CN109652320A - A kind of biological and ecological methods to prevent plant disease, pests, and erosion DSE bacterial strain LS1 and its application on banana blight - Google Patents
A kind of biological and ecological methods to prevent plant disease, pests, and erosion DSE bacterial strain LS1 and its application on banana blight Download PDFInfo
- Publication number
- CN109652320A CN109652320A CN201811571220.4A CN201811571220A CN109652320A CN 109652320 A CN109652320 A CN 109652320A CN 201811571220 A CN201811571220 A CN 201811571220A CN 109652320 A CN109652320 A CN 109652320A
- Authority
- CN
- China
- Prior art keywords
- root
- banana
- bacterial strain
- dse
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Virology (AREA)
- Agronomy & Crop Science (AREA)
- Dentistry (AREA)
- Plant Pathology (AREA)
- Pest Control & Pesticides (AREA)
- Environmental Sciences (AREA)
- Botany (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biomedical Technology (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention provides a kind of biological and ecological methods to prevent plant disease, pests, and erosion DSE bacterial strain LS1 and its application on banana blight, which is CGMCC NO.16498, and the preservation time started is on November 8th, 2018.The present invention has screened one plant of biological and ecological methods to prevent plant disease, pests, and erosion DSE bacterial strain LS1 by indoor plate and potted plant experiment, and plate control efficiency is up to 86.19%, and potting control efficiency is 63.19%.Preventive effect performance of the bacterial strain in plate and pot experiment can be said to be more stable.
Description
Technical field
The present invention relates to a kind of microorganism field more particularly to a kind of DSE bacterial strainsCladosporium chlorocephalumBiocontrol Effect of the LS1 to banana blight.
Background technique
Banana is the important industrial crops in south China subtropical zone.Guangxi banana planting area about 90,000 is public within 2013
Hectare, it 275.2 ten thousand tons of yield, is doubled compared to 2005 annual outputs.But since the scale continuous cropping of banana is planted, cause
Soil-borne disease banana blight (Fusarium oxysporum f. sp. cubense) multiple harm.The disease can cause
Diseased plant is wilting, vascular bundle is downright bad, and seriously ill field disease incidence is up to 90%, the serious development for restricting Guangxi banana industry[1-2].By anti-
Sick variety yield is bad, the restriction of the undesirable equal means of prevention of Agro-chemicals control, economic and environmental protection biological prevention by
Gradually become the research hotspot for preventing and treating the disease.
For at present, it is that a kind of mycelia is dark that dark color, which has every endogenetic fungus (Dark Septate Endophyte, DSE),
There is separation, soil sac fungus or the Fungi Imperfecti of " Microsclerotia " can be formed, colonizes plant root tissue is intracellular or space between cells,
To host's no pathogenicity.Many studies have shown that DSE can with host's mutualistic symbiosis, degeneration-resistant, growth-promoting, in terms of all play
Positive ecological functions, and it is colonized extensively, host is non-specific, so that plant-DSE homobium is used as after leguminous plant-root
The form of expression of another plant after tumor homobium, mycorrhizas homobium and microbe symbiotic relationship, mycorrhizal research field by
Gradually it is taken seriously.2017, Zhang Xiaorong etc. passed through the inoculation sweet Saksenaea vasiformis of DSE fungiPhialophora musteaK36 and Z48 is aobvious
It writes and alleviates the symptom that tomato is inhibited growth by Fusarium oxysporum；Pretty one plant of the equal screenings acquisition of agriculture has banana blight anti-compared with Johnson & Johnson
The DSE bacterial strain L-14(of ability splits shell bacteriumSchizotheciumSp.).2018, the discovery such as Surono was inoculated with DSE on asparagus
FungiPhialocepahala fortiniiCKG.I.11 can promote the growth of asparagus and have inhibiting effect to wilt disease.
Summary of the invention
In research before, applicant have found that having the DSE bacterial strain of excellent Biocontrol Effect to banana blight, but quantity is still
It is very limited, in order to which the research and development of composite bacteria agent from now on still need to increase the screening dynamics of strain excellent.For this purpose, the purpose of the present invention is
The measurement of biocontrol effect is carried out to other DSE bacterial strains that this laboratory saves, and carries out taxonomic identification.The present invention is directed to screen to obtain
Banana blight biocontrol bacterial strain efficiently, stable is obtained, provides more abundant strain for the exploitation of banana blight biocontrol agent
Resource.
A kind of endogenetic fungus LS1 preventing and treating banana blight, deposit number are CGMCC NO.16498, and the preservation time is 2018
On November 8, in.Depositary institution: CGMCC- China General Microbiological culture presevation administrative center, classification naming: Cladosporium
chlorocephalum；Preservation address: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3.
The present invention provides a kind of biological and ecological methods to prevent plant disease, pests, and erosion DSE bacterial strain LS1 and its application on banana blight, and application method includes such as
Under several steps:
Step A: strain inoculated and its influence to Banana Growth: being inoculated on oat medium after activating for examination DSE bacterial strain,
It chooses the consistent tissue culture seedlings of bananas of growing way to transplant to bacterium colony, root system is laid in bacterium colony surface, and each bacterium colony transplants one plant, culture
Ware is put to tissue culture bottle, is put into incubator and is cultivated；Measure the wide plant height of banana, stem, fresh weight and dry weight；The part respectively handled is fresh
Banana Root sample is observed and is separated again for colonizing for DSE, and the sample quality of reserved part is recorded, and rest part dries after weighing fresh weight
Case is dry to constant weight, measures dry weight, calculates average moisture content, and by new fresh root sample reserved before calculated together after converting into
Dry weight;
Step B: bacterial strain separates again and colonizes detection: taking proper amount of fresh root sample, cuts in segment holding test tubes, KOH solution is added
It is totally submerged root segment, is dissociated in thermostat water bath, keeps root segment softening transparent, clear water is rinsed and soaked after being dyed with ink vinegar
Bubble decoloration, observation DSE and calculate the rate that colonizes and (colonize rate %=(colonize root segment number/by microscopy root in the situation that colonizes of banana root
Section sum) × 100%);
Step C: bacterial strain measures the control efficiency of banana blight: DSE- banana homobium (together with oat medium) is moved
On to the water agar with sickle-like bacteria, the control tissue culture seedlings of bananas for not connecing bacterium is directly accessed the water agar with sickle-like bacteria
On plate;It observes and records disease grade, calculate disease index and control efficiency;
Step D: the taxonomic identification of biocontrol bacterial strain: colony characteristics of the observation bacterial strain in PDA culture medium, and pass through coverslip oblique cutting
Method, make mycelia it is raw on the cover slip, the hypha form on optical microphotograph microscopic observation coverslip.
Preferably, in the step A, the oat medium is used: 10 gL of oatmeal-1, 18 gL of agar-1,
MgSO4·7H2O 1g·L-1, KH2PO4 1.5g·L-1, NaNO3 1g·L-1, 3 fungus blocks of every ware, 28 DEG C of culture 10d.
Preferably, in the step A, tissue culture bottle, in 28 DEG C, 180 μm of olm of light intensity-2·s-2, photoperiod 16h:8h
Incubator in cultivate 40 d.
Preferably, in the step B, it is that 10% KOH solution is totally submerged root segment that mass concentration, which is added, in 90 DEG C of constant temperature
15-20 min is dissociated in water-bath, keeps root segment softening transparent, after being dyed with ink vinegar (volume ratio: ink 5: rice vinegar 95)
Clear water rinses 3 times, and impregnates 12 h decoloration.
Preferably, in the step C, severity Scaling standard: 0 grade-appearance is without Visual symptoms；1 grade-plant growing way is without obvious
It is obstructed, complete stool Huang withers area≤35%；2 grades-plant is small and weak, and 35% < complete stool Huang withers area≤80%；3 grades-complete stool Huang withers area >
80%。
Preferably, in the step C, potting biological and ecological methods to prevent plant disease, pests, and erosion test takes the Banana Seedlings of 4 leaf phase sizes to carry out；Preparation 5 × 105
cfu mL-1DSE bacterium solution carry out root irrigation.Every plant of banana seedlings pouring root 50mL bacterium solution fills primary every 15d, fills altogether three times.
After last time pouring root terminates 10-15d, banana seedlings are carried out hurting root and are inoculated with sickle-like bacteria spore liquid (1 × 106 cfu mL-1).
Preferably, with clear water pouring root and the processing of pathogen is inoculated with as control (CK).25d dissection is fragrant after being inoculated with pathogen
Any of several broadleaf plants bulb observes and records incidence and calculates preventive effect.3 repetitions of every processing, every 8 young plant of repetition.Severity Scaling standard: 0 grade-
Bulb health is without discoloration；1 grade: bulb discoloration area accounts for bulb area < 20%；2 grades: 20%≤bulb discoloration area accounts for bulb face
Product < 40%；3 grades: 40%≤bulb discoloration area accounts for the < 60% of bulb area；4 grades: 60%≤bulb discoloration area accounts for bulb face
Product < 80%；5 grades: bulb discoloration area accounts for bulb area >=80%.
Calculation formula: disease index=∑ (diseased plant series × represent numerical value)/(strain number summation × highest disease grade typical value)；
Control efficiency (%)=[(control disease index-processing disease index) × 100]/control disease index
Preferably, in the step D, when induction produces spore, 4 DEG C is placed and is cultivated 2-4 weeks.
Preferably, in the step D, mycelium total DNA is extracted using OMEGA fungal DNA extraction kits, amplimer
For ITS1:5 '-TCCGTAGGTGAACCTGCGG -3 ' and ITS4:5 '-TCCTCCGCTTATTGATATGC -3 '.Expand body
It is 50 μ l, wherein containing: MasterMix(TIANgel) 25 μ l, each 1 μ l of 1 μ l, DNA of 20 μm of positive anti-primers of ol L-1,
DdH2O constant volume.Amplification program: 98 DEG C of 2 min of initial denaturation；94 DEG C of denaturation 40 s, 50 DEG C of annealing 1 min, 68 DEG C of 4 min of extension,
30 circulations；Last 72 DEG C of extensions 10min.
For a long time, the control efficiency difference of indoor antibacterial test and field controling test is that biological prevention is effective greatly
One big problem of application.Colonized inside the root of plant in view of DSE in " DSE- plant " homobium rather than the characteristics of surface, we
DSE is applied in the prevention and treatment of soil-borne disease banana blight, to can be reduced other edaphons to the shadow of biocontrol bacterial strain
It rings, to reduce the unstability of preventive effect.
The present invention has screened one plant of biological and ecological methods to prevent plant disease, pests, and erosion DSE bacterial strain LS1, plate control efficiency by indoor plate and potted plant experiment
Up to 86.19%, potting control efficiency is 63.19%.It is steady that preventive effect performance of the bacterial strain in plate and pot experiment can be said to be comparison
Fixed, how field application preventive effect, which also needs further to test, confirms.Other 4 plants of DSE bacterial strains in experiment also can table to banana
Now certain Biocontrol Effect, but potted plant experiment preventive effect is undesirable.
Detailed description of the invention
Fig. 1 is bacterial strain LS1 Morphological Identification figure of the present invention.Wherein A is the colonial morphology in PDA culture medium；B is to produce falx
And conidium；C is conidium.
Fig. 2 is mycelia and germ nuclear structure of the DSE in Banana Root in the present invention, wherein arrow show Microsclerotia.
Fig. 3 is that present invention difference DSE colonizes rate and compares figure.
Biocontrol effect of Fig. 4 difference DSE bacterial strain to banana blight.
Fig. 5 is the phylogenetic tree of bacterial strain LS1 and related strain based on ITS segment of the present invention.
Specific embodiment
With reference to the accompanying drawing, preferably embodiment of the invention is described in further detail:
Embodiment 1
The separation material requested and method of bacterial strain LS1 is as follows:
1. material
With acquiring Nanning suburban district sugarcane rhizosphere soil sample, 4 DEG C save for use.
Select eggplant seed, the surface of the seed sterilization method: 75% 20 seconds → mass concentration of alcohol of volumetric concentration, 1% sodium hypochlorite
Oscillation disinfection 40s → sterile water oscillation is rinsed to be placed on pure agar plate three times → aseptic filter paper suck dry moisture → and be cultivated 2-3 days,
Budding grows up to aseptic seedling.2. the separation of bacterial strain LS1 (soil into mixed culture matrix by the sterile eggplant transplantation of seedlings of above-mentioned acquisition
Sample and sterilizing nursery soil weight ratio 2:1), it plants 50 to 60 days, rinses the soil matrix of eggplant root attachment well with tap water, adopt
With the concussion of 0.5% Tween-20 of mass concentration disinfection 3 times, 1 minute every time, after aqua sterilisa concussion is rinsed 3 times, suck dry moisture was placed on
Weight concentration is to cultivate in 28 DEG C of incubators and observe day by day, grow to mycelia from root segment position on 1/2 maize powder medium
It is transferred in time on potato dextrose medium (PDA) afterwards, obtains pure culture bacterial strain.
The taxonomic identification of biocontrol bacterial strain:
1. the morphological observation of bacterial strain LS1
Bacterial strain is activated on potato dextrose medium (PDA), culture observed colony morphology characteristic after 14 days.Use inserted sheet
The bacterial strain of purifying is connected to oat medium by method, and 28 DEG C are cultivated 2 weeks, wait be clearly visible mycelia give birth on the cover slip when, as 4
It in 4 weeks -6 weeks in DEG C refrigerator, induces its to generate conidium, slide is taken out, is observed under optical microscopy.
2. the Molecular Identification of bacterial strain LS1
Endogenetic fungal bacterial strain LS1 is incubated at potato dextrose broth (PDB), in 28 DEG C of revolving speed 120r/min shaking tables
After middle shake culture 10-14d, mycelia is collected by filtration.Mycelium total DNA is extracted using OMEGA fungal DNA extraction kits, is expanded
Increasing primer is ITS1:5 '-TCCGTAGGTGAACCTGCGG -3 ' and ITS4:5 '-TCCTCCGCTTATTGATATGC -3 '.
50 μ l of amplification system, wherein containing: MasterMix(TIANgel) 25 μ l, each 1 μ l, DNA 1 of 20 μm of positive anti-primers of ol L-1
μ l, ddH2O constant volume.Amplification program: 98 DEG C of 2 min of initial denaturation；94 DEG C of 40 s of denaturation, 50 DEG C of 1 min of annealing, 68 DEG C extend 4
Min, 30 circulations；Last 72 DEG C of extensions 10min.Product sequencing is completed by Shanghai Sheng Gong biotechnology Co., Ltd.
Sequence is analyzed using ClustalX 1.81 and BioEdit v7.0 software, tests the ITS1/ITS4 sequence of acquisition
Column and its most like sequence downloaded in GenBank are constructed using MEGA6.06 software based on Kimura two-parameter model
Neighbor-Joining phylogenetic tree, the reliability through bootstrap1000 loop checking system tree.
3. the Morphological Identification of bacterial strain LS1
Morphological Identification: bacterial strain LS1 speed of growth in PDA culture medium is moderate, after 28 DEG C are cultivated 2 weeks, colony diameter about 70
Mm, bacterium colony is round, brown to breen, terry-like, flush edge, there is shallow radial rill, back side dark brown (Figure 1A).It is aobvious
Micro- microscopic observation visible LS1 mycelia branch has every, yellowish-brown to brown, smooth, heavy wall, and 1.4-4.7 μm of diameter.Conidium
Stalk uprightly generates on the top of mycelia or side shoot, not branch, and brown is smooth, has every size is 22.4-386.7 × 2.7-
5.2 μm (Figure 1B).Conidiophore top and middle part expand to form conidiogenous cell, expand 3.7-6.3 μm of position.Branch is mitogenetic
Spore is mostly cylindricality, and part-elliptical, largely middle part is slightly shunk, and has 0-2 separation, and conidia chain is raw thereon, and chain is raw
A spore is generated on spore or again, then the raw spore of chain, branch spore size are 6.4-28.5 × 2.0-5.6 μm.It is conidium subcircular, ellipse
There are spore navel, 3.4-8.4 × 2.2-4.7 μ in round, lemon shape or spindle, yellowish-brown, no separation, part spore both ends or one end
m；Subcircular spore diameter is 2.4-7.6 μm.(Fig. 1 C).Features described above in the prior art to green head branch sporeCladosporium chlorocephalumMorphological feature description be consistent substantially.
4. sequence analysis and Phylogenetic Analysis
To the target fragment for obtaining a treaty 550bp after the ITS fragment amplification of LS1 bacterial strain, purifying, sequencing, GenBank is submitted to obtain
The number of logining MH376857 is obtained, sequence carries out Blastn analysis in NCBI, and discovery LS1 is respectively separated with Thamnidium Cladosporium
The sequence similarity of object is 99% or more；Using Bensch K(Studies in Mycology, 2015,82 (82): 23-
74) correlated series downloaded in sequence and GenBank in text, construct the phylogenetic tree (Fig. 5) based on ITS sequence, find
It is one that LS1 and C. chlorocephalum, C. tenuissimum, which gather, supporting rate 89%, and bacterial strain LS1 and C.
The ITS sequence similitude of chlorocephalum is 100%.Bacterial strain LS1 is accredited as green head cladosporium by Comprehensive analysis results
Cladosporium chlorocephalum。
Embodiment 2
1. material and method
1.1 experimental material
Strains tested: being obtained by this laboratory 2016 from the separation of sugarcane rhizosphere soil, number be respectively LS1, LC8, B2,
MS38、TD1。
For trying tissue culture seedlings of bananas: osmanthus any of several broadleaf plants No. 6, being provided by guangxi plant tissue-cultured seedling Co., Ltd.
For trying pathogen: reaping hook germina number-four biological strain (FOC4).
1.2 experimental method
1.2.1 strain inoculated and its influence to Banana Growth
It will be for being inoculated on oat medium (10 gL of oatmeal after examination DSE bacterial strain activation-1, 18 gL of agar-1,
MgSO4·7H2O 1g·L-1, KH2PO4 1.5g·L-1, NaNO3 1g·L-1), 3 fungus blocks of every ware, 28 DEG C of culture 10-14d.Choosing
The consistent tissue culture seedlings of bananas of growing way is taken to transplant to bacterium colony, root system is laid in bacterium colony surface, and each bacterium colony transplants one plant, culture dish
It puts to tissue culture bottle, in 28-30 DEG C, 160-180 μm of olm of light intensity-2·s-2, photoperiod 16h:8h incubator in cultivate 40
D or so, not to be inoculated with the processing of DSE bacterial strain as control, 3 repetitions of each processing, every 10 ware of repetition.Measure plant height, the stem of banana
Wide, fresh weight and dry weight.The fresh Banana Root sample in the part respectively handled is observed and is separated again for colonizing for DSE, and reserved part is recorded
Sample quality, rest part weighs fresh weight and is placed on 70 DEG C of oven drying 70-75h to constant weight, measure dry weight, calculate average
Water content, and new fresh root sample reserved before is calculated together after converting into dry weight.
1.2.2 bacterial strain separates again and colonizes detection
Proper amount of fresh root sample is taken, tap water is cut into about 1 cm segment after rinsing well is placed in clean 50 mL test tube, is added
10% KOH solution is totally submerged root segment, and 15-20 min is dissociated in 90 DEG C of thermostat water baths, keeps root segment softening transparent, with ink
Clear water rinses 3 times after water vinegar (volume ratio ink 5: rice vinegar 95) is dyed, and impregnates 10-14 h decoloration, in optical microscopy
Lower observation DSE and calculates the rate that colonizes and (colonizes rate %=(colonize root segment number/total by microscopy root segment in the situation that colonizes of banana root
Number) × 100%).DSE's separates again.
1.2.3 bacterial strain measures the control efficiency of banana blight
Plate and potting biological and ecological methods to prevent plant disease, pests, and erosion experiment: DSE- banana homobium (together with oat medium) is moved to the water agar with sickle-like bacteria
On culture medium, the control tissue culture seedlings of bananas for not connecing bacterium is directly accessed on the water agar plate with sickle-like bacteria.Each processing repeats
10 wares.It observes and records disease grade, calculate disease index and control efficiency.Severity Scaling standard: 0 grade-appearance is without Visual symptoms；1 grade-
Without being obviously obstructed, complete stool Huang withers area≤35% plant growing way；2 grades-plant is small and weak, and 35% < complete stool Huang withers area≤80%；3 grades-
Complete stool Huang withers area > 80%.
Potting biological and ecological methods to prevent plant disease, pests, and erosion test takes the Banana Seedlings of 4 leaf phase sizes to carry out.Preparation 5 × 105 cfu mL-1DSE bacterium solution carry out
Root irrigation.Every plant of banana seedlings pouring root 50mL bacterium solution fills primary every 15d, fills altogether three times.Terminate 15d in last time pouring root
Afterwards, banana seedlings are carried out hurting root and is inoculated with sickle-like bacteria spore liquid (1 × 106 cfu mL-1).With clear water pouring root and it is inoculated with pathogen
Processing be control (CK).25d dissects banana bulb after being inoculated with pathogen, observes and records incidence and calculates preventive effect.Often
Handle 3 repetitions, every 8 young plant of repetition.Severity Scaling standard: 0 grade-bulb health is without discoloration；1 grade: bulb discoloration area accounts for ball
Stem area < 20%；2 grades: 20%≤bulb discoloration area accounts for bulb area < 40%；3 grades: 40%≤bulb discoloration area accounts for bulb
The < 60% of area；4 grades: 60%≤bulb discoloration area accounts for bulb area < 80%；5 grades: bulb discoloration area account for bulb area >=
80%。
Calculation formula: disease index=∑ (diseased plant series × represent numerical value)/(strain number summation × highest disease grade typical value)；
Control efficiency (%)=[(control disease index-processing disease index) × 100]/control disease index.
1.2.4 the taxonomic identification of biocontrol bacterial strain
The morphological observation of DSE is carried out referring to the method for Lan Taoju etc., observes colony characteristics of the bacterial strain in PDA culture medium, and
By coverslip oblique cutting method, make mycelia it is raw on the cover slip, the hypha form on optical microphotograph microscopic observation coverslip.Induction
When producing spore, places 4 DEG C and cultivate 2-4 weeks.
Mycelium total DNA is extracted using OMEGA fungal DNA extraction kits, amplimer ITS1:5 '-
TCCGTAGGTGAACCTGCGG -3 ' and ITS4:5 '-TCCTCCGCTTATTGATATGC -3 '.50 μ l of amplification system, wherein
Contain: MasterMix(TIANgel) 25 μ l, each 1 μ l, ddH2O constant volume of 1 μ l, DNA of 20 μm of positive anti-primers of ol L-1.Amplification
Program: 98 DEG C of 2 min of initial denaturation；94 DEG C of 40 s of denaturation, 50 DEG C of 1 min of annealing, 68 DEG C of 4 min of extension, 30 recycle；Last 72
DEG C extend 10min.Product sequencing is completed by Shanghai Sheng Gong biotechnology Co., Ltd.By NCBI Blastn to acquisition
Sequence is compared, and carries out systematic evolution tree building using MEGA6.0 program.
2. result and analysis
Influence of 2.1 inoculating strains to Banana Growth
It has been observed that each long important and influential persons of processing of the banana plant of inoculation DSE processing than not being inoculated with DSE after inoculation DSE bacterial strain 40d
It is good.Seen from table 1, inoculation DSE can effectively improve the wide plant height of banana plant, stem, fresh weight and dry weight, and growth rate is respectively
4.49%~21.91%, 3.66%~30.37%, 18.42%~47.36%, 35.9%~42.40%, wherein after inoculating strain LS1
Banana plant plant height, stem be wide, fresh weight and dry weight reach the significance level of difference compared with the control, and fresh weight relatively compares respectively with dry weight
Increase by 47.36% and 42.40%.
The influence that 1 difference DSE bacterial strain of table grows tissue culture seedlings of bananas
2.2 DSE colonizing in banana root system
Using the tissue culture seedlings of bananas root sample after inoculation DSE bacterial strain 40d under aseptic condition as material, it is separated to and is inoculated with from root system
The consistent endogenetic fungus of DSE cultural colony, morphosis shows that " DSE- banana " syntaxial system has built up after being inoculated with 40d.It is right
After the dissociation dyeing of Banana Root sample, carry out micro- sem observation, have found mycelia that is dark, having tabula, sample segment it is observed that
The DSE such as " Microsclerotia " typical structure (Fig. 2).5 plants of DSE bacterial strains colonize rate between 30%-45%, and bacterial strain LS1, TD1, B2's determines
It is higher to grow rate, and difference is not significant, bacterial strain LC8 to colonize rate minimum (Fig. 3).
Biocontrol effect of 2.3 DSE to banana blight
As shown in figure 4, the banana plant respectively handled produces strong and weak different resist to banana blight after 5 plants of DSE bacterial strains of inoculation
Characteristic of disease, plate preventive effect is between 57.76%-86.19%, and potting preventive effect is between 12.69%-63.19%.Wherein bacterial strain LS1 is handled
Banana plant performance control efficiency it is best, and with other bacterial strains processing reach the significance level of difference.It can be seen that bacterial strain LS1 is one
The endogenetic fungus of strain tool Biocontrol Potential, carries out further taxonomic identification to it.
The taxonomic identification of 2.4 biocontrol bacterial strain LS1
Morphological Identification: bacterial strain LS1 speed of growth in PDA culture medium is moderate, after 28 DEG C are cultivated 2 weeks, colony diameter about 70
Mm, bacterium colony is round, brown to breen, terry-like, flush edge, there is shallow radial rill, back side dark brown (Figure 1A).It is aobvious
Micro- microscopic observation visible LS1 mycelia branch has every, yellowish-brown to brown, smooth, heavy wall, and 1.4-4.7 μm of diameter.Conidium
Stalk uprightly generates on the top of mycelia or side shoot, not branch, and brown is smooth, has every size is 22.4-386.7 × 2.7-
5.2 μm (Figure 1B).Conidiophore top and middle part expand to form conidiogenous cell, expand 3.7-6.3 μm of position.Branch is mitogenetic
Spore is mostly cylindricality, and part-elliptical, largely middle part is slightly shunk, and has 0-2 separation, and conidia chain is raw thereon, and chain is raw
A spore is generated on spore or again, then the raw spore of chain, branch spore size are 6.4-28.5 × 2.0-5.6 μm.It is conidium subcircular, ellipse
There are spore navel, 3.4-8.4 × 2.2-4.7 μ in round, lemon shape or spindle, yellowish-brown, no separation, part spore both ends or one end
m；Subcircular spore diameter is 2.4-7.6 μm.(Fig. 1 C).Noted down in features described above and document to green head branch sporeCladosporium chlorocephalumMorphological feature description be consistent substantially.
Molecular Identification: the purpose of a treaty 550bp is obtained after carrying out ITS amplification using ITS primer pair LS1 bacterial strain total DNA
PCR product band, by PCR product it is purified after be sequenced, submit GenBank to obtain the number of logining MH376857, sequence exists
Blastn analysis is carried out in NCBI, finds LS1 and ThamnidiumCladosporiumThe sequence similarity of each isolate 99% with
On；Using Bensch K(Studies in Mycology, 2015,82 (82): 23-74) in text in sequence and GenBank under
The correlated series of load, construct the phylogenetic tree (Fig. 5) based on ITS sequence, discovery LS1 withC. chlorocephalum、C. tenuissimumGathering is one, supporting rate 89%, and bacterial strain LS1 withC. chlorocephalumITS sequence similitude be
100%。
Bacterial strain LS1 is accredited as green head cladosporium by Comprehensive analysis resultsCladosporium chlorocephalum。
Classification position in relation to DSE is one of urgent problem to be solved in current DSE research.Since most DSE can trained
Invisible element exists under the conditions of supporting, and Perfect stage seldom occurs, and brings difficulty to morphological classification.At present by Molecular Identification
Technology, being accredited the DSE come out includes more than 10 categories, and polyphyly is presented in about 30 kinds of fungi.The present invention passes through morphology
Bacterial strain LS1 is accredited as green head cladosporium by the means combined with Molecular IdentificationCladosporium chlorocephalum。
The green head cladosporium obtained is separated by being inoculated on banana from sugarcane rhizosphere soilCladosporium chlorocephalumLS1, plant height, the stem for effectively increasing banana be wide, fresh weight and dry weight.And after the completion of being inoculated with, LS1- banana
Homobium is to the plate preventive effect of banana blight up to 86.19%, and potting preventive effect is up to 63.19%.It can be seen that the bacterium is one plant great
The beneficial biocontrol microorganisms of research and utilization value.
The above content is a further detailed description of the present invention in conjunction with specific preferred embodiments, and it cannot be said that
Specific implementation of the invention is only limited to these instructions.For those of ordinary skill in the art to which the present invention belongs, exist
Under the premise of not departing from present inventive concept, a number of simple deductions or replacements can also be made, all shall be regarded as belonging to of the invention
Protection scope.
Sequence table
<110>Guangxi Autonomous Region Academy of Agricultural Sciences
<120>a kind of biological and ecological methods to prevent plant disease, pests, and erosion DSE bacterial strain LS1 and its application on banana blight
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> ITS1
<400> 1
tccgtaggtg aacctgcgg 19
<210> 2
<211> 20
<212> DNA
<213> ITS4
<400> 2
tcctccgctt attgatatgc 20
Claims (10)
1. a kind of biological and ecological methods to prevent plant disease, pests, and erosion DSE bacterial strain LS1, which is characterized in that deposit number is CGMCC NO.16498, and the preservation time is 2018 11
The moon 8.
2. a kind of application of biological and ecological methods to prevent plant disease, pests, and erosion DSE bacterial strain LS1 on banana blight, which is characterized in that comprise the following steps:
Step A: strain inoculated and its influence to Banana Growth: being inoculated on oat medium after activating for examination DSE bacterial strain,
It chooses the consistent tissue culture seedlings of bananas of growing way to transplant to bacterium colony, root system is laid in bacterium colony surface, and each bacterium colony transplants one plant, culture
Ware is put to tissue culture bottle, is put into incubator and is cultivated；Measure the wide plant height of banana, stem, fresh weight and dry weight；The part respectively handled is fresh
Banana Root sample is observed and is separated again for colonizing for DSE, and the sample quality of reserved part is recorded, and rest part dries after weighing fresh weight
Case is dry to constant weight, measures dry weight, calculates average moisture content, and by new fresh root sample reserved before calculated together after converting into
Dry weight;
Step B: bacterial strain separates again and colonizes detection: taking proper amount of fresh root sample, cuts in segment holding test tubes, KOH solution is added
It is totally submerged root segment, is dissociated in thermostat water bath, keeps root segment softening transparent, clear water is rinsed and soaked after being dyed with ink vinegar
Bubble decoloration, observation DSE and are calculated in the situation that colonizes of banana root and are colonized rate: colonizing rate %=(colonize root segment number/by microscopy root
Section sum) × 100%;
Step C: bacterial strain measures the control efficiency of banana blight: DSE- banana homobium (together with oat medium) is moved
On to the water agar with sickle-like bacteria, the control tissue culture seedlings of bananas for not connecing bacterium is directly accessed the water agar with sickle-like bacteria
On plate;It observes and records disease grade, calculate disease index and control efficiency;
Step D: the taxonomic identification of biocontrol bacterial strain: colony characteristics of the observation bacterial strain in PDA culture medium, and pass through coverslip oblique cutting
Method, make mycelia it is raw on the cover slip, the hypha form on optical microphotograph microscopic observation coverslip.
3. application as claimed in claim 2, which is characterized in that in the step A, the oat medium is used: oatmeal
10 g·L-1, 18 gL of agar-1, MgSO4·7H2O 1g·L-1, KH2PO4 1.5g·L-1, NaNO3 1g·L-1, 3, every ware
Fungus block, 28 DEG C of culture 10d.
4. application as claimed in claim 2, which is characterized in that in the step A, tissue culture bottle, in 28 DEG C, 180 μ of light intensity
mol·m-2·s-2, photoperiod 16h:8h incubator in cultivate 30-40 d.
5. application as claimed in claim 2, which is characterized in that in the step B, addition mass concentration is 10% KOH solution
It is totally submerged root segment, 15-20 min is dissociated in 90 DEG C of thermostat water baths, keeps root segment softening transparent, is dyed with ink vinegar
Clear water rinses 3 times afterwards, and impregnates 12 h decoloration.
6. application as claimed in claim 2, which is characterized in that in the step C, severity Scaling standard: 0 grade-appearance can not
See symptom；Without being obviously obstructed, complete stool Huang withers area≤35% 1 grade-plant growing way；2 grades-plant is small and weak, and 35% < complete stool Huang withers face
Product≤80%；3 grades-complete stool Huang withers area > 80%.
7. application as claimed in claim 2, which is characterized in that in the step C, potting biological and ecological methods to prevent plant disease, pests, and erosion test takes 4 leaf phase sizes
Banana Seedlings carry out；Preparation 5 × 105 cfu mL-1DSE bacterium solution carry out root irrigation, every plant of banana seedlings pouring root 50mL bacterium solution,
It fills primary every 15d, fills three times altogether, after last time pouring root terminates 15d, banana seedlings are carried out hurting root and are inoculated with sickle-like bacteria spore
Sub- liquid (1 × 106 cfu mL-1).
8. the use as claimed in claim 7, which is characterized in that with clear water pouring root and be inoculated with the processing of pathogen as control
(CK), 25d dissects banana bulb after being inoculated with pathogen, observes and records incidence and calculates preventive effect, 3 repetitions of every processing,
Every 8 young plant of repetition.
9. application as described in claim 1, which is characterized in that in the step D, when induction produces spore, place 4 DEG C of culture 2-4
Week.
10. application as described in claim 1, which is characterized in that in the step D, mycelium total DNA uses OMEGA fungi
DNA extraction kit is extracted, amplimer ITS1:5 '-TCCGTAGGTGAACCTGCGG -3 ' and ITS4:5 ' -
TCCTCCGCTTATTGATATGC -3 ', 50 μ l of amplification system, wherein containing: MasterMix(TIANgel) 25 μ l, 20 μm of ol
Each 1 μ l, ddH2O constant volume of 1 μ l, DNA of the positive anti-primer of L-1；Amplification program: 98 DEG C of 2 min of initial denaturation；94 DEG C of denaturation 40 s, 50
DEG C annealing 1 min, 68 DEG C of extensions 4 min, 30 recycle；Last 72 DEG C of extensions 10min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811571220.4A CN109652320B (en) | 2018-12-21 | 2018-12-21 | Biocontrol DSE strain LS1 and application thereof in banana wilt |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811571220.4A CN109652320B (en) | 2018-12-21 | 2018-12-21 | Biocontrol DSE strain LS1 and application thereof in banana wilt |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109652320A true CN109652320A (en) | 2019-04-19 |
| CN109652320B CN109652320B (en) | 2021-11-16 |
Family
ID=66116090
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811571220.4A Active CN109652320B (en) | 2018-12-21 | 2018-12-21 | Biocontrol DSE strain LS1 and application thereof in banana wilt |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109652320B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103981101A (en) * | 2014-05-23 | 2014-08-13 | 广西壮族自治区农业科学院微生物研究所 | DSE (Dark Septate Endophyte) strain and application of DSE strain in production of sugarcane |
-
2018
- 2018-12-21 CN CN201811571220.4A patent/CN109652320B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103981101A (en) * | 2014-05-23 | 2014-08-13 | 广西壮族自治区农业科学院微生物研究所 | DSE (Dark Septate Endophyte) strain and application of DSE strain in production of sugarcane |
Non-Patent Citations (1)
| Title |
|---|
| 农倩: "一株抗香蕉枯萎病DSE菌株的筛选鉴定及抗病机理初探", 《热带作物学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109652320B (en) | 2021-11-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100584938C (en) | Plants endogenetic fungus and application thereof | |
| Sandoval-Denis et al. | New Fusarium species from the Kruger national park, south Africa | |
| CN102839131B (en) | Trichoderma viride and application thereof | |
| CN103160442B (en) | Paecilomyceslilacinus strain having strong pathogenicity for diaphorina citri | |
| Diene et al. | Pseudosigmoidea ibarakiensis sp. nov., a dark septate endophytic fungus from a cedar forest in Ibaraki, Japan | |
| CN107058160B (en) | One plant of peanut rhizosphere bacillus amyloliquefaciens and its application | |
| CN113943660B (en) | Talaromyces fungus NJAU-L8 for preventing and controlling continuous cropping soil-borne blight and application thereof | |
| CN104805019B (en) | One plant of endogenetic fungus that can promote aleurite montana Nutrient Absorption | |
| CN102586120B (en) | Endophytic fungi CEF08111 of cotton and application thereof in prevention and treatment of cotton verticillium wilt | |
| CN105861332B (en) | A kind of bacterial strain of the promotion with leaf pocket orchid plant strain growth and its application | |
| CN115537358A (en) | Bacillus belgii YFB3-1 and separation, screening and identification method and application thereof | |
| CN106520566B (en) | One plant of Antagonistic Fungus for preventing and treating bitter gourd wilt and its application | |
| CN103146609B (en) | Pseudomonas fluorescens and method for preventing phytophthora capsici thereby | |
| CN110343621A (en) | A kind of Trichoderma asperellum strain and its application | |
| CN107893034B (en) | A kind of identification of needle mushroom pathogenetic bacteria and the screening technique of disease-resistant white gold needle mushroom bacterial strain | |
| CN114032182A (en) | Fungus with functions of antagonizing garlic root rot pathogenic bacteria and promoting growth | |
| CN113862156A (en) | Fusarium oxysporum (Fusarium oxysporum) K2018-1418 and application thereof | |
| CN103468579B (en) | New lecanicillium bacteria genus fungi specie providing pathogenicity for diaphorina citri | |
| CN106212277A (en) | A kind of method producing Rhizoma Zingiberis Recens mycorhiza tissue culture of sprout | |
| Xie et al. | A endophytic fungus, Ramichloridium cerophilum, promotes growth of a non-mycorrhizal plant, Chinese cabbage | |
| CN105462882B (en) | A kind of pseudomonas aeruginosa and its application for preventing crop verticillium wilt | |
| CN105462854B (en) | Application of the sophora tonkinensis Gapnep endogenetic fungus SDTE-P in prevention and treatment Radix Notoginseng anthracnose | |
| Yamamoto et al. | Endogone corticioides sp. nov. from subalpine conifer forests in Japan and China, and its multi-locus phylogeny | |
| CN105462890A (en) | Application of sophora tonkinensis endophytic bacterium B22 in preventing and controlling panax notoginseng root rot | |
| CN110468060A (en) | A kind of general bacteria strain and its application in biological control |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |