CN109602747B

CN109602747B - Application of 6-benzylaminopurine in preparation of medicine for preventing and/or treating altitude disease caused by acute altitude advance

Info

Publication number: CN109602747B
Application number: CN201910121335.1A
Authority: CN
Inventors: 施冰; 薛大卫
Original assignee: 7th Medical Center of PLA General Hospital
Current assignee: 7th Medical Center of PLA General Hospital
Priority date: 2019-02-19
Filing date: 2019-02-19
Publication date: 2021-03-23
Anticipated expiration: 2039-02-19
Also published as: CN109602747A

Abstract

The invention discloses application of 6-benzylaminopurine in preparation of a medicine for preventing and/or treating altitude diseases caused by acute altitude. The invention utilizes the comprehensive experiment chamber to simulate the plateau environment with the altitude of 7000m, observes the protective effect of 6-benzylaminopurine on myocardial edema caused by the rapid-entry plateau low-pressure hypoxia environment, and explores the related mechanism. Experimental results show that 6-BA can reduce the water content of the myocardial tissue of a rat with high altitude hypoxia, reduce the damage degree of the myocardial tissue caused by a low-pressure hypoxia environment, and inhibit the expression of AQP1mRNA and miR-144-3p in the myocardial tissue of the rat with high altitude hypoxia. The 6-BA has better treatment effect on the altitude disease generated in the fast-advancing altitude low-pressure low-oxygen environment, has obvious effect on treating myocardial edema, and can be developed into the medicine for preventing and treating the altitude disease caused by the altitude low-pressure low-oxygen environment.

Description

Application of 6-benzylaminopurine in preparation of medicine for preventing and/or treating altitude disease caused by acute altitude advance

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to application of 6-benzylaminopurine (6-BA) in preparation of a medicine for preventing and/or treating altitude diseases caused by acute altitude.

Background

High altitude hypoxic environment with altitude above 3000m can have great influence on human health, especially when people who do not have adaptive exercise enter the altitude rapidly from the plain, Acute altitude sickness (AMS) is easy to occur, and the treatment can be further developed into High Altitude Pulmonary Edema (HAPE) and High Altitude Cerebral Edema (HACE) which endanger life. With the increase of national defense, economic construction and tourists in the plateau, the search for a drug for really and effectively preventing and treating acute altitude diseases becomes an urgent task for the research work of plateau medicine.

6-benzylaminopurine (6-benzylaminopurine, 6-BA) is a cytokinin in plant growth regulators. The 6-BA has various effects of inhibiting the decomposition of chlorophyll, nucleic acid and protein in plant leaves, protecting green and resisting aging, regulating and transporting amino acid, auxin, inorganic salt and the like to a treated part and the like, has the characteristics of stability, low price, easy use and the like, and is widely applied to plant tissue culture, fruit growth, vegetable preservation and the like. However, whether 6-BA has the function of protecting tissue cells of animals and human bodies from oxidative damage is not reported in documents.

Disclosure of Invention

The invention aims to solve the technical problem of how to prevent and/or treat acute altitude diseases caused by rapidly entering into high altitude low pressure and low oxygen environment.

In order to solve the technical problems, the invention firstly provides a new application of 6-benzylaminopurine or pharmaceutically acceptable salts and esters thereof.

The 6-Benzylaminopurine has the English name of 6-benzylamidinopurine, and the alias can be 6-benzyladenine, 6-BA and BAP. CAS registry number 1214-39-7. EINECS accession number 19406. Molecular formula C₁₂H₁₁N₅. The molecular weight is 225.25. The appearance is white crystal powder, is insoluble in water, slightly soluble in ethanol and stable in acid and alkali. The structural formula is shown as formula I.

The invention provides application of 6-benzylaminopurine or pharmaceutically acceptable salts and esters thereof in preparing medicines for preventing and/or treating altitude diseases caused by rapidly advancing high altitude low pressure hypoxia environment.

Further, the altitude disease is acute altitude disease. The acute altitude diseases are various pathological reactions generated after a human body is exposed to a low-pressure hypoxic environment in a short time after entering an altitude area, and are unique common diseases in the altitude area. Rapidly enters a plateau with an altitude of more than 3000m from a plain, or enters a region with a higher altitude from the plateau, and the disease is attacked within hours or 1 to 3 days.

Further, the altitude disease may include one or more of the following: 1) it has symptoms of headache, dizziness, nausea, emesis, hypomnesis, insomnia, dreaminess, deep respiration, increased frequency, tachycardia, palpitation, short breath, chest distress, chest pain, lethargy, anorexia, abdominal distention, and numbness of hands and feet, and can not be explained by other reasons. The degree of symptoms is assessed primarily by the degree of headache and/or vomiting (mild, moderate, severe), in combination with other symptoms. 2) When resting, it shows only mild symptoms, such as palpitation, shortness of breath, chest distress, chest pain, etc., but the symptoms after activity are particularly significant. 3) Those with symptoms or signs such as markedly accelerated pulse, mild or moderate increase (or decrease) in blood pressure, cyanosis of lips and/or fingers, puffy eyelids and/or face, etc., and who have been significantly reduced or eliminated by oxygen inhalation, or adaptation for 1-2 weeks, or passage to low altitude areas.

The invention also provides application of the 6-benzylaminopurine or the pharmaceutically acceptable salt and ester thereof in preparing a medicament for preventing and/or treating myocardial tissue edema caused by rapidly advancing to a high-altitude low-pressure hypoxic environment.

In the above application, the myocardial tissue edema also includes sudden cardiac death caused by malignant arrhythmia such as ventricular contraction and/or relaxation dysfunction, arrhythmia, heart failure, atrioventricular block, and the like.

The invention also provides application of the 6-benzylaminopurine or the pharmaceutically acceptable salt and ester thereof in preparing a medicine for reducing the degree of myocardial tissue damage caused by rapidly advancing to a high-altitude low-pressure hypoxic environment.

For the above applications, the myocardial tissue injury may include fulminant myocarditis and acute myocarditis.

The invention also provides application of the 6-benzylaminopurine or the pharmaceutically acceptable salt and ester thereof in down-regulating the expression level of the aquaporin gene AQP1 and/or the expression level of the miR-144-3p gene in myocardial tissues under the high-altitude low-pressure and low-oxygen environment.

The invention also provides application of the 6-benzylaminopurine or the pharmaceutically acceptable salt and ester thereof in preparing a medicine for regulating the expression level of the aquaporin gene AQP1 and/or the expression level of the miR-144-3p gene in myocardial tissues under the high-altitude low-pressure and low-oxygen environment.

In the above application, the expression level is mRNA expression level.

In the above application, the myocardial tissue is mammalian myocardial tissue;

the mammal includes a human.

The application of the active component of 6-benzylaminopurine or pharmaceutically acceptable salts and esters thereof in preparing the medicine for preventing and/or treating altitude sickness caused by acute entry into the high altitude low oxygen environment or the application in preparing the medicine for preventing and/or treating myocardial tissue edema caused by acute entry into the high altitude low oxygen environment or the application in preparing the medicine for reducing the myocardial tissue damage degree caused by acute entry into the high altitude low oxygen environment also belongs to the protection scope of the invention.

When necessary, one or more pharmaceutically acceptable carriers can be added into the medicine; the carrier includes diluent, excipient, filler, binder, wetting agent, disintegrating agent, absorption enhancer, surfactant, adsorption carrier, lubricant, etc. which are conventional in the pharmaceutical field.

The above medicine can be made into various forms such as injection, tablet, powder, granule, capsule, oral liquid, paste, cream, etc.; the medicaments in various dosage forms can be prepared according to the conventional method in the pharmaceutical field.

The above drugs can be introduced into body such as muscle, intradermal, subcutaneous, intravenous, mucosal tissue by injection, spray, nasal drop, eye drop, penetration, absorption, physical or chemical mediated method; or mixed or coated with other materials and introduced into body.

The application of miR-144-3p as a target point in developing or screening a medicine for preventing and/or treating altitude diseases caused by acute high altitude low pressure hypoxia environment or the application of miR-144-3p as a target point in developing or screening a medicine for preventing and/or treating myocardial tissue edema caused by acute high altitude low pressure hypoxia environment or the application of miR-144-3p as a target point in developing or screening a medicine for reducing myocardial tissue damage degree caused by acute high altitude low pressure hypoxia environment also belong to the protection scope of the invention.

The application of the substance for inhibiting or reducing the expression quantity and/or activity of miR-144-3p in preparing the medicine for preventing and/or treating altitude sickness caused by rapidly advancing to the high altitude low oxygen environment or the application of the substance for inhibiting or reducing the expression quantity and/or activity of miR-144-3p in preparing the medicine for preventing and/or treating myocardial tissue edema caused by rapidly advancing to the high altitude low oxygen environment or the application of the substance for inhibiting or reducing the expression quantity and/or activity of miR-144-3p in preparing the medicine for reducing the myocardial tissue damage degree caused by rapidly advancing to the high altitude low oxygen environment also belong to the protection scope of the invention.

The application of the substance for inhibiting or silencing miR-144-3p gene expression in preparing the medicine for preventing and/or treating altitude diseases caused by rapidly advancing to the high altitude low pressure hypoxia environment or the application of the substance for inhibiting or silencing miR-144-3p gene expression in preparing the medicine for preventing and/or treating myocardial tissue edema caused by rapidly advancing to the high altitude low pressure hypoxia environment or the application of the substance for inhibiting or silencing miR-144-3p gene expression in preparing the medicine for reducing the myocardial tissue damage degree caused by rapidly advancing to the high altitude low pressure hypoxia environment also belongs to the protection scope of the invention.

The invention utilizes the comprehensive experiment chamber to simulate the plateau environment with the altitude of 7000m, observes the protective effect of 6-benzylaminopurine (6-BA) on rat myocardial edema caused by the plateau low-pressure hypoxia environment after the plateau is rapidly advanced, and explores the related mechanism. Experimental results show that the 6-BA can reduce the water content of the myocardial tissue of a rat suffering from high altitude low-pressure hypoxia, reduce the myocardial tissue damage degree caused by rapidly advancing to the high altitude low-pressure hypoxia environment, and reduce the AQP1mRNA expression level and the miR-144-3p expression level in the myocardial tissue of the rat rapidly advancing to the high altitude low-pressure hypoxia environment. The above results indicate that 6-BA has the effect of preventing and treating myocardial tissue edema caused by high altitude hypoxia. The compound 6-BA has better treatment effect on the altitude disease generated in the fast-advancing plateau low-pressure low-oxygen environment, has obvious effect on treating myocardial tissue edema of a rat simulating the plateau environment of 7000m, and can be developed into a medicament for preventing and treating the altitude disease generated in the plateau low-oxygen environment.

Drawings

FIG. 1 shows the measurement of water content in rat myocardial tissue. Each treatment group of rats n-6, p <0.01Vs con; # p <0.01Vs HH.

FIG. 2 shows the results of pathological sections of rat myocardial tissue HE (x20 light mirror). From left to right, there are con group, HH group and 6-BA group. Rat myocardial tissue of the control group (con group): the rat myocardial cells are clear, pink, myofibrils and transverse striations are visible, and nuclei are clear. Rat myocardial tissue of hypoxic group (HH group): rats with focal degeneration of myocardium and sparse fascicles. 6-BA group rat myocardial tissue: rats with focal degeneration of myocardium and sparse fascicles. The degree of myocardial tissue damage in rats in the 6-BA group was lower than that in the hypoxic group.

FIG. 3 shows the result of AQP1mRNA assay in rat myocardial tissue. Each treatment group of rats n-6, p <0.01Vs con; # p <0.05 Vs HH.

FIG. 4 shows the detection result of rat myocardial tissue miR-144-3 p. Each treatment group of rats n-6, p <0.01Vs con; # p <0.05 Vs HH.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

Six week old SPF grade SD rats, weighing 200 + -20 g, male, purchased from Experimental animals technology, Inc., Viton, Beijing, were obtained in the following examples. License number SCXK (Kyoto) 2016-. All animal experiments were reviewed by the ethics committee.

Example 1 application of 6-BA in preparing medicine for preventing and treating altitude disease caused by rapidly advancing to altitude

First, experimental materials and methods

1. Experimental materials: six-week-old SPF grade SD rats, 200 + -20 g in body weight, male.

2. Grouping experiments: the SD rat is randomly divided into a plateau hypoxia experimental group, a 6-BA intervention group and a normal pressure normoxic control group by adopting a random digital table method. Each group had 18 animals. The treatment methods of each group are respectively as follows:

plateau hypoxia experimental group (hypoxia group or HH group for short): an experimental cabin (Guizhou wind mine aviation military, Limited liability company) is applied to simulate the high plateau low-pressure hypoxia condition. SD rats were placed in the laboratory chamber for 7 days of high altitude hypoxic treatment. Setting parameters of the experiment cabin: the simulated altitude is 7000m, the lifting speed is 10m/s, the pressure in the cabin is 56kpa, the oxygen pressure in the cabin is 8.6kpa, the temperature in the cabin is 22.8 ℃, and the humidity in the cabin is 24% RH. The running time of the experimental cabin is 23 h/day, and the day-night ratio is 12h/12 h. The feed, drinking water and padding are replaced after 1 hour of opening the barn every morning. At the same time, equal volume of drinking water (same volume of 6-BA solution used by 6-BA intervention group) is used for carrying out rat gavage when opening the warehouse every day, and the gavage is continuously carried out for 7 days.

6-BA intervention group (6-BA group for short): an experimental cabin (Guizhou wind mine aviation military, Limited liability company) is applied to simulate the high plateau low-pressure hypoxia condition. SD rats were placed in the laboratory chamber for 7 days of high altitude hypoxic treatment. Setting parameters of the experiment cabin: the simulated altitude is 7000m, the lifting speed is 10m/s, the pressure in the cabin is 56kpa, the oxygen pressure in the cabin is 8.6kpa, the temperature in the cabin is 22.8 ℃, and the humidity in the cabin is 24% RH. The operation time of the experimental cabin is 23 h/day, the day and night are 12h/12h, and the experimental cabin is opened 1 hour every morning to replace feed, drinking water and padding. Meanwhile, 6-BA (Sanland corporation, batch No. 201212201, 25 g/bottle, USA) is dissolved in dilute HCl with concentration of 0.06mol/L to prepare 6-BA stock solution with concentration of 10 g/L. The rats were gavaged at the time of daily opening at a dose of 100mg/kg/d for 7 consecutive days.

Normal pressure and normal oxygen control group (control group or con group for short): the rats in the normal pressure and normal oxygen control group are placed outside the experimental cabin, and the treatment is identical to that of the rats in the experimental group.

3. The experimental method comprises the following steps: three groups of animals are killed by a neck breaking method after the experiment is finished and taken out of the chamber, and the complete heart is picked up to carry out HE staining to observe histopathological changes. The water content of the myocardial tissue is measured by a dry-wet weight method. Real-time PCR detects the mRNA expression level of the myocardial tissue aquaporin 1(aquaporin1, AQP1) and the miR-144-3p expression level.

The method for detecting the water content of the myocardial tissue comprises the following specific steps: after each group of animals die after anesthesia, the thoracic cavity is cut open, the heart is taken out under the aseptic condition, the heart is rinsed by physiological sodium chloride solution at 4 ℃, after the heart is sucked dry by filter paper, the wet mass of the heart is weighed by an electronic balance, the heart is placed in a constant temperature drying oven at 80 ℃ to be dried for 48 hours until the heart is weighed constantly, the dry mass of the heart is weighed, and the water content of the myocardial tissue is calculated according to the following formula: myocardial tissue water content { (wet heart weight-dry heart weight)/wet heart weight } × 100%.

The method for detecting the myocardial tissue pathology comprises the following specific steps: after each group of animals died under anesthesia, the thoracic cavity was dissected open and the heart was removed under aseptic conditions. The PBS solution was rinsed at 4 ℃ and blotted dry on filter paper. The tissue organ is fixed with 40mL/L paraformaldehyde solution for 24h, dehydrated conventionally, embedded in paraffin, cut into 5 pieces continuously, the piece thickness is about 4 μm, stained by HE, sealed with neutral gum, and observed under light microscope for myocardial histopathological changes.

The real-time PCR detection of the AQP1mRNA expression level of the myocardial tissue comprises the following specific steps: the total RNA of the tissue was extracted by Trizol method from 100mg each of the myocardial tissue specimens of each group of rats. RNA was Reverse transcribed into cDNA by Reverse Transcription Kit, and AQP1mRNA was measured for myocardial tissue using a fluorescent quantitative PCR Kit. The total amount of the assay was 25. mu.l (0.5. mu.l each of the upstream and downstream primers, 12.5. mu.l of Premix, 2. mu.l of cDNA template, ddH)₂O9.5. mu.l). PCR program two-step assay provided in the reference kit: 30s at 95 ℃, 5s at 95 ℃ and 30s at 60 ℃ for 40 cycles. Each experiment was independently repeated 3 times. Beta-actin is used as an internal reference gene and 2 is adopted^-ΔΔCtThe relative expression quantity of mRNA is calculated by the method, and the primer is synthesized by Shanghai. The sequences of the upstream and downstream primers for each gene amplification are as follows:

AQP1 upstream primer: 5'-GCCAGCGAGTTCAAGAAG-3', respectively;

AQP1 downstream primer: 5'-TCCACCACCCTGTTGCTGTA-3' are provided.

Beta-actin upstream primer: 5'-TTCGCGGGCGACGATGC-3', respectively;

beta-actin downstream primer: 5'-CGAAGTCCAGGGCGAC-3' are provided.

Wherein, the amplification products of the AQP1 upstream primer and the AQP1 downstream primer are 230bp in size; the amplification products of the beta-actin upstream primer and the beta-actin downstream primer are 310bp in size.

The real-time PCR detection of the expression level of the myocardial tissue miR-144-3p comprises the following specific steps: 100mg of myocardial tissue specimens of rats in each group are taken, and total RNA of the tissues is extracted by a Trizol method. Application of reverse transcription kit Mir-X^TMThe miRNAs First-StrandSynthesis Kit reversely transcribes the RNA to be detected into cDNA. Using SYBR

The PCR reaction was carried out using the qPCR Premix Kit and 7500 quantitative PCR instrument. And (3) PCR reaction conditions: 10s at 95 ℃, 5s at 95 ℃ and 20s at 65 ℃ for 40 cycles. By using 2^-ΔΔCtCalculating the relative expression level of miRNA, wherein the delta Ct is Ct target gene-Ct reference gene. Each experiment was independently repeated 3 times. The method takes cel-miR-39 as an internal reference gene, and miRNA specific primers are synthesized by Guangzhou Ruibo company. The primer sequences are as follows:

rno-miR-144-3p：

stem-loop primers: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCACTTACAG, respectively;

an upstream primer: 5'-TCGGCAGGTACAGTATAGATG-3', respectively;

a downstream primer: 5'-CTCAACTGGTGTCGTGGA-3', respectively;

Cel-miR-39：

stem-loop primers:

TCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGCCAAGCT；

an upstream primer: 5'-AGTGCACGGTCCGAGGTATT-3', respectively;

a downstream primer: 5'-CGGGTGTAAATCAGCTTGGT-3' are provided.

The statistical method is as follows: analysis was performed using Spss17.0 statistical software. The measurement data are expressed as mean + -standard deviation (X + -S), and normal distribution and homogeneity of variance are tested. The comparison among multiple groups adopts one-factor analysis of variance, and the difference between two groups adopts independent sample t test. Differences defined as p <0.05 are statistically significant.

Second, experimental results

1. Rat myocardial tissue water content detection result

The results of the measurement of the water content in rat myocardial tissue are shown in FIG. 1 and Table 1.

Compared with the control group, the myocardial tissue water content of rats in the hypoxia group and the 6-BA group is obviously increased (p < 0.01). The myocardial tissue water content of rats in the 6-BA group was reduced compared to that in the hypoxic group (P < 0.01). It is shown that 6-BA can relieve myocardial edema caused by high altitude hypoxia.

TABLE 1 detection of myocardial tissue Water content

2. Pathological change of rat cardiac muscle tissue

The results of pathological section of rat myocardial tissue are shown in FIG. 2.

Control rat myocardial tissue: the myocardial cells are clearly defined, pink, myofibrils and transverse striations are visible, and the nuclei are clear. Hypoxic rat myocardial tissue: focal degeneration of the myocardium, sparse fascicles. 6-BA group rat myocardial tissue: little focal degeneration of the myocardium was observed. The myocardial pathology showed that the degree of myocardial tissue damage was lower in the 6-BA group rats than in the hypoxic group.

3. Rat myocardial tissue AQP1mRNA detection result

The results of AQP1mRNA detection in rat myocardial tissue are shown in FIG. 3 and Table 2.

Compared with a control group, the AQP1mRNA expression level of the rat myocardial tissue of the hypoxia group is remarkably increased (P <0.01), and the AQP1mRNA expression level of the rat myocardial tissue of the 6-BA group is not remarkably changed (P > 0.05). Compared with the hypoxia group, the 6-BA group rats have the reduced AQP1mRNA expression level of myocardial tissue (P < 0.05). The 6-BA can reduce the expression level of AQP1mRNA in the myocardial tissue under the high-altitude low-pressure hypoxia environment.

TABLE 2 AQP1mRNA assay results of rat myocardial tissue

4. Rat myocardial tissue miR-144-3p detection result

The results of miR-144-3p detection in rat myocardial tissue are shown in FIG. 4 and Table 3.

Compared with a control group, the expression level of the miR-144-3P in the myocardial tissue of the rat in the hypoxia group is remarkably increased (P <0.01), and the expression level of the miR-144-3P in the myocardial tissue of the rat in the 6-BA group is not remarkably changed (P > 0.05). Compared with the hypoxia group, the 6-BA group rat myocardial tissue miR-144-3P expression level is remarkably reduced (P < 0.05). The 6-BA can reduce the expression level of miR-144-3p in the myocardial tissue under the high-altitude low-pressure hypoxia environment.

TABLE 3 rat myocardial tissue miR-144-3p detection result

The results show that the 6-BA can reduce the water content of the myocardial tissue of the plateau low-pressure hypoxic rat and inhibit the expression of AQP1mRNA and miR-144-3p in the myocardial tissue of the plateau low-pressure hypoxic rat, and the 6-BA has the effect of preventing and treating the myocardial edema caused by the plateau low-pressure hypoxia. The mechanism is supposed to be related to the water transport related to the 6-BA regulation of the AQP1/miR-144-3p of the myocardial tissue. The compound 6-BA has a good treatment effect on the altitude disease generated in the fast-advancing plateau low-pressure low-oxygen environment, has a remarkable effect on treating myocardial edema of a rat simulating the plateau environment of 7000m, and can be developed into a medicament for preventing and treating the altitude disease generated in the plateau low-oxygen environment.

Claims

Application of 1.6-benzylaminopurine in preparation of medicine for preventing and/or treating altitude diseases caused by fast-advancing high altitude low pressure hypoxia environment.
2. The use according to claim 1, wherein the medicament prevents and/or treats myocardial tissue edema caused by an acute entry into a high altitude, low pressure hypoxic environment.
3. The use of claim 1, wherein the medicament reduces the extent of myocardial tissue damage caused by a rush into a high-altitude, low-pressure hypoxic environment.
4. The use according to claim 1, characterized in that the medicament down-regulates the level of expression of the aquaporin gene AQP1 and/or the level of expression of the miR-144-3p gene in myocardial tissue in a fast-advancing high-altitude, low-pressure hypoxic environment.
5. Use according to claim 4, characterized in that: the expression level is mRNA expression level.
6. Use according to any one of claims 2 to 5, characterized in that: the myocardial tissue is mammalian myocardial tissue.
7. Use according to claim 6, characterized in that: the mammal includes a human.