CN109609418B - Erysipelothrix rhusiopathiae and application thereof - Google Patents
Erysipelothrix rhusiopathiae and application thereof Download PDFInfo
- Publication number
- CN109609418B CN109609418B CN201910095766.5A CN201910095766A CN109609418B CN 109609418 B CN109609418 B CN 109609418B CN 201910095766 A CN201910095766 A CN 201910095766A CN 109609418 B CN109609418 B CN 109609418B
- Authority
- CN
- China
- Prior art keywords
- erysipelothrix rhusiopathiae
- strain
- vaccine
- erysipelothrix
- inactivated
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/0208—Specific bacteria not otherwise provided for
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
- A61K2039/521—Bacterial cells; Fungal cells; Protozoal cells inactivated (killed)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Virology (AREA)
- Pharmacology & Pharmacy (AREA)
- Tropical Medicine & Parasitology (AREA)
- Veterinary Medicine (AREA)
- Biomedical Technology (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Oncology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Communicable Diseases (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention discloses a type 1a erysipelothrix rhusiopathiae strain and application thereof. The preservation number of the erysipelothrix rhusiopathiae is CGMCC NO: 16808 and is named as Erysipelothrix rhusiopathiae HN 1573. The strain is used for separating heart blood of fattening pigs which die due to acute septicemia, no other bacteria grow when the strain is separated on a TSA solid culture medium, only erysipelothrix rhusiopathiae grows, and the proliferation titer in a TSB liquid culture medium is as high as 109 CFU/mL or more; the vaccine prepared by the strain HN1573 screened by the invention has simple preparation process and good prevention effect on swine erysipelas.
Description
The technical field is as follows:
the invention belongs to the technical field of veterinary biological products, and particularly relates to a strain of erysipelothrix rhusiopathiae and application thereof.
Background art:
erysipelothrix rhusiopathiae (Erysipelothrix rhusiopathiae) is a small, elongated, straight rod-shaped gram-positive bacterium that causes erysipelas in pigs and many other animals. Swine erysipelas is commonly manifested as acute or subacute sepsis and chronic proliferative lesions. The heart is the major target organ and usually presents as a significant lesion. Swine erysipelas, a disease that occurs around the world, has significant economic significance in europe, asia, australia and america. Erysipelothrix rhusiopathiae is also a zoonosis pathogen in humans and is the cause of skin disease, erysipelas-like. Live attenuated vaccines and bacteria have long been used to control swine erysipelas. However, the failure of attenuated vaccines often occurs, often causing a violent reaction or death after injection. The high prevalence of swine erysipelas remains a concern for the pork industry worldwide. In addition, antibodies generated by vaccination are difficult to distinguish from antibodies caused by wild-strain erysipelothrix infection. Therefore, there is a need to develop new, more effective vaccines.
The erysipelothrix serovars are numerous, 26 serovars (namely 1a, 1b, 2-24 and N) are confirmed to date, the different serovars erysipelothrix strains have obvious difference in virulence, the types 1a and 1b are most pathogenic, the strains derived from septicemia cases are mostly 1a, and the strains derived from wheal cases are mostly 2. The type 1a causes acute sepsis and death of the medium and large pigs, so once the disease occurs, the disease is difficult to control, thereby causing great economic and property loss to farmers and bringing great difficulty to the development of the pig industry in China. Many medicines developed in advance can have good treatment effect on the swine erysipelas, but with the development of culture scale, the use of a large amount of antibacterial medicines and the unreasonable use of medicines in the withdrawal period cause the drug resistance phenomenon of pathogenic bacteria to be more and more serious, and are more and more not beneficial to the prevention and treatment of clinical diseases. Therefore, the development of a vaccine prepared from a new strain with better immunogenicity is urgently needed.
The invention content is as follows:
aiming at the problems existing in the existing swine erysipelas treatment, the invention provides a type 1a swine erysipelas strain and application thereof.
The technical scheme adopted by the invention for solving the technical problems is as follows: the Erysipelothrix rhusiopathiae is Erysipelothrix rhusiopathiae HN1573 with a deposit number of: CGMCC NO: 16808, date of deposit: 11/09/2018, depository: china general microbiological culture Collection center, preservation Address: xilu No. 1 Hospital No. 3, Beijing, Chaoyang, North.
The erysipelothrix rhusiopathiae is type 1a erysipelothrix rhusiopathiae.
The invention also provides application of the erysipelothrix rhusiopathiae in preparation of a medicament for preventing and controlling erysipelothrix rhusiopathiae.
The application of the swine erysipelas in preparing the medicament for preventing and controlling the swine erysipelas is a vaccine.
An inactivated vaccine of erysipelothrix rhusiopathiae is prepared from an antigen of an inactivated erysipelothrix rhusiopathiae serotype and an adjuvant, wherein the antigen of the serotype of the erysipelothrix rhusiopathiae is an antigen of an inactivated strain HN1573 of the erysipelothrix rhusiopathiae.
The swine erysipelothrix inactivated vaccine is characterized in that the adjuvant is an aluminum hydroxide adjuvant.
The erysipelothrix rhusiopathiae inactivated vaccine has the erysipelothrix rhusiopathiae bacterial amount of 1 multiplied by 109CFU/mL。
The preparation method of any one of the swine erysipelothrix bacterium inactivated vaccines comprises the following steps: inoculating Erysipelothrix rhusiopathiae to TSB liquid culture medium, culturing in shaker at 37 deg.C for 18 hr, collecting culture, measuring concentration, and regulating number of bacteria in culture to 2 × 109CFU/mL, adding formaldehyde to a final concentration of 0.2%, and inactivating at 37 deg.C for 12 h; adding aluminum hydroxide adjuvant into the inactivated bacteria liquid according to the volume ratio of 9:1, and mixing to obtain the erysipelothrix rhusiopathiae inactivated vaccine.
The invention has the beneficial effects that:
1. the strain HN1573 of the invention is used for separating heart blood of fattening pigs which die due to acute septicemia, no other bacteria grow when the heart blood is separated on a TSA solid culture medium, only pig erysipelothrix rhusiopathiae grows, and the proliferation titer in a TSB liquid culture medium is as high as 109CFU/mL or more.
2. The strain HN1573 has strong pathogenicity on nursery pigs, causes the nursery pigs to die, and has good immunogenicity.
3. The vaccine prepared according to the strain HN1573 in the invention has a good protection effect on swine erysipelas.
Description of the drawings:
FIG. 1 shows the colony morphology of strain HN 1573.
FIG. 2 shows the gram-stained 100 Xmicroscopic appearance of strain HN 1573.
FIG. 3 shows the PCR identification result of strain HN1573, wherein the Marker in the figure is DL 2000bp, which is 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom; lane 1 shows the result of amplifying the 16S rRNA gene of HN1573 strain with primers P1 and P2; lane 2 shows the results of amplification of 16S rRNA gene of vaccine strain G4T10 with primers P1 and P2; lane 3 shows the results of the primers P1 and P2 amplifying the 16S rRNA gene of Salmonella C500 strain.
FIG. 4 shows the serotype PCR identification result of the strain HN1573, wherein the Marker in the figure is DL 2000bp, which is 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom; lane 1 shows the amplification of the HN1573 glycerol-3-phosphatecylyltransferase gene by the primers P3 and P4; lane 2 shows the results of amplification of the gene of the vaccine strain G4T10, glycerol-3-phosphate cytidylyltransferase with primers P3 and P4; lane 3 shows the results of primers P3 and P4 on the amplification of Salmonella strain C500.
The specific implementation mode is as follows:
the present invention will be described in further detail with reference to the accompanying drawings and examples.
The disease material of the erysipelothrix rhusiopathiae is heart blood of a fattening pig with 6 months of age and death caused by acute septicemia, which is collected in a large pig farm in Yuanyang county of Henan province in 8 months in 2018.
Example 1: isolation and characterization of Strain HN1573
1.1 preparation of the culture Medium
TSB liquid medium: dissolving 30g of TSB broth powder (Tryptic Soy broth, tryptone and Soy broth) in 1000mL of ultrapure water, sterilizing at 115 ℃ for 15min, and adding 50mL of fetal calf serum;
TSA solid medium: dissolving 40g of TSA Agar powder (Tryptic Soy Agar, tryptone Soy Agar) in 1000mL of ultrapure water, sterilizing at 115 ℃ for 15min, and adding 50mL of fetal calf serum; stored at 4 ℃ for further use.
1.2 isolation and culture of the Strain
Aseptically collecting heart blood of sick pigs, inoculating on TSA solid culture medium, culturing in 37 deg.C incubator for 24-36 hr to obtain colonies with consistent needle tip shape size, colorless transparency, round shape, smooth shape, and regular edge (see figure 1). After the purification inoculation, gram-positive bacteria, straight or slightly bent bacilli, in a chain or in filaments, are gram-stained (see FIG. 2). The strain is primarily judged to be the erysipelothrix rhusiopathiae from the morphological and biochemical characteristic results of the strain and is named as a strain HN 1573.
1.3 identification of the strains
1.3.1 primer design
A pair of universal primers is designed according to the sequence of the erysipelothrix rhusiopathiae 16S rRNA gene (NO. M23728) for the amplification of the erysipelothrix rhusiopathiae, and the primer sequences are as follows:
P1：5’-AGATGCCATAGAAACTGGTA-3’(SEQ ID NO.1)
P2：5’-CTGTATCCGCCATAACTA-3’(SEQ ID NO.2)
the amplified fragment size was 407 bp.
Designing a pair of specific primers of the type 1a of the erysipelothrix rhusiopathiae according to the sequence of the erysipelothrix rhusiopathiae glycerol-3-phosphate cytyllyltransferae gene, and using the specific primers for the amplification of the type 1a of the erysipelothrix rhusiopathiae, wherein the primer sequences are as follows:
P3：5’-CTCCTAACGCTTTAGCACGC-3’(SEQ ID NO.3)
P4：5’-TGATCCTTTGCCACTAATGC-3’(SEQ ID NO.4)
the amplified fragment was 356bp in size.
1.3.2PCR identification
Extracting DNA of the strain HN1573 according to the operation steps of the DNA extraction kit, measuring the concentration by a spectrophotometer to be 100ug/mL, and carrying out PCR identification.
The PCR amplification reaction system is 25 mu L: 2.5. mu.L of 10 Xbuffer, 0.5. mu.L of 2.5mM dNTPs0.5. mu.L, 10. mu.M/L universal primer P1, 1. mu.L of each of P2, 1. mu.L of 5U/. mu.L rTaq, and 100ug/mLDNATemplate 1. mu.L, add ddH2O to 25. mu.L. Vaccine strain G4T10 was used as a positive control, and Salmonella C500 was used as a negative control.
Reaction conditions are as follows: pre-denaturation at 95 ℃ for 2min, entering circulation: at 94 ℃ for 30s, at 60 ℃ for 30s, at 68 ℃ for 1min, for 35 cycles, and finally at 72 ℃ for 10min, the PCR product is stored at 4 ℃.
The amplification products were subjected to electrophoresis, 10. mu.L of each well was applied, and the results were observed on a 1% agarose gel under ultraviolet light (see FIG. 3). As a result, a 407bp fragment was amplified, and the sequencing was 100% homologous to Erysipelothrix suis strain WH13013 (GenBank NO: CP017116), and the sequencing result was as follows, demonstrating that strain HN1573 is Erysipelothrix rhusiopathiae.
AGATGCCATAGAAACTGGTAGACTAGAGTGCAGGAGAGGTTAGTGGAATTCCATGTGTAGCGGTAAAATGCGTAGATATATGGAGGAACACCAGTGGCGAAGGCGGCTAACTGGCCTGTAACTGACGCTGAGGCTCGAAAGCGTGGGGAGCAAATAGGATTAGATACCCTAGTAGTCCACGCCGTAAACGATGGATACTAAGTGTTGGAGAAATTCAGTGCTGTAGTTAACGCAATAAGTATCCCGCCTGGGGAGTATGCGCGCAAGCGTAAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGTGGAGTATGTGGTTTAATTCGAAGCAACGCGAAGAACCTTACCAGGTCTTGACATACCGCGCAAAAGCACAGAGATGTGTAATAGTTATGGCGGATACAG(SEQ ID NO.5)
1.3.3 serotype identification
Referring to the 1.3.2PCR identification method, the 356bp fragment was amplified by PCR using specific primers P3 and P4 of type 1a Erysipelothrix rhusiopathiae (see FIG. 3), and the sequencing result showed that it was 100% homologous to strain WH13013 (GenBank NO: CP017116) of Erysipelothrix rhusiopathiae, which confirmed that strain HN1573 was type 1a Erysipelothrix rhusiopathiae.
CTCCTAACGCTTTAGCACGCTTTAGAATATTAATATGACCTTGATGTAATAAATCAAACGTACCGTATGTTATAACTTTTTTCATTTGTTTACTCCTCCACTAATTAATTTGATGACTATTACACTTTATCCTCTCTACTAGACTAAAATTTAACTATTTGCTAATAGTTCCAATATTTTCGAAAAAGTCGATAAATCTTTCAGAGGATTTATTGTCCATATATTTATTCACCTTATGATTGACTTCTTCTCTCTTACTTTTGAAACTATCGACTTCTTCTAATACATTTTCGAAGAATTTAATTAAACCATCTAAATCAGTTATCTTATAACCCGGCATTAGTGGCAAAGGATCA(SEQ ID NO.6)
1.4 virulence test
The test animals were 10 weaned healthy piglets at the age of 30 days. The test animals were divided into two groups, 5 control groups, test group5 pieces of the Chinese herbal medicine are taken. Inoculating strain HN1573 into TSB liquid culture medium, shake culturing at 37 deg.C for 18 hr, measuring thallus concentration, continuously diluting 10 times, coating solid plate, counting viable bacteria under low-power microscope, calculating stock solution thallus concentration, and adjusting to 2.5 × 108CFU/mL, experimental animals were inoculated with 2mL of HN1573 strain liquid culture by cervical subcutaneous injection, and control animals were inoculated with 32mL of sterilized TSB liquid culture by cervical subcutaneous injection. After injection, the observation was continued for 2 weeks, and the number of morbidities and deaths were observed and recorded.
The observation shows that: after HN 157324 h is inoculated to animals in a test group, the animals show high fever, the body temperature reaches 42-43 ℃, the animals can not stay for a long time, lie down, eat no food, cyanosis of mucous membrane and the like, and all die in 3 days; the control animals were normothermic and had no apparent clinical symptoms during the trial.
After the test is finished, killing animals in the test group, and killing 5 animals in the control group at the same time; collecting the disease material, and separating the erysipelothrix rhusiopathiae. The experimental group showed obvious change of systemic septicemia, red swelling of kidney, spleen congestion swelling, cherry red, congestion, hemorrhage and swelling of systemic lymph nodes, acute hemorrhagic catarrhal inflammation of stomach and duodenum. No obvious pathological change occurs in the control group by means of autopsy, no erysipelothrix rhusiopathiae is separated from 5 patient materials of the control group, the erysipelothrix rhusiopathiae is separated from 5 patient materials of the test group, and the PCR identification result is consistent with HN 1573.
Example 2 vaccine preparation, safety and efficacy testing
2.1 preparation of the vaccine
Inoculating Erysipelothrix rhusiopathiae strain HN1573 into TSB liquid culture medium, culturing in shaker at 37 deg.C for 18 hr, collecting culture, measuring concentration, and adjusting number of bacteria in culture to 2 × 109CFU/mL, every 1000mL bacterial liquid adding 2mL formaldehyde solution, at 37 degrees C were inactivated for 12 h. Adding aluminum hydroxide adjuvant into the inactivated bacteria liquid according to the volume ratio of 9:1, and mixing to obtain the erysipelothrix rhusiopathiae inactivated vaccine.
2.2 safety testing of vaccines
10 healthy nursery pigs of 30 days old are selected and divided into 2 groups, and each group has 5 pigs.
Vaccine groups: 4mL of the vaccine is injected subcutaneously at the neck;
control group: 4mL of sterile saline was injected subcutaneously into the neck. Animal body temperature was measured and clinical performance was observed for 2 weeks.
During the observation period, the nursery pigs of the vaccine group and the control group are normal in breathing, appetite and mental state during the whole observation period, which indicates that the inactivated vaccine of the invention is safe.
2.3 potency testing of vaccines
30 healthy piglets in 30 days are selected and divided into 6 groups, and each group has 5 piglets. The method specifically comprises the following steps: vaccine 1-4 groups: each group is injected with 0.5ml, 1ml, 1.5ml and 2ml of the vaccine respectively; group 5 was the non-immunized group; group 6 was a healthy control group, and 2mL of sterilized saline was injected. The vaccine group and the healthy control group were immunized with the same dose of vaccine or sterilized normal saline 3 weeks later. 10 for each group 14 days after the second immunization9And F, performing intravenous injection on HN1573 bacterial liquid of the CFU to counteract toxic substances. The piglets were observed for clinical appearance and body temperature was measured daily for 2 weeks. Carrying out separation culture of erysipelothrix suis on organs such as lungs of dead pigs.
The observation shows that: the vaccine group is obviously different from the non-immune group, clinical symptoms begin to appear the next day after virus challenge, the body temperature rises, the patient does not eat horizontally, the mucous membrane becomes cyanotic, death begins to appear on the 2 nd day, and all 5 deaths within 1 week.
And c, performing autopsy on the dead pig kidney, spleen and whole lymph node swelling and blood stasis or bleeding. No piglets of the healthy control group had developed disease. In the vaccine group, 3 piglets in 5 piglets in the 0.5ml vaccine group have clinical symptoms and case changes; 2 of 5 piglets in the 1ml vaccine group showed clinical symptoms and case changes; in 5 piglets of the 1.5ml vaccine group, 1 piglet showed clinical symptoms and case changes; 5 piglets in the 2ml vaccine group had no disease. The protective conditions of immune challenge are shown in table 1.
TABLE 1 Erysipelothrix rhusiopathiae HN1573 strain immune challenge test results
Note: "-" indicates inapplicable.
As can be seen from the above table, the minimum immunoprotective dose of the vaccine is 0.5ml with a bacterial content of 1X 109CFU/mL. The inactivated seedlings of the invention have good protection effect.
The foregoing description is only a preferred embodiment of the present invention, and various modifications and changes will occur to those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> institute of zootechnics of academy of agricultural sciences of Henan province
<120> one strain of erysipelothrix rhusiopathiae and application thereof
<141> 2019-01-31
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA/RNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 1
agatgccata gaaactggta 20
<210> 2
<211> 18
<212> DNA/RNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 2
ctgtatccgc cataacta 18
<210> 3
<211> 20
<212> DNA/RNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 3
ctcctaacgc tttagcacgc 20
<210> 4
<211> 20
<212> DNA/RNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 4
tgatcctttg ccactaatgc 20
<210> 5
<211> 407
<212> DNA/RNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 5
agatgccata gaaactggta gactagagtg caggagaggt tagtggaatt ccatgtgtag 60
cggtaaaatg cgtagatata tggaggaaca ccagtggcga aggcggctaa ctggcctgta 120
actgacgctg aggctcgaaa gcgtggggag caaataggat tagataccct agtagtccac 180
gccgtaaacg atggatacta agtgttggag aaattcagtg ctgtagttaa cgcaataagt 240
atcccgcctg gggagtatgc gcgcaagcgt aaaactcaaa ggaattgacg ggggcccgca 300
caagcggtgg agtatgtggt ttaattcgaa gcaacgcgaa gaaccttacc aggtcttgac 360
ataccgcgca aaagcacaga gatgtgtaat agttatggcg gatacag 407
<210> 6
<211> 356
<212> DNA/RNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 6
ctcctaacgc tttagcacgc tttagaatat taatatgacc ttgatgtaat aaatcaaacg 60
taccgtatgt tataactttt ttcatttgtt tactcctcca ctaattaatt tgatgactat 120
tacactttat cctctctact agactaaaat ttaactattt gctaatagtt ccaatatttt 180
cgaaaaagtc gataaatctt tcagaggatt tattgtccat atatttattc accttatgat 240
tgacttcttc tctcttactt ttgaaactat cgacttcttc taatacattt tcgaagaatt 300
taattaaacc atctaaatca gttatcttat aacccggcat tagtggcaaa ggatca 356
Claims (4)
1. A strain of erysipelothrix rhusiopathiae is characterized in that: the erysipelothrix rhusiopathiae is type 1a erysipelothrix rhusiopathiae HN1573, and the preservation number is as follows: CGMCC NO: 16808, date of deposit: 11/09/2018, depository: china general microbiological culture Collection center, preservation Address: xilu No. 1 Hospital No. 3, Beijing, Chaoyang, North.
2. Use of the strain of erysipelothrix rhusiopathiae of claim 1 in the preparation of a vaccine for the prevention and control of erysipelothrix rhusiopathiae.
3. An inactivated vaccine of Erysipelothrix rhusiopathiae, characterized in that the vaccine is prepared from Erysipelothrix rhusiopathiae serotype antigen and adjuvant, the Erysipelothrix rhusiopathiae serotype antigen is the inactivated antigen of Erysipelothrix rhusiopathiae strain HN1573 as claimed in claim 1, wherein the bacterial dose of Erysipelothrix rhusiopathiae in the vaccine is 1 x 109CFU/mL, and the adjuvant is an aluminum hydroxide adjuvant.
4. The method for preparing the inactivated erysipelothrix rhusiopathiae vaccine according to claim 3 comprises the following steps: inoculating Erysipelothrix rhusiopathiae to TSB liquid culture medium, culturing in shaker at 37 deg.C for 18 hr, collecting culture, measuring concentration, and regulating number of bacteria in culture to 2 × 109CFU/mL, adding formaldehyde to a final concentration of 0.2%, and inactivating at 37 deg.C for 12 h; adding aluminum hydroxide adjuvant into the inactivated bacteria liquid according to the volume ratio of 9:1, and mixing to obtain the erysipelothrix rhusiopathiae inactivated vaccine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910095766.5A CN109609418B (en) | 2019-01-31 | 2019-01-31 | Erysipelothrix rhusiopathiae and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910095766.5A CN109609418B (en) | 2019-01-31 | 2019-01-31 | Erysipelothrix rhusiopathiae and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109609418A CN109609418A (en) | 2019-04-12 |
| CN109609418B true CN109609418B (en) | 2021-06-15 |
Family
ID=66021632
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910095766.5A Active CN109609418B (en) | 2019-01-31 | 2019-01-31 | Erysipelothrix rhusiopathiae and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109609418B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112226379B (en) * | 2019-12-26 | 2022-06-14 | 河南科技大学 | Erysipelothrix rhusiopathiae type 1a strain, swine erysipelas inactivated vaccine and application thereof |
| CN113897315A (en) * | 2021-10-26 | 2022-01-07 | 上海市动物疫病预防控制中心(上海市兽药饲料检测所、上海市畜牧技术推广中心) | Erysipelothrix rhusiopathiae and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106146626A (en) * | 2015-04-07 | 2016-11-23 | 武汉科缘生物发展有限责任公司 | A kind of erysipelothrix ruhsiopathiae subunit vaccine and preparation method and application |
-
2019
- 2019-01-31 CN CN201910095766.5A patent/CN109609418B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106146626A (en) * | 2015-04-07 | 2016-11-23 | 武汉科缘生物发展有限责任公司 | A kind of erysipelothrix ruhsiopathiae subunit vaccine and preparation method and application |
Non-Patent Citations (3)
| Title |
|---|
| Characterizationof Erysipelothrix rhusiopathiae strains isolated from recent swine erysipelas outbreaks in Japan;To H，et al;《J Vet Med Sci》;20120309;第74卷(第7期);全文 * |
| 猪丹毒丝菌河南株的分离鉴定;徐引弟等;《上海畜牧兽医通讯》;20200220;全文 * |
| 猪红斑丹毒丝菌制苗用菌株的筛选;吴琼娟等;《浙江农业学报》;20180925;摘要，第1468页右栏第1段,第1469页左栏第5段，1471页右栏第2段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109609418A (en) | 2019-04-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104784686B (en) | TGEV, PEDV bigeminal live vaccine and preparation method thereof | |
| CN104788561B (en) | Anti-swine infectious enterogastritis virus and Porcine epidemic diarrhea virus Yolk antibody and preparation method thereof | |
| CN109806389B (en) | Haemophilus parasuis trivalent inactivated vaccine and application thereof | |
| Shoemaker et al. | Immersion vaccination with an inactivated virulent Aeromonas hydrophila bacterin protects hybrid catfish (Ictalurus punctatus X Ictalurus furcatus) from motile Aeromonas septicemia | |
| CN106929451A (en) | One plant of Streptococcus suis and its application | |
| CN109609418B (en) | Erysipelothrix rhusiopathiae and application thereof | |
| CN106929452B (en) | Mycoplasma bovis and application thereof | |
| CN102949714A (en) | Swine Streptococcosis trivalent inactivated vaccine and preparation method thereof | |
| CN105441368A (en) | Mycoplasma bovis and application thereof | |
| CN110812473A (en) | Triple inactivated vaccine for haemophilus parasuis disease, streptococcus suis disease and pasteurella multocida disease and preparation method thereof | |
| CN107201326B (en) | Infectious actinobacillus pleuropneumoniae and application thereof | |
| CN104096222B (en) | A kind of vaccine combination and its preparation method and application | |
| CN110241060B (en) | Mink klebsiella pneumoniae and application thereof | |
| CN109745555B (en) | Mycoplasma hyopneumoniae and haemophilus parasuis combined inactivated vaccine and application thereof | |
| CN112063561A (en) | Streptococcus suis type 3 vaccine strain and application thereof | |
| CN101829321B (en) | Vaccine for preventing red head disease of Pseudobagrus fulvidraco | |
| CN107446859B (en) | Mycoplasma gallisepticum and application thereof | |
| CN107488612B (en) | Mycoplasma hyopneumoniae and application thereof | |
| CN112940987B (en) | Rabbit staphylococcus aureus and application thereof in preparation of inactivated vaccine | |
| CN109797139A (en) | 3 type duck hepatitis A virus low virulent strain CH-P60 of one kind and its application | |
| CN105497885B (en) | A kind of subunit vaccine and its preparation method and application | |
| CN111073863B (en) | Porcine epidemic diarrhea and porcine delta coronavirus bivalent attenuated vaccine and preparation method thereof | |
| CN110862938B (en) | Porcine pathogenic escherichia coli strain and inactivated vaccine thereof | |
| CN110124022B (en) | Mycoplasma hyopneumoniae, haemophilus parasuis, streptococcus suis and actinobacillus pleuropneumoniae quadruple inactivated vaccine and application thereof | |
| CN104250623B (en) | One plant of mycoplasma hyorhinis bacterial strain, vaccine combination and its preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |