CN109628597A - A kind of primer, kit and the detection method of CRP and miR-365-3p joint-detection gastric cancer - Google Patents
A kind of primer, kit and the detection method of CRP and miR-365-3p joint-detection gastric cancer Download PDFInfo
- Publication number
- CN109628597A CN109628597A CN201910057855.0A CN201910057855A CN109628597A CN 109628597 A CN109628597 A CN 109628597A CN 201910057855 A CN201910057855 A CN 201910057855A CN 109628597 A CN109628597 A CN 109628597A
- Authority
- CN
- China
- Prior art keywords
- mir
- crp
- detection
- seq
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 108091030670 miR-365 stem-loop Proteins 0.000 title claims abstract description 53
- 208000005718 Stomach Neoplasms Diseases 0.000 title claims abstract description 48
- 206010017758 gastric cancer Diseases 0.000 title claims abstract description 47
- 201000011549 stomach cancer Diseases 0.000 title claims abstract description 46
- 108091043604 miR-365-1 stem-loop Proteins 0.000 title claims abstract description 43
- 108091076262 miR-365-2 stem-loop Proteins 0.000 title claims abstract description 43
- 238000001514 detection method Methods 0.000 title claims abstract description 41
- 238000006243 chemical reaction Methods 0.000 claims abstract description 24
- 238000011144 upstream manufacturing Methods 0.000 claims abstract description 22
- 238000000034 method Methods 0.000 claims abstract description 15
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 15
- 230000003321 amplification Effects 0.000 claims abstract description 11
- 238000003199 nucleic acid amplification method Methods 0.000 claims abstract description 11
- 239000003153 chemical reaction reagent Substances 0.000 claims abstract description 6
- 210000004369 blood Anatomy 0.000 claims description 24
- 239000008280 blood Substances 0.000 claims description 24
- 210000002966 serum Anatomy 0.000 claims description 21
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 11
- 239000000284 extract Substances 0.000 claims description 6
- 238000007689 inspection Methods 0.000 claims description 6
- 210000002381 plasma Anatomy 0.000 claims description 6
- 238000005119 centrifugation Methods 0.000 claims description 5
- 238000012408 PCR amplification Methods 0.000 claims description 4
- 239000008367 deionised water Substances 0.000 claims description 4
- 229910021641 deionized water Inorganic materials 0.000 claims description 4
- 238000010839 reverse transcription Methods 0.000 claims description 4
- 239000002299 complementary DNA Substances 0.000 claims description 3
- 238000011529 RT qPCR Methods 0.000 claims description 2
- 239000000203 mixture Substances 0.000 claims description 2
- 230000008569 process Effects 0.000 claims description 2
- 238000012360 testing method Methods 0.000 abstract description 15
- 108091036688 miR-365-3 stem-loop Proteins 0.000 abstract description 10
- 238000013461 design Methods 0.000 abstract description 6
- 239000000439 tumor marker Substances 0.000 abstract description 5
- 239000012474 protein marker Substances 0.000 abstract description 4
- 230000035945 sensitivity Effects 0.000 abstract description 4
- 102100032752 C-reactive protein Human genes 0.000 description 36
- 206010028980 Neoplasm Diseases 0.000 description 8
- 201000011510 cancer Diseases 0.000 description 8
- 239000000243 solution Substances 0.000 description 8
- 108700011259 MicroRNAs Proteins 0.000 description 7
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 4
- 238000011161 development Methods 0.000 description 4
- 230000000694 effects Effects 0.000 description 4
- 239000006228 supernatant Substances 0.000 description 4
- 238000005406 washing Methods 0.000 description 4
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 3
- 210000004027 cell Anatomy 0.000 description 3
- 239000003085 diluting agent Substances 0.000 description 3
- 238000010790 dilution Methods 0.000 description 3
- 239000012895 dilution Substances 0.000 description 3
- 239000012153 distilled water Substances 0.000 description 3
- 108091070501 miRNA Proteins 0.000 description 3
- 239000000047 product Substances 0.000 description 3
- 239000012224 working solution Substances 0.000 description 3
- 108010074051 C-Reactive Protein Proteins 0.000 description 2
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 2
- 206010061218 Inflammation Diseases 0.000 description 2
- 210000001124 body fluid Anatomy 0.000 description 2
- 239000010839 body fluid Substances 0.000 description 2
- 238000004140 cleaning Methods 0.000 description 2
- 230000002596 correlated effect Effects 0.000 description 2
- 230000034994 death Effects 0.000 description 2
- 238000004925 denaturation Methods 0.000 description 2
- 230000036425 denaturation Effects 0.000 description 2
- 238000003745 diagnosis Methods 0.000 description 2
- 210000002249 digestive system Anatomy 0.000 description 2
- 235000019441 ethanol Nutrition 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 230000004054 inflammatory process Effects 0.000 description 2
- 239000007788 liquid Substances 0.000 description 2
- 210000004185 liver Anatomy 0.000 description 2
- 238000005259 measurement Methods 0.000 description 2
- 238000003753 real-time PCR Methods 0.000 description 2
- 201000000498 stomach carcinoma Diseases 0.000 description 2
- 208000024891 symptom Diseases 0.000 description 2
- 102000040650 (ribonucleotides)n+m Human genes 0.000 description 1
- 108010062271 Acute-Phase Proteins Proteins 0.000 description 1
- 102000011767 Acute-Phase Proteins Human genes 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 208000022072 Gallbladder Neoplasms Diseases 0.000 description 1
- 206010061968 Gastric neoplasm Diseases 0.000 description 1
- 206010019695 Hepatic neoplasm Diseases 0.000 description 1
- 108091067260 Homo sapiens miR-365a stem-loop Proteins 0.000 description 1
- 102000004889 Interleukin-6 Human genes 0.000 description 1
- 108090001005 Interleukin-6 Proteins 0.000 description 1
- 208000005016 Intestinal Neoplasms Diseases 0.000 description 1
- 206010061902 Pancreatic neoplasm Diseases 0.000 description 1
- 229920002472 Starch Polymers 0.000 description 1
- 101150018082 U6 gene Proteins 0.000 description 1
- 230000002159 abnormal effect Effects 0.000 description 1
- 230000001476 alcoholic effect Effects 0.000 description 1
- 210000004381 amniotic fluid Anatomy 0.000 description 1
- 230000006907 apoptotic process Effects 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 230000000711 cancerogenic effect Effects 0.000 description 1
- 231100000315 carcinogenic Toxicity 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 230000009137 competitive binding Effects 0.000 description 1
- 230000009089 cytolysis Effects 0.000 description 1
- 230000004069 differentiation Effects 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 230000035622 drinking Effects 0.000 description 1
- 238000013399 early diagnosis Methods 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 235000013305 food Nutrition 0.000 description 1
- 230000008014 freezing Effects 0.000 description 1
- 238000007710 freezing Methods 0.000 description 1
- 210000000232 gallbladder Anatomy 0.000 description 1
- 201000010175 gallbladder cancer Diseases 0.000 description 1
- 208000010749 gastric carcinoma Diseases 0.000 description 1
- 230000002496 gastric effect Effects 0.000 description 1
- -1 gently vibrates Substances 0.000 description 1
- 208000015181 infectious disease Diseases 0.000 description 1
- 229940100601 interleukin-6 Drugs 0.000 description 1
- 210000000936 intestine Anatomy 0.000 description 1
- 230000003834 intracellular effect Effects 0.000 description 1
- 125000001449 isopropyl group Chemical group [H]C([H])([H])C([H])(*)C([H])([H])[H] 0.000 description 1
- 230000031700 light absorption Effects 0.000 description 1
- 208000014018 liver neoplasm Diseases 0.000 description 1
- 210000004698 lymphocyte Anatomy 0.000 description 1
- 239000006166 lysate Substances 0.000 description 1
- 210000002540 macrophage Anatomy 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 239000002679 microRNA Substances 0.000 description 1
- 238000012544 monitoring process Methods 0.000 description 1
- 102000042567 non-coding RNA Human genes 0.000 description 1
- 108091027963 non-coding RNA Proteins 0.000 description 1
- 239000002773 nucleotide Substances 0.000 description 1
- 125000003729 nucleotide group Chemical group 0.000 description 1
- 238000011369 optimal treatment Methods 0.000 description 1
- 201000002528 pancreatic cancer Diseases 0.000 description 1
- 230000000505 pernicious effect Effects 0.000 description 1
- 238000012545 processing Methods 0.000 description 1
- 230000035755 proliferation Effects 0.000 description 1
- 230000001681 protective effect Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 210000003296 saliva Anatomy 0.000 description 1
- 239000013049 sediment Substances 0.000 description 1
- 239000002002 slurry Substances 0.000 description 1
- 239000012086 standard solution Substances 0.000 description 1
- 235000019698 starch Nutrition 0.000 description 1
- 239000008107 starch Substances 0.000 description 1
- 238000007619 statistical method Methods 0.000 description 1
- 230000001954 sterilising effect Effects 0.000 description 1
- 210000002784 stomach Anatomy 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 239000000758 substrate Substances 0.000 description 1
- 238000003786 synthesis reaction Methods 0.000 description 1
- 230000004797 therapeutic response Effects 0.000 description 1
- 210000001519 tissue Anatomy 0.000 description 1
- 230000000451 tissue damage Effects 0.000 description 1
- 231100000827 tissue damage Toxicity 0.000 description 1
- 238000011282 treatment Methods 0.000 description 1
- 229910021642 ultra pure water Inorganic materials 0.000 description 1
- 239000012498 ultrapure water Substances 0.000 description 1
- 238000002604 ultrasonography Methods 0.000 description 1
- 210000002700 urine Anatomy 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to biology and technical field of medical detection, more particularly to primer, kit and the detection method of a kind of CRP and miR-365-3p joint-detection gastric cancer, wherein primer includes the upstream and downstream primer for expanding miR-365-3p and reference gene U6, the upstream and downstream primer of the amplification miR-365-3p is as shown in SEQ ID NO.1 and SEQ ID NO.2, and the upstream and downstream primer of the amplification reference gene U6 is as shown in SEQ ID NO.3 and SEQ ID NO.4.Kit includes the upstream and downstream primer for expanding miR-365-3p, expands the upstream and downstream primer and CRP detection reagent of reference gene U6.Technical solution of the present invention passes through CRP and miR-365-3p joint-detection gastric cancer, wherein the detection of miR-365-3p passes through the high target primer of design specificity, internal control primer, it is reconfigured to easy to use, the reliable kit of testing result, designs scientific and reasonable PCR reaction system.The problem of being also easy to produce false positive when the method overcome miR-365 as individual stomach cancer marker, while there is higher sensitivity and better predictive ability than individual protein marker.
Description
Technical field
The invention belongs to biology and technical field of medical detection, and in particular to a kind of CRP and miR-365-3p joint-detection
Primer, kit and the detection method of gastric cancer.
Background technique
Gastric cancer is to betide the most common malignant tumour in digestive system, and it is pernicious that disease incidence occupies whole world digestive system
First, tumour, China's incidence gastric cancer rate and the death rate occupy malignant tumour second.Since early gastric caacer symptom is than less obvious
And hardly possible is discovered by patient, and generally having manifest symptom and medical treatment Shi Douyi is advanced gastric carcinoma, because missing optimal treatment time,
So the death rate of patients with gastric cancer is higher, and life quality is poor.Therefore the early detection, early diagnosis of gastric cancer are to improve curative effect
Key.
MicroRNA (miRNA) is a kind of endogenic non-coding RNA, and long is about 20 nucleotide or so, and miRNA is extensive
Be present in it is Eukaryotic intracellular, can by the non-translational region combination at 3 ' ends or 5 ' ends to DNA carry out directly or
The regulation connect reaches to influence the proliferation of cell, differentiation, apoptosis etc. and adjusts biology growing and development.MiRNAs is not only deposited
It in tissue and cell, exists simultaneously in many body fluid, including serum, blood plasma, saliva, urine and amniotic fluid etc..Usually blood
Slurry or serum miRNA are considered to recycle miRNAs.MiRNAs can indicate noninvasive carcinobiology marker in the presence of body fluid.
Since the miRNA early expression event of imbalance occurs in tumour, detection circulation miRNA level can be used for early-stage cancer diagnosis and
Effect in the prediction of therapeutic response and potential patient selection standard clinical tests.The generation of Recent study discovery gastric cancer
The abnormal expression of a variety of miRNA is directed to development.
Hsa-miR-365a-3p is one of miR-365 family member, has correlative study to report miR-365 and mankind's stomach
Cancer has certain correlation, and the occurrence and development degree of expression and gastric cancer is negatively correlated.
C reactive protein (C-reactive protein, CRP) is that a kind of clinically used acute phase protein reaction refers to
Mark, there are micro CRP in healthy human blood, but when malignant tumour, inflammation, infection, macrophage in body, lymphocyte generate and
Certain cell factors, such as interleukin-6 are secreted, liver can be stimulated to accelerate synthesis CRP, its concentration is made to have different degrees of liter
It is high.The detection of serum CA125 has important clinical value to tumor evaluation, and generally CRP starts to rise in tissue damage 6 hours
Height reaches peak in 48 hours.Research finds that the serum-concentration of high quick CRP can be used as one of stomach, intestines, liver, gallbladder and pancreatic neoplasm
Relatively reliable Diagnostic parameters.CRP is a kind of carcinogenic factor in gastric cancer, expresses and is positively correlated with the development degree of gastric cancer.
According to software target prediction, it is found by the applicant that miR-365 can inhibit its right with the seed zone competitive binding of CRP
The effect of downstream targets gene, therefore gastric cancer can be predicted well using the joint-detection of miR-365-3p in blood and CRP.
Summary of the invention
For technological gap in the prior art, the object of the present invention is to provide a kind of CRP and miR-365-3p joint inspections
Primer, detection kit and the detection method of gastric cancer are surveyed, it is easy when the method overcome miR-365 as individual stomach cancer marker
False positive is led to the problem of, while there is higher sensitivity and better predictive ability than individual protein marker.
The present invention is achieved by the following technical solutions:
The first purpose of this invention is to propose a kind of drawing for CRP and miR-365-3p joint-detection gastric cancer in blood
Object, the upstream and downstream primer including expanding miR-365-3p and reference gene U6；Draw the upstream and downstream of the amplification miR-365-3p
Object is as shown in SEQ ID NO.1 and SEQ ID NO.2, the upstream and downstream primer such as SEQ ID NO.3 of the amplification reference gene U6
With shown in SEQ ID NO.4.
Second object of the present invention is to propose a kind of reagent of CRP and miR-365-3p joint-detection gastric cancer in blood
Box, the upstream and downstream primer including expanding miR-365-3p, expands the upstream and downstream primer and CRP detection reagent of reference gene U6；
The upstream and downstream primer of the amplification miR-365-3p is as shown in SEQ ID NO.1 and SEQ ID NO.2, the amplification internal reference base
Because the upstream and downstream primer of U6 is as shown in SEQ ID NO.3 and SEQ ID NO.4.
Further, the kit further includes PCR MIX reaction solution and deionized water.
Third object of the present invention is to propose a kind of side of CRP and miR-365-3p joint-detection gastric cancer in blood
Method includes the following steps:
(1) two parts of blood sample to be checked are taken, a room temperature centrifugation obtains blood plasma, extracts the total serum IgE in blood plasma and measure blood
Starch purity；Another extracts the CRP in serum；
(2) reverse transcription is carried out to the total serum IgE in step (1), obtains cDNA；
(3) Real-time quantitative PCR is respectively adopted, quantitative inspection is carried out to the copy number of miR-365-3p and reference gene U6
It surveys, the primer is as shown in NO:1~4 SEQ ID in detection process；
(4) quantitative detection is carried out to the serum CA125 that step (1) is extracted；
(4) miR-365-3p pcr amplification product and CRP are analyzed, according to miR-365-3p in sample to be examined serum
The ratio between the ratio between relative expression quantity and normal person, CRP relative expression quantity and normal person determine whether sample to be examined suffers from gastric cancer.
Further, PCR reaction system is 2 × PCR Pre-Master Buffer, 5 μ L, concentration in the step (3)
For the 0.5 μ L of upstream primer of 20uM, concentration is the 0.5 μ L of downstream primer, template cDNA1 μ L, 13 μ L of deionized water of 20uM.
The inspection of existing gastric cancer generally detects tester using the Medical Devices of some complexity such as color ultrasound,
Not only testing cost is big, but also increases medical staff labour, and operation is more complicated, compares medical staff's technical requirements
Height is not able to satisfy user demand.Based on existing cancer detection, MiR-365 easily occurs false as individual stomach cancer marker
Positive phenomenon, to experimental result, there are errors.CRP is not only cancer markers, while being also inflammation expression thing, and clinical
The best critical value that CRP can not yet be provided, the not absolute reference value of the monitoring to gastric cancer.Therefore, compared with prior art,
The advantages of the present invention are as follows:
(1) technical solution of the present invention combination CRP and miR-365-3p joint-detection gastric cancer, the wherein inspection of miR-365-3p
It surveys through the high target primer of design specificity, internal control primer, is reconfigured to easy to use, the reliable kit of testing result,
Design scientific and reasonable PCR reaction system.Vacation is also easy to produce when the method overcome miR-365 as individual stomach cancer marker
Positive problem, while there is higher sensitivity and better predictive ability than individual protein marker.
(2) internal reference U6 gene primer is arranged in kit of the invention and detection method, can have by the amplification of reference gene
Effect avoids the appearance of false positive results from finally ensuring that kit test result is accurate to guarantee the reliability of data.
(3) this method is easy to operate, reduces testing cost, while also reducing and wanting to medical staff's technical level
It asks, the concentration of MiR-365 and CRP in blood of human body need to only be detected, to miR-365-3p pcr amplification product and CRP
Analyzed, according to the ratio between miR-365-3p relative expression quantity and normal person in sample to be examined serum, CRP relative expression quantity with just
The ratio between ordinary person determines whether sample to be examined suffers from gastric cancer.If in person under test's serum has-miR-365-3p relative expression quantity with to just
The ratio between ordinary person is lower than 0.32, and the ratio between CRP relative expression quantity and normal person are higher than 3.98, then person under test has the possibility greater than 95%
Property gets a cancer of the stomach.
Detailed description of the invention
Fig. 1 is expression result of the MiR-365 gene in normal human blood and gastic cancer patients in embodiment 2
Figure；
Fig. 2 is expression result figure of the CRP in normal human blood and gastic cancer patients in embodiment 2.
Specific embodiment
Applicant is in conjunction with specific embodiments described in further details technical solution of the present invention below, so that this field
Technical staff may be better understood the present invention and can be practiced, but range is claimed not as the present invention in illustrated embodiment
Restriction.
Embodiment 1:
1, the measurement of miR-365-3p relative expression quantity
(1) blood of person under test is taken, the RNA in serum is extracted
RNAiso Plus reagent is added into person under test's serum, extracts total serum IgE.According to RNAiso Plus (Total RNAs extraction
Kit) it requires on operation instructions that 1mL RNAiso Plus is added, lysate moves to EP pipe, centrifugation after lysis at room temperature 15min
After leave and take supernatant, 0.2mL chloroform is added, is placed at room temperature for 5min after being mixed by inversion；Supernatant is left and taken after centrifugation, and 0.5mL isopropyl is added
Alcohol is centrifuged after standing；75% ethyl alcohol of lmL is added after abandoning supernatant, gently vibrates, supernatant dry sediment is abandoned in centrifugation；ddH2O
(the processed sterilizing ultrapure water of DEPC) dissolved dilution, measures RNA concentration using Nanodrop 2000, surveys again after appropriate dilution
Determine concentration, chooses OD260/OD280 value sample between 1.8-2.0 and carry out next step experiment, all samples are saved in -80 DEG C.
(2) RNA reverse transcription
It is reacted in PCR amplification instrument, reaction system is as shown in table 1:
1 reverse transcription reaction system of table
Reaction condition are as follows: 25 DEG C, 30 minutes；42 DEG C, 30 minutes；85 DEG C, 5 minutes.CDNA product is stood after reaction
Take out, be placed in and be quickly cooled down on ice, all steps later carry out on ice, should not at will from remove on ice cDNA produce
Object.
(3) real-time fluorescence quantitative PCR
Real-time fluorescence quantitative PCR detects miR-365-3p relative expression quantity, and U6 is as internal reference.Wherein upstream and downstream primer sequence
It is specific as follows:
MiR-365-3p:
SEQ ID NO.1Forward Primer GCCGCTAAGGCACGCG
SEQ ID NO.2Reverse Primer TATGGTTGTTCACGACTCCTTCAC
U6:
SEQ ID NO.3Forward Primer CTCGCTTCGGCAGCACA
SEQ ID NO.4Reverse Primer AACGCTTCACGAATTTGCGT
20.0 μ L of experimental group overall reaction system, it is shown that reaction system such as table 2:
2 experimental group quantitative fluorescent PCR system of table
Reaction condition are as follows: 95 DEG C of 10min of initial denaturation；95 DEG C of 2s of amplified reaction, 60 DEG C of 20s, 70 DEG C of l0s acquire fluorescence, altogether
40cycles, 70 DEG C of 30min of solubility curve.
20.0 μ L of internal reference group overall reaction system, reaction system are as shown in table 3:
3 internal reference group quantitative fluorescent PCR system of table
Reaction condition are as follows: 95 DEG C of 10min of initial denaturation；95 DEG C of 2s of amplified reaction, 60 DEG C of 20s, 70 DEG C of l0s acquire fluorescence, altogether
40cycles, 70 DEG C of 30min of solubility curve.
2, the measurement (detection of EILSA kit) of CRP relative expression quantity
Prepare reagent and collect blood sample, extracts the CRP in person under test's serum.(blood drawing the previous day does not eat excessively greasy, high egg
Food and drinks one gets without pay object avoids heavy drinking, and the alcoholic content in blood will have a direct impact on inspection result.8 points of evening on the day before physical examination with
Afterwards, it is fasted 12 hours, in order to avoid influence testing result.)
10 × sample diluent is made 1:10 times with distilled water and is diluted；
It makes a collection of specimens, 2-8 DEG C saves 48 hours；Longer time palpus freezen protective (- 20 DEG C or -70 DEG C) avoids freezing repeatedly
Melt.
The configuration of standard items liquid: it is mixed using preceding addition 0.5ml distilled water, is made into the solution of 40ng/ml.Take 8 10ml from
Sample diluent 500ul is added in heart pipe, the first pipe plus sample diluent 900ul, the second to the 8th pipe.It is added in the first pipe
The standard solution 100ul of 40ng/ul is placed on eddy mixer and 500ul is sucked out with sample injector after mixing, moves to the second pipe.Such as
This makees two-fold dilution repeatedly, and 500ul is sucked out from the 7th pipe and discards.8th pipe is blank control.
Cleaning solution: it is diluted with redistilled water 1:20.
Detect program
(1) be loaded: standard items or sample to be tested 100ul is added in every hole, and reaction plate is mixed well 37 DEG C 40 points of postposition
Clock.
(2) board-washing: sufficiently being washed reaction plate 4-6 times with cleaning solution, is printed on filter paper dry.
(3) every hole is added distilled water and each 50ul of first antibody working solution (except blank) and reaction plate is mixed well postposition
37 DEG C 20 minutes.
(4) board-washing: the same.
(5) reaction plate is set 37 DEG C 10 minutes by the enzyme standard type working solution 100ul in every hole.
(6) board-washing: the same.
(7) substrate working solution 100ul is added in every hole, sets 37 board-washings: the same, dark place is reacted 15 minutes.
(8) every hole is added 100ul terminate liquid and mixes.Light absorption value is surveyed at 450nm with microplate reader after 30 minutes.
Embodiment 2:
(1) 20 patients with gastric cancer and 20 normal persons are chosen, are detected according to the method in embodiment 1, testing result
Statistical analysis is carried out, all experiments are repeated three times, and data are all made of SPSS16.0 processing, using mean+SD
Mode indicates.As a result as shown in table 3, table 4, Fig. 1 and Fig. 2.
The clinically miR-365-3p relative expression quantity in patients with gastric cancer and normal human blood of table 3
| Group | MiR-365-3p relative expression quantity |
| Patients with gastric cancer | 38.15±4.15 |
| Normal person | 98.46±6.78 |
The clinically CRP relative expression quantity in patients with gastric cancer and normal human blood of table 4
| Group | MiR-365-3p relative expression quantity |
| Patients with gastric cancer | 27.70±1.68 |
| Normal person | 5.87±2.35 |
If showing the ratio between has-miR-365-3p relative expression quantity and normal person in person under test's serum by the embodiment 2
Lower than 0.32, and the ratio between CRP relative expression quantity and normal person are higher than 3.98, then person under test has a possibility that greater than 95% to suffer from stomach
Cancer.
(2) 6 patients with gastric cancer and 6 normal persons are randomly selected, are detected according to the method in embodiment 1, wherein 6
The ratio between the relative expression quantity of has-miR-365-3p, CRP and normal person meet lower than 0.32, are higher than in the serum of patients with gastric cancer
3.98, show expression using has-miR-365-3p in blood and CRP to gastric cancer carry out diagnosis have it is very high accurate
Rate.
Therefore, technical solution of the present invention combination CRP and miR-365-3p joint-detection gastric cancer, utilizes miR-365-3p's
Detection designs scientific and reasonable PCR reaction system by the high target primer of design specificity, internal control primer.This method gram
The problem of being also easy to produce false positive when having taken miR-365 as individual stomach cancer marker, while having than individual protein marker
There are higher sensitivity and better predictive ability.
The foregoing is only a preferred embodiment of the present invention, but scope of protection of the present invention is not limited thereto,
Anyone skilled in the art in the technical scope disclosed by the present invention, according to the technique and scheme of the present invention and its
Inventive concept is subject to equivalent substitution or change, should be covered by the protection scope of the present invention.
Sequence table
<110>Wuhan University Of Technology
<120>a kind of primer, kit and the detection method of CRP and miR-365-3p joint-detection gastric cancer
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 16
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gccgctaagg cacgcg 16
<210> 2
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
tatggttgtt cacgactcct tcac 24
<210> 3
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
ctcgcttcgg cagcaca 17
<210> 4
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
aacgcttcac gaatttgcgt 20
Claims (5)
1. the primer of CRP and miR-365-3p joint-detection gastric cancer in a kind of blood, which is characterized in that including expanding miR-365-
The upstream and downstream primer of 3p and reference gene U6；The upstream and downstream primer such as SEQ ID NO.1 and SEQ of the amplification miR-365-3p
Shown in ID NO.2, the upstream and downstream primer of the amplification reference gene U6 is as shown in SEQ ID NO.3 and SEQ ID NO.4.
2. the kit of CRP and miR-365-3p joint-detection gastric cancer in a kind of blood, which is characterized in that including expanding miR-
The upstream and downstream primer of 365-3p expands the upstream and downstream primer and CRP detection reagent of reference gene U6；The amplification miR-365-
The upstream and downstream primer of 3p is as shown in SEQ ID NO.1 and SEQ ID NO.2, the upstream and downstream primer of the amplification reference gene U6
As shown in SEQ ID NO.3 and SEQ ID NO.4.
3. the kit of CRP and miR-365-3p joint-detection gastric cancer, feature in a kind of blood according to claim 2
It is, the kit further includes PCR MIX reaction solution and deionized water.
4. a kind of method of CRP and miR-365-3p joint-detection gastric cancer in blood, which comprises the steps of:
(1) two parts of blood sample to be checked are taken, a room temperature centrifugation obtains blood plasma, extracts the total serum IgE in blood plasma and to measure blood plasma pure
Degree；Another extracts the CRP in serum；
(2) reverse transcription is carried out to the total serum IgE in step (1), obtains cDNA；
(3) Real-time quantitative PCR is respectively adopted, quantitative detection, inspection is carried out to the copy number of miR-365-3p and reference gene U6
Primer is as shown in NO:1~4 SEQ ID used in the process of survey；
(4) quantitative detection is carried out to the serum CA125 that step (1) is extracted；
(4) miR-365-3p pcr amplification product and CRP are analyzed, it is opposite according to miR-365-3p in sample to be examined serum
The ratio between the ratio between expression quantity and normal person, CRP relative expression quantity and normal person determine whether sample to be examined suffers from gastric cancer.
5. the method for CRP and miR-365-3p joint-detection gastric cancer, feature in 4 a kind of blood according to claim 4
It is, PCR reaction system is 2 × PCR Pre-Master Buffer, 5 μ L in the step (3), and concentration is the upstream of 20uM
0.5 μ L of primer, concentration are the 0.5 μ L of downstream primer, template cDNA1 μ L, 13 μ L of deionized water of 20uM.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910057855.0A CN109628597A (en) | 2019-01-22 | 2019-01-22 | A kind of primer, kit and the detection method of CRP and miR-365-3p joint-detection gastric cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910057855.0A CN109628597A (en) | 2019-01-22 | 2019-01-22 | A kind of primer, kit and the detection method of CRP and miR-365-3p joint-detection gastric cancer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109628597A true CN109628597A (en) | 2019-04-16 |
Family
ID=66062978
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910057855.0A Pending CN109628597A (en) | 2019-01-22 | 2019-01-22 | A kind of primer, kit and the detection method of CRP and miR-365-3p joint-detection gastric cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109628597A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016148593A1 (en) * | 2015-03-13 | 2016-09-22 | Gdański Uniwersytet Medyczny | A microrna profile combined with a profile of blood protein markers as a test for the detection of lung cancer |
| CN108315417A (en) * | 2018-03-14 | 2018-07-24 | 深圳瑞科生物科技有限公司 | Pass through the kit of miR-124-3p and GATA3-AS1 joint-detections gastric cancer in blood |
| CN108977540A (en) * | 2018-07-24 | 2018-12-11 | 深圳瑞科生物科技有限公司 | A kind of cancer diagnosis reagent box and its application of combination monitoring RhoA signal path and microRNAs |
-
2019
- 2019-01-22 CN CN201910057855.0A patent/CN109628597A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016148593A1 (en) * | 2015-03-13 | 2016-09-22 | Gdański Uniwersytet Medyczny | A microrna profile combined with a profile of blood protein markers as a test for the detection of lung cancer |
| CN108315417A (en) * | 2018-03-14 | 2018-07-24 | 深圳瑞科生物科技有限公司 | Pass through the kit of miR-124-3p and GATA3-AS1 joint-detections gastric cancer in blood |
| CN108977540A (en) * | 2018-07-24 | 2018-12-11 | 深圳瑞科生物科技有限公司 | A kind of cancer diagnosis reagent box and its application of combination monitoring RhoA signal path and microRNAs |
Non-Patent Citations (2)
| Title |
|---|
| 周旭军: "胃癌患者血清CRP、CA125、CA19-9和CA72-4联合检测的临床意义", 《河北医药》 * |
| 陈兆锋: "胃癌相关miRNAs的筛选及其与胃癌发生发展的关系", 《中国优秀博士学位论文全文数据库 医药卫生科技辑》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107326066A (en) | The urine markers detected for carcinoma of urinary bladder | |
| US20210269885A1 (en) | Multi-gene biomarker for early diagnosis of cancer | |
| US20110218121A1 (en) | Gene associated with liver cancer, and method for determination of the risk of acquiring liver cancer | |
| CN110383070A (en) | Cancer biomarker | |
| CN105603101A (en) | Application of system for detecting expression quantity of eight miRNAs in preparation of product for diagnosing or assisting in diagnosing hepatocellular carcinoma | |
| Tzika et al. | Combination of high-resolution magic angle spinning proton magnetic resonance spectroscopy and microscale genomics to type brain tumor biopsies | |
| CN109777877A (en) | Detection kit for auxiliary diagnosis of cerebral aneurysm based on PTBP1 methylation and application thereof | |
| CN105861672A (en) | Detection kit and detection method for methylation of septin9 gene in human peripheral blood cell-free DNA | |
| CN104711341B (en) | DLK1 gene is preparing the application in gastrointestinal stromal tumor diagnostic reagent | |
| CN109055555A (en) | A kind of lung cancer transfer diagnosis marker and its kit and application in early days | |
| CN109355406B (en) | A kind of kit of the detection mycobacterium tuberculosis based on blood free nucleic acid | |
| CN110295172A (en) | A kind of application of the kidney aptamer quickly screened and its preparation in preparation detection | |
| CN107312865B (en) | Purposes of the LOC100130111 in preparation osteosarcoma diagnostic products, therapeutic agent | |
| JP7187081B2 (en) | Methods for early diagnosis and post-treatment monitoring of breast cancer using liquid biopsy multiplex oncogene biomarkers | |
| CN108300788A (en) | A kind of micro RNA combination and its application for detecting light-duty brain trauma | |
| CN109628597A (en) | A kind of primer, kit and the detection method of CRP and miR-365-3p joint-detection gastric cancer | |
| CN109735612A (en) | The biomolecule marker and its kit of Kawasaki disease coronary aneurysm complication | |
| CN110331208A (en) | Application of the molecular target in adenocarcinoma of lung Combining diagnosis | |
| CN109402228A (en) | The method of RT-qPCR detection tree shrew SLC2A9/Glut9 gene transcription level | |
| CN110249056A (en) | It is detected for prostate cancer diagnosis and the indoles amine -2,3- dioxygenase of prognosis | |
| RU2665965C1 (en) | Method for screening malignant neoplasms in humans | |
| CN110004227A (en) | A kind of biomarker of nasopharyngeal carcinoma diagnosis and/or prognosis evaluation | |
| CN107312836A (en) | Applications of the microRNA miRNA 146a 5p in relevant disease diagnosis of risk | |
| CN108728542A (en) | Detect the preparation and its application process of long-chain non-coding RNA BC200 | |
| CN116287252B (en) | Application of long-chain non-coding RNA APCDD1L-DT in preparation of pancreatic cancer detection products |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190416 |