CN109596830B

CN109596830B - Kit for detecting ER-alpha 36 expression level in tumor tissue

Info

Publication number: CN109596830B
Application number: CN201811598781.3A
Authority: CN
Inventors: 孟坤; 陈凤; 白伟; 王伟娜; 郭兰英; 刘雅迪
Original assignee: Beijing Shenogen Biomedical Co ltd
Current assignee: Beijing Shenogen Biomedical Co ltd
Priority date: 2017-12-29
Filing date: 2018-12-25
Publication date: 2022-10-11
Anticipated expiration: 2038-12-25
Also published as: CN109596830A

Abstract

The invention provides a kit for detecting the expression level of ER-alpha 36 in tumor tissues, which comprises the following components: ER-alpha 36 detection antibody reagent and breast cancer tissue quality control tablet. The kit provided by the invention is used for detecting the expression level of ER-alpha 36 in the breast cancer tissue of a patient, so that the prognosis of the breast cancer patient receiving tamoxifen treatment is judged in an auxiliary manner, and a guiding significance is provided for clinical treatment.

Description

Kit for detecting ER-alpha 36 expression level in tumor tissue

Technical Field

The invention relates to a kit for detecting the expression level of ER-alpha 36 in tumor tissues, which is used for detecting the expression level of ER-alpha 36 in breast cancer tumor tissues and belongs to the field of medical instruments.

Background

The estrogen receptor ER-alpha 36 is a brand-new isoform of ER-alpha found and cloned in 2005 in the human mammary epithelial Caveolin-1 haploid deficient cell line study, and has a molecular weight of 36kDa. ER- α 36 differs from ER- α 66 (the usual estrogen receptor) primarily in the nucleus, with the receptor being primarily distributed in the cytoplasm and/or cell membrane. The main difference between the structures of ER- α 36 and ER- α 66 is the absence of the AF-1 and AF-2 regions, which are two transcriptional activation sites, but the DNA binding region and part of the dimer formation and ligand binding region are retained. ER- α 36 functions similarly to growth factor receptors, and acts with a variety of estrogens and is involved in estrogen and antiestrogen-induced cell proliferation. The rapid response of estrogens typically activates, for example, MARK/ERK, phosphatidylinositol-3-kinase, and protein kinase C.

In WO2005087811, the structure, the obtaining method and the use of ER- α 36 are described in detail.

Recently, ER-alpha 36 has been found to be highly expressed in a variety of tumor cells, playing an important role in the development of tumors, particularly in breast cancer. Experiments show that ER-alpha 36 is highly expressed in breast cancer cells and promotes the proliferation and metastasis of the breast cancer cells.

Breast cancer is the most common malignancy in women, with 150 million new cases per year, and about 40 million people die of breast cancer per year. Tamoxifen (TAM) has been used as a standard drug for endocrine therapy in breast cancer patients when the estrogen receptor ER- α 66 expression is positive in such patients. However, the majority of patients with intermediate-and advanced-stage breast cancer eventually have a poor prognosis after receiving tamoxifen treatment. In Journal Of Clinical Oncology, there is published a report entitled "Expression Of ER-alpha 36, a Novel Variant Of Estrogen receptor, and Resistance to Tamoxifen Treatment in Breast Cancer". It is proposed in this paper that treatment with tamoxifen results in a significant reduction in survival for breast cancer patients who are positive for both the estrogen receptors ER- α 36 and ER- α 66. Studies have shown that patients with ER- α 36 overexpression have a poor prognosis in patients with ER- α 66 positive tamoxifen administration; while in patients with ER- α 66 positive without tamoxifen or patients with ER- α 66 negative receiving chemotherapy, ER- α 36 expression has no significant correlation with prognosis. This study was the first to find that overexpression of ER- α 36 is one of the important reasons for the development of primary tamoxifen resistance. Therefore, ER-alpha 36 expression can also be used as an important prediction index for whether ER-alpha 66 positive patients receive tamoxifen treatment, and the potential clinical significance is that if ER-alpha 66 positive breast cancer patients simultaneously express ER-alpha 36, the patients are not suitable for receiving tamoxifen treatment, so blind and ineffective treatment is avoided.

Therefore, standardized detection reagents and detection methods for detecting the expression level of ER- α 36 in a tissue sample of a subject are a problem to be solved.

However, no detection reagent or kit for detecting ER-alpha 36 exists internationally and domestically, and no corresponding standardized detection method exists.

Disclosure of Invention

The invention aims to provide a kit for detecting the expression level of ER-alpha 36 in a breast cancer tumor tissue sample, which can be used for analyzing the prognosis of breast cancer and plays a guiding role in the administration of breast cancer.

One aspect of the present invention provides a kit for detecting the expression level of ER- α 36 in tumor tissue, comprising: ER-alpha 36 detection antibody reagent and breast cancer tissue quality control tablet, wherein the tumor tissue is breast cancer tumor tissue.

Preferably, the breast cancer tissue quality control tablet comprises a clinical negative quality control tablet and a clinical positive quality control tablet.

Preferably, the clinical negative quality control tablet has 2 tablets, and the clinical positive quality control tablet has 2 tablets.

Preferably, the clinical negative quality control wafer comprises 1: quality control tablet with tumor cell staining intensity of 0; 2: the staining intensity is 1+ and the tumor cells with the staining intensity account for the quality control sheet of the total tumor cells in any proportion, and the tumor cells are breast cancer tumor cells.

Preferably, the clinical positive quality control tablet comprises 1: the staining intensity is 2+ and the stained tumor cells account for more than or equal to 50% of the total tumor cells; 2: the staining intensity is 3+, the percentage of the stained tumor cells in the total tumor cells is more than or equal to 25%, and the tumor cells are breast cancer tumor cells.

Preferably, the kit further comprises an unstained quality control tablet of the breast cancer cell line.

Preferably, the breast cancer cell line quality control tablet comprises a breast cancer cell line MDA-MB-231 positive quality control tablet, a breast cancer cell line MCF-7-ER-alpha 36 positive quality control tablet and a breast cancer cell line MCF-7 negative quality control tablet.

Preferably, the breast cancer cell line MDA-MB-231 positive quality control tablet is prepared from MDA-MB-231 breast cancer cells highly expressing ER-alpha 36; the breast cancer cell line MCF-7-ER-alpha 36 positive quality control tablet is prepared from MCF-7 breast cancer cells which externally over-express ER-alpha 36; the breast cancer cell line MCF-7 negative property control tablet is prepared from MCF-7 breast cancer cells with low expression of ER-alpha 36.

Preferably, the ER-alpha 36 detection antibody reagent contains a sequence of SNGmB 1.

More preferably, the concentration of the ER-alpha 36 detection antibody reagent is 7 mu g/ml-25 mu g/ml.

Preferably, the tumor tissue is breast cancer tumor tissue obtained through operation or puncture, and a paraffin-embedded breast cancer tumor tissue specimen is fixed through xylene.

Preferably, said detecting the expression level of ER- α 36 in tumor tissue comprises the steps of: 1. preparing tumor tissue wax blocks and slices; 2. staining the sections by immunohistochemical methods; 3. reading the clinical result of the stained section expressing ER-alpha 36 by referring to the breast cancer tissue quality control sheet; the expression level of ER-alpha 36 in the tumor tissue of the subject is evaluated.

Preferably, the clinical negative nature control tablet and the clinical positive nature control tablet are four quality control tablets as shown in figure 2.

In a further aspect, the invention provides the use of a kit of the invention for detecting the expression level of ER-alpha 36 in breast cancer tumor tissue.

The kit for detecting the expression level of ER-alpha 36 in the tumor tissue detects the expression level of ER-alpha 36 in the breast cancer tissue by utilizing the principle of specific binding of immunohistochemical antigen and antibody. And comparing the detected ER-alpha 36 staining intensity, the percentage of the breast cancer tumor cells with the total tumor cells and the breast cancer tissue quality control sheet to judge the expression level of ER-alpha 36 in the tumor tissue of the detected object. When the ER-alpha 66 of the detected person is positive and the expression level of the ER-alpha 36 level is clinical negative, judging that the prognosis of the detected person receiving tamoxifen endocrine therapy is good; when the ER-alpha 66 of the detected object is positive and the expression level of the ER-alpha 36 level is clinical positive, judging that the prognosis of the detected object receiving tamoxifen endocrine treatment is not good, and not recommending the treatment by using tamoxifen. Poor prognosis indicates that a breast cancer patient is at risk for recurrence or metastasis.

For breast cancer patients with ER-alpha 66 and ER-alpha 36 expression which are clinically positive, aromatase inhibitors are more suitable for treatment; for breast cancer patients with ER-alpha 66 expression as positive and ER-alpha 36 expression as clinical negative, the tamoxifen treatment is more suitable.

When the system quality control is carried out in the kit, a breast cancer cell line quality control tablet is sometimes adopted. The quality control tablet of cell line is different from the quality control tablet of breast cancer tissue. Whether all steps of immunohistochemical staining are correct and whether the related auxiliary reagents are degraded can be confirmed by whether the cell line positive quality control chip achieves the expected staining intensity. Control cell line negative quality control tablets can be used to test the specificity of reagents purchased by the user. The tracing process of the ER-alpha 36 cell line quality control chip is shown in example 5 and attached FIG. 3.

The invention is used for detecting the marker ER-alpha 36 in a tumor tissue specimen, and over 1000 clinical cases prove that the detection reagent has high accuracy and specificity.

The reagent provided by the invention is verified to have good repeatability and stability through within-batch and between-batch repeatability tests and accelerated stability tests.

The invention is used for detecting the expression level of ER-alpha 36 in the breast cancer tissue of a patient, thereby assisting in judging the prognosis of the breast cancer patient receiving tamoxifen treatment and providing guiding significance for clinical treatment.

Drawings

FIG. 1 shows the results of immunohistochemical staining of breast cancer tissue sections with different concentrations of antibody.

FIG. 2 shows a plot of staining intensity and staining area evaluation for ER- α 36 in breast cancer tissue; upper left panel: quality control sheet with tumor cell staining intensity of 0; upper right view: the staining intensity is 1+ and the tumor cells with the staining intensity account for the quality control sheet of the total tumor cells in any proportion; lower left panel: the staining intensity is 2+ and the percentage of the staining intensity tumor cells in the total tumor cells is more than or equal to 50 percent; right lower panel: the staining intensity is 3+ and the percentage of the staining intensity tumor cells in the total tumor cells is more than or equal to 25%.

FIG. 3 shows a tracing procedure of quality control wafer in the kit.

FIGS. 4A-D show the overall survival and disease-free survival after surgery for breast cancer patients with different levels of ER- α 66 and ER- α 36 expression. FIG. 4A shows that both ER- α 66 and ER- α 36 expression are clinically positive patients with significantly poorer overall survival than patients with ER- α 66 clinical positive and ER- α 36 clinical negative; FIG. 4B shows that disease-free survival of patients with both ER- α 66 and ER- α 36 expression is significantly worse than patients with both ER- α 66 clinical positive and ER- α 36 clinical negative; FIG. 4C shows that ER- α 66 is clinically negative, and overall survival for patients with ER- α 36 expression that is clinically positive is significantly worse than for patients with ER- α 66 that are clinically negative ER- α 36; FIG. 4D shows that ER- α 66 is clinically negative, and ER- α 36 expression is significantly worse in disease-free survival in patients who are clinically positive than in patients who are clinically negative for ER- α 66 and ER- α 36.

Detailed Description

The following examples are intended to illustrate the present invention, but are not intended to limit the present invention, and modifications, changes, variations, etc. made within the scope of the present invention are within the scope of the present invention.

Unless otherwise indicated, the term "tumor" as used herein refers to an abnormal lesion formed by the loss of normal regulation of growth of a certain cell of a local tissue at the gene level under the action of various factors, resulting in clonal abnormal hyperplasia, and the tumor is generally classified into benign and malignant types by academia.

The term "subject" refers to a breast cancer patient whose expression of ER- α 36 in breast tissue is detected by the kit of the invention.

The term "recurrence of breast cancer" means that the same cancer cells as the original cancer cells reappear in the initially diseased region of breast cancer at the early stage of breast cancer recovery or remission.

The term "metastasis" means that the same cancer cells as the original cancer cells are found again in the region other than the region where the breast cancer was originally diseased at the early stage of the breast cancer recovery or remission.

The term "tumor tissue specimen" refers to breast tumor tissue obtained by surgery or puncture, which is then fixed, dehydrated, cleared and waxed, paraffin embedded and re-sectioned with paraffin to obtain a tumor tissue specimen for immunohistochemical detection.

The term "immunohistochemistry" refers to the determination of antigens in tissue cells by using the basic principle of immunology, namely the principle of specific binding of antigens and antibodies, and the color development of color development agents for marking antibodies through chemical reaction, and the localization and qualitative research of the antigens are carried out.

The term "puncture" refers to the examination of a suspicious lesion (e.g., a lump, a thickened area, a calcified lesion, etc.) of the breast by puncturing a portion of the glandular tissue with the aid of a hollow needle.

The term "MDA-MB-231 breast cancer cells highly expressing ER-alpha 36"

Purchased from ATCC under the trade designation HTB-26, and the background of this cell line was defined as being in a state of high ER-alpha 36 expression.

The term "MCF-7 breast cancer cells with low expression of ER-alpha 36" was purchased from ATCC under the trade name HTB-22, and the background of the cell line is in the state of low expression of ER-alpha 36.

The term "MCF-7 breast cancer cells overexpressing ER- α 36" refers to an MCF-7 breast cancer cell line obtained by transfecting ER- α 36 with the aforementioned MCF-7 breast cancer cells overexpressing ER- α 36 by the following method.

MCF-7 human Breast cancer cells purchased from ATCC, the cells having been treated at 37 ℃,5% ₂ Culturing in medium. To establish the MCF-7 cell line expressing recombinant ER-. Alpha.36, the cell line was cultured at 1x 10 per 60mm dish ⁵ The density of cells was cultured and the vector turned on by the Cytomegalovirus (CMV) promoter in the mammalian expression vector pCB6+ was transfected with a transfection agent (Lipofectamine 2000 purchased from invitrogen) for 24 hours. The expression vector contained the full length ER- α 36cDNA (see SEQ ID NO:21 for ER- α 36cDNA, CN102504025, nucleotide sequence 234-1166 also in GenBank accession No. BX 640939), a blank expression vector was also transfected into the cells as a control, the cells were cultured again 48 hours after transfection and selected with 500. Mu.g/ml of the genetic toxin (G418) for 2 weeks, and the medium was cultured every 3 daysThe medium was changed once until cloning occurred.

"quality control tablet for breast cancer cell line" means a quality control tablet prepared by the following method. The expression of ER-alpha 36 in the three cell lines is verified by an immunoblotting (Western Blot) experiment. The 3 cell lines were separately expanded and cultured, and the cells were digested, centrifuged, washed with phosphate buffer, suspended in 10% formalin overnight (about 20 hours) at room temperature, centrifuged, and formalin was discarded. The cells were transferred into a 1.5ml centrifuge tube and left to stand for 30 minutes, and then the excess formalin was aspirated as clean as possible. Carefully mix the cells and pre-warmed melted agar, mix for 5 minutes, put the cell-agar mixture into a refrigerator for 2-3 minutes, and extrude the cell-agar-mixture. And dehydrating by a full-automatic dehydrator and embedding by paraffin to prepare the cell line quality control tablet. The tissue wax block needs to be frozen in a refrigerator at-20 ℃ for a minimum of 30 minutes before being sliced by a paraffin microtome to prevent cell deformation and overlapping during slicing. Each slice had a thickness of 3 μm and was stored at-20 ℃. When the breast cancer cell line quality control tablet is used for detecting a tumor tissue, the breast cancer cell line quality control tablet and the tumor tissue detection tablet are stained together.

Example 1

See PCT/CN2014/073673, which is incorporated herein by reference.

The ER- α 36 antibodies provided below include SNGmB1 antibodies.

The SNGmB1 antibody provided by the invention is a monoclonal antibody of ER-alpha 36 of a murine source. Comprises an amino acid sequence of SEQ ID:1 and the amino acid sequence SEQ ID NO: 2. The nucleotide sequences encoding the light chain and the heavy chain of the SNGmB1 antibody are respectively SEQ ID NO:17 and SEQ ID NO:19. the amino acid sequences of the light and heavy chains are shown below, with the CDR regions italicized and underlined, and the constant regions italicized with shading.

Amino acid sequence of SNGmB1 light chain (SEQ ID NO: 1):

amino acid sequence of SNGmB1 heavy chain (SEQ ID NO: 2):

nucleotide sequence of the murine antibody SNGmB1 encoding the light chain (SEQ ID NO: 9):

5‘-gaaacaactgtgacccagtctccagcatccctgtccatggctataggagaaaaagtcaccatcagatgcataaccagcactgatattgatgatgatatgaactggtaccggaagaagccagggcaacctcctaagctccttatttcagaaggcaatactcttcgtcctggagtcccatcccgattctccagcagtggctatggtacagattttgtttttacaattgaaaacatgctctcagaagatgttgcagattactactgtttgcaaagtgataacttgcctcttacgttcggtgctgggaccaagctggagctgaaacgggctgatgctgcaccaactgtatccatcttcccaccatccagtgagcagttaacatctggaggtgcctcagtcgtgtgcttcttgaacaacttctaccccaaagacatcaatgtcaagtggaagattgatggcagtgaacgacaaaatggcgtcctgaacagttggactgatcaggacagcaaagacagcacctacagcatgagcagcaccctcacgttgaccaaggacgagtatgaacgacataacagctatacctgtgaggccactcacaagacatcaacttcacccattgtcaagagcttcaacaggaat gagtgttaa-3’

nucleotide sequence of the murine antibody SNGmB1 encoding the heavy chain (SEQ ID NO: 10):

5’-caggcttatctacagcagtctggggctgagctggtgaggcctggggcctcagtgaagatgtcctgcaaggcttctggctacacatttaccagtcacaatatgcactggataaagcagacacctagacagggcctggaatggattggagctattcatccagtaaatggtgatactgcctacaatcagaagttcaagggcaaggccacactgactgtagacaaatcctccagcacagcctacctgcaactcagcagcctgacatctgaagagtctgcggtctatttctgtgcaagagaggggtacggtagtgttgactactggggccaaggcaccactctcaccgtctcctcagctaaaacaacacccccatcagtctatccactggcccctgggtgtggagatacaactggttcctccgtgactctgggatgcctggtcaagggctacttccctgagtcagtgactgtgacttggaactctggatccctgtccagcagtgtgcacaccttcccagctctcctgcagtctggactctacactatgagcagctcagtgactgtcccctccagcacttggccaagtcagaccgtcacctgcagcgttgctcacccagccagcagcaccacggtggacaaaaaacttgagcccagcgggcccatttcaacaatcaacccctgtcctccatgcaaggagtgtcacaaatgcccagctcctaacctcgagggtggaccatccgtcttcatcttccctccaaatatcaaggatgtactcatgatctccctgacacccaaggtcacgtgtgtggtggtggatgtgagcgaggatgacccagacgtccagatcagctggtttgtgaacaacgtggaagtacacacagctcagacacaaacccatagagaggattacaacagtactatccgggtggtcagcaccctccccatccagcaccaggactggatgagtggcaaggagttcaaatgcaaggtcaacaacaaagacctcccatcacccatcgagagaaccatctcaaaaattaaagggctagtcagagctccacaagtatacatcttgccgccaccagcagagcagttgtccaggaaagatgtcagtctcacttgcctggtcgtgggcttcaaccctggagacatcagtgtggagtggaccagcaatgggcatacagaggagaactacaaggacaccgcaccagtcctagactctgacggttcttacttcatatatagcaagctcaatatgaaaacaagcaagtgggagaaaacagattccttctcatgcaacgtgagacacgagggtctgaaaaattactacctgaagaagaccatctcccggtctccgggtaaataa-3’

table 1 shows CDR sequences of SNGmB1 antibody

TABLE 1

CDR	Sequence of	SEQ ID NO.
			LCDR1	ITSTDIDDDMN	SEQ ID NO：3
LCDR2	EGNTLRP	SEQ ID NO：4
			LCDR3	LQ SDNLPLT	SEQ ID NO：5
HCDR1	SHNMH	SEQ ID NO：6
			HCDR2	AIHPVNGDTAYNQKFKG	SEQ ID NO：7
HCDR3	EGYGSVDY	SEQ ID NO：8

In certain embodiments, an antibody to ER- α 36 and a polypeptide comprising at least one amino acid sequence selected from SEQ ID nos: 3-8, the CDR regions are for binding to an antigen, however not all 6 CDRs are indispensably bound to an antigen, one or more CDRs of the SNGmB1 antibody can be replaced while still retaining selectivity and affinity for binding to ER- α 36 antigen.

Example 2

Selection of the Final concentration of the reagents of the invention

Antibody concentration gradients were diluted to 7ug/ml, 12.5ug/ml, 15ug/ml, 17.5ug/ml and 25ug/ml and sections of the same breast cancer tissue were simultaneously immunohistochemically stained using the experimental procedure of example 3. The staining results are shown in FIG. 1.

The results show that: the intensity of staining of tissue sections increases with increasing antibody concentration in the concentration range of 7.0ug/ml to 25 ug/ml. Therefore, the antibody concentration of 7.0ug/ml to 25ug/ml is selected, the staining intensity of the antibody in the above concentration range is suitable, and the background is clean.

Example 3

Obtaining pathological section for reading by immunohistochemical method

Fixing: tumor tissue obtained by surgery or puncture is first soaked in formalin fixative and fixed for 24 hours.

Washing and cleaningDewatering: the fixed tissue was then gradually dehydrated with ethanol at concentration gradients of 50%, 70%, 85%, and 95% and absolute ethanol.

Is transparent: soaking the dehydrated tissue in a mixed solution of absolute ethyl alcohol and dimethylbenzene = 1: 1 for 20 minutes, then transferring the tissue into pure dimethylbenzene to soak for 10 minutes, and then repeatedly soaking the tissue into another bottle of dimethylbenzene for 10 minutes to carry out proper transparent treatment.

Wax impregnation and embedding: after the transparent treatment, the tissue material is put into the mixed liquid of the melted paraffin and the xylene with equal amount for half an hour, then the tissue material is sequentially transferred into 2 melted paraffin liquid for respective immersion for one half an hour, and the wax immersion is carried out in a warm box at about 60 ℃. And (3) putting the tissue material block subjected to wax dipping into a container filled with wax liquid, putting the tissue material block in the wax, and quickly putting the tissue material block into cold water for cooling after the surface layer of the wax liquid is rapidly solidified to obtain the wax block containing the tissue block.

Slicing: after wax penetration, embedding by paraffin, and cutting into pathological sections with the thickness of 3 mu m after the wax block is solidified.

Dewaxing hydration: the slices were baked in an oven at 65 ℃ for 2 hours, then soaked in xylene for 10 minutes and 2 times to remove paraffin, then soaked in 100% ethanol for 3 minutes and 2 times, 95% ethanol for 3 minutes, 85% ethanol for 3 minutes and 75% ethanol for 3 minutes in sequence, and finally washed 5 times with Phosphate Buffered Saline (PBS) containing 0.01% tween 20 for 2 minutes each time.

Antigen retrieval: and (3) repairing the antigen by adopting a high-pressure repairing method, completely immersing the slice in 1mmol EDTApH8.0 antigen repairing liquid, heating to boil under high pressure, starting timing by an air supply valve of the pressure cooker, naturally cooling the pressure cooker to room temperature after 2 min and 30 sec, and taking out the slice.

Elimination of endogenous peroxidases: washed 5 times with Phosphate Buffered Saline (PBS) containing 0.01% tween 20 for 2 minutes each time. The slices were placed in a fresh container of 3% hydrogen peroxide (H) ₂ O ₂ ) The reaction dish was incubated in an oven at 37 ℃ for 30 minutes to inactivate the endogenous peroxidase.

Serum blocking: washed 5 times with Phosphate Buffered Saline (PBS) containing 0.01% tween 20 for 2 minutes each time. 10% goat serum was added to the tissue area delineated by the immunohistochemical pen and incubated in an oven at 37 ℃ for 20 minutes to block non-specific antigens.

Using antibodies: excess fluid on and around the tissue was carefully spun off and wiped off, and primary antibody reagent, 15. Mu.g/ml antibody reagent from example 2 (using SNGmB1 antibody), was added dropwise, overnight (preferably 16 to 18 hours) at 4 ℃ and allowed to warm again for 30 minutes at room temperature. Washed 5 times with Phosphate Buffered Saline (PBS) containing 0.01% tween 20 for 2 minutes each time. And (3) dropwise adding a proper amount of horseradish peroxidase labeled secondary antibody working solution, and incubating for 30 minutes at 37 ℃.

Washing and developing:washed 5 times with Phosphate Buffered Saline (PBS) containing 0.01% tween 20 for 2 minutes each time. Developing with color developing agent for 2-3 min, observing under microscope, stopping developing, staining with hematoxylin for 2 min, washing with tap water for 2 min, placing in hydrochloric acid and ethanol for 1 s, washing with Phosphate Buffer Solution (PBS) or tap water for returning blue, dehydrating, transparentizing, and sealing. Making into pathological tablet for reading.

Example 4

Detection of ER-alpha 66 expression in breast cancer tissue as expression of ER-alpha 36 in clinically positive tumor tissue, and milk Preparation of adenocarcinoma tissue quality control tablet

By immunohistochemistry, the expression of ER-alpha 36 was examined in 500 ER-alpha 66 positive breast cancer cases. The prepared wax block containing the tissue block was subjected to sectioning, deparaffinization and hydration, antigen retrieval, elimination of endogenous peroxidase, serum blocking, incubation with SNGmB1 antibody and horseradish peroxidase-labeled secondary antibody working solution, diaminobenzidine (DAB) color development, and dehydrated transparent mounting according to the method of example 3 to prepare a pathological section for reading, hereinafter referred to as a test piece.

The test piece was read under a microscope, and the staining intensity of ER-. Alpha.36 was graded for 500 breast cancer patients, which were defined as four staining intensities of 0, 1+, 2+ and 3+, respectively, with a clean background and positive signals localized to the cell membrane and/or cytoplasm. The corresponding figures for these four staining intensities are shown in FIG. 2. The staining intensity scores for ER- α 36 were therefore set to four grades, 0, 1+, 2+ and 3+.

Criteria for clinical positive interpretation: when the staining intensity of the breast cancer cells on the detection sheet is 2+, and the percentage of the breast cancer cells stained with the intensity to the total breast cancer cells is more than or equal to 50%; or the staining intensity of the breast cancer cells on the detection sheet is 3+, and the percentage of the breast cancer cells stained with the intensity to the total breast cancer cells is more than or equal to 25%; the tumor tissue staining sheet is a clinical positive staining sheet.

Criteria for clinical negative interpretation: when the staining intensity is 0 or 1+, the breast cancer cells with the two staining intensities account for any proportion of the breast cancer cells; or staining intensity is 2+ and the percentage of breast cancer cells of this intensity is < 50% of the total breast cancer cells; or the staining intensity is 3+ and the percentage of breast cancer cells stained with this intensity is < 25% of the total breast cancer cells. The above staining sheet for tumor tissue is a clinical negative staining sheet.

When multiple staining intensities were present on the stained cells, the interpretation criteria were as follows.

When only stained cells with the staining intensity of 0 or 1+ were present on the stained cells, regardless of the ratio of the stained cells of both intensities, the tumor tissue was judged to be negative for ER-alpha 36 expression overall.

When only stained cells with staining intensity of 2+ or 3+ were present on the stained cells, the expression of ER-alpha 36 in tumor tissue was judged to be positive overall regardless of the ratio of the stained cells of both intensities.

When various staining intensities appear on stained cells, for example: the staining intensity of 2+ and 3+ can be clinically positive, the staining intensity of 0 + and 1+ can only be clinically negative, and the proportion of cells with one or two of the staining intensities of 2+ and 3+ is used for determining whether the tumor tissue is positive for ER-alpha 36 expression. Namely: if the proportion of the breast cancer cells with the staining intensity of 2+ or 3+ reaches clinical positive, judging that the breast cancer tumor tissue staining sheet is clinically positive; if the proportion of the breast cancer cells with the staining intensity of 2+ or 3+ is clinically positive, judging that the tumor tissue staining slice is clinically positive; if the proportion of the breast cancer cells with the staining intensity of 2+ or 3+ does not reach clinical positive, the tumor tissue staining sheet is judged to be clinical negative.

Therefore, the formalin fixed paraffin embedded human breast cancer tissue is subjected to ER-alpha 36 immunohistochemical staining, a tissue sample with good tissue morphology and accurate positive cell positioning is screened, and the ER-alpha 36 tissue quality control tablet is prepared according to the staining intensity (3 +,2+,1+ and 0) of ER-alpha 36 and the cell proportion of each staining intensity. 2 clinical positive nature control tablets, the first: a quality control tablet with staining intensity of 2+ and the percentage of tumor cells with staining intensity in the total tumor cells is more than or equal to 50%, as shown in the lower left of figure 2; and (3) second sheet: the staining intensity is 3+ and the percentage of the tumor cells with the staining intensity in the total tumor cells is more than or equal to 25%, as shown in the lower right part of figure 2. 2 negative control sheets in total, the first sheet: quality control tablet with tumor cell staining intensity of 0; as shown in fig. 2, top left, second: and the staining intensity is 1+ and the tumor cells with the staining intensity account for any proportion of the total tumor cells, as shown in the upper right part of the figure 2.

The above four quality control wafers can be respectively presented in the form of one sheet in the kit, and can also be integrated on one sheet and divided into 4 parts for presentation. And reading the expression level of ER-alpha 36 of the breast cancer patient by referring to the four quality control tablets each time a pathologist judges the expression level. The quality control sheet and the detection sheet are dyed together for interpretation.

The kit can be used for placing the breast cancer tissue quality control sheets with four staining intensities which are already stained; four breast cancer tissue quality control discs that were not stained can also be used. When the quality control wafer which is not dyed is used, the quality control wafer and the detection wafer are parallelly subjected to a dyeing experiment, and then the wafer is read.

Example 5

Tracing program performed by breast cancer cell line quality control tablet (tracing program corresponding to figure 3)

The specificity and the antigen binding capacity of the ER-alpha 36 monoclonal antibody are detected and verified by an immunoblotting (Western Blot) method and an enzyme-linked immunosorbent assay (ELISA) method, and epitope identification and antibody affinity determination are carried out. Then, the staining location and intensity of the positive cells are confirmed by immunohistochemical staining of the cell line quality control chip.

The cell line quality control tablet is prepared by using cells with high expression, over expression and low expression of ER-alpha 36. Cells highly expressing ER- α 36 are MDA-MB-231 breast cancer cells; cells overexpressing ER- α 36 refer to MCF-7 breast cancer cells transfected with ER- α 36 virus, i.e., MCF-7-ER- α 36 breast cancer cells; the cells that underexpress ER-alpha 36 are MCF-7 breast cancer cells.

Staining the cell line quality control chip by an immunohistochemical method to prepare a pathological chip for reading, and reading the pathological chip under a microscope. MDA-MB-231 highly expressing ER-alpha 36 and MCF-7-ER-alpha 36 excessively expressing ER-alpha 36 of the breast cancer cell line are positive cell line quality control tablets: it is expected that the cells will be stained brownish yellow on the cytoplasm and/or cell membrane, with no background staining, and the staining intensity corresponding to the quality control slice of breast cancer tissue will be 2+ and 3+, respectively. MCF-7 of the breast cancer cell line low expression ER-alpha 36 is a negative cell line quality control sheet: cells were not expected to be colored brown-yellow, and the staining intensity corresponding to breast cancer tissue quality control tablets was 0.

The correctness of the immunohistochemical staining procedure was verified by the above method based on the cell line quality control chip of ER-alpha 36, and it was confirmed whether the reagents were degraded or not. If the reagent is degraded, the positive cell line quality control tablet can reduce the expected cell expression intensity, and is not suitable for use.

The breast cancer tissue slices are detected by the determined immunohistochemical method, and tissue samples with complete cell morphology, accurate positive signal positioning and clean background and different expression intensities are screened out to be used as breast cancer tissue quality control tablets. And then, performing immunohistochemical staining on the breast cancer tissue quality control sheet and the detection sheet simultaneously so as to determine whether the staining program is correct or not and whether the antibody is invalid or not, and using the staining program as a reference for interpretation standards during reading.

Example 6

In-and inter-batch reproducibility studies of the antibody reagents of the invention

In-batch reproducibility: 3 continuous slices of an ER-alpha 36 clinical negative property control sheet N1 (with the staining intensity of 0) of a breast cancer tissue, 3 continuous slices of an ER-alpha 36 clinical negative property control sheet P1 (with the staining intensity of 1 +) of the breast cancer tissue, 3 continuous slices of an ER-alpha 36 clinical positive property control sheet P2 (with the staining intensity of 2+ and the percentage of tumor cells in the staining intensity of more than or equal to 50%) of the breast cancer tissue, 3 continuous slices of an ER-alpha 36 clinical positive property control sheet P3 (with the staining intensity of 3+ and the percentage of tumor cells in the staining intensity of more than or equal to 25%) of the breast cancer tissue are taken, immunohistochemical detection is carried out according to the method of the embodiment 3, 3 repeated detections are carried out on each tissue, and the expression level of the ER-alpha 36 in a breast cancer tissue sample is detected by using the same batch of reagents. The results show that: the staining intensity and the location of the same batch of antibody reagent on breast cancer tissue sections from the same tissue source have no obvious difference.

Batch-to-batch repeatability: 3 continuous slices of an ER-alpha 36 clinical negative property control sheet N1 (the staining intensity is 0) of a breast cancer tissue, 3 continuous slices of an ER-alpha 36 clinical negative property control sheet P1 (the staining intensity is 1 +) of the breast cancer tissue, 3 continuous slices of an ER-alpha 36 clinical positive property control sheet P2 (the staining intensity is 2+, the percentage of tumor cells with the staining intensity to total tumor cells is more than or equal to 50%) of the breast cancer tissue, 3 continuous slices of an ER-alpha 36 clinical positive property control sheet P3 (the staining intensity is 3+, the percentage of tumor cells with the clinical positive staining to total tumor cells is more than or equal to 25%) of the breast cancer tissue, and 3 batch number reagents are used for carrying out ER-alpha 36 immunohistochemical detection, and 3 repeated detections are carried out on each tissue. The results show that: the staining intensity and the location of different batch antibody reagents on breast cancer tissue sections from the same tissue source have no obvious difference. (the same batch of antibody reagent shows the difference of different expression levels of breast cancer tissue sections)

Example 7

Study on detection accuracy of antibody reagent of the present invention

5 clinical positive tissue sections of different pathological types of breast cancer ER-alpha 36 are taken, immunohistochemical detection is carried out according to the method in example 3, and the expression level of ER-alpha 36 in breast cancer tissue samples is detected by using 3 batches of reagents. The results show that: under light microscopy, a brownish yellow coloration of the cytoplasm and/or cell membrane of the expected cells was seen with no background staining and no significant difference between the 3 batches of antibody reagents.

Example 8

Study of detection specificity of antibody reagent of the present invention

3 cases of tissue sections with 0 staining intensity of ER-alpha 36 of breast cancer were taken and immunohistochemical detection was performed according to the method of example 3, and 3 batches of reagents were used to detect the expression level of ER-alpha 36 in breast cancer tissue samples. The results show that: under light microscopy, it was seen that no tan staining was seen on the cytoplasm and/or cell membrane of the expected cells, and there was no background staining, and there was no significant difference between the 3 batches of antibody reagents.

Other tumor tissues, clear cell carcinoma of kidney, lung, bladder and prostate cancer, and normal tissues of spleen, pancreas, lung, skeletal muscle and ovary of human body were sectioned for immunohistochemical detection according to the method of example 3, and 3 batches of reagents were used to detect the expression level of ER- α 36 in breast cancer tissue samples. The results show that: under light microscopy, no tan staining was seen on the cytoplasm and/or cell membrane of the expected cells, and no background staining and no significant difference between 3 batches of reagents was seen.

Example 9

Stability study of antibody reagents of the invention

The antibody reagent was left at 37 ℃ for at least 7 days (corresponding to 2-8 ℃ storage, with a validity period of 1 year), and the stability of the antibody reagent was examined according to the methods of examples 6, 7, and 8.

Therefore, the reagent has good storage stability, can be stored at the temperature of 2-8 ℃, and has the storage life of 1 year.

Example 10

Detection of ER-alpha 36 expression in tumor tissue of breast cancer patients with lymph node metastasis

The experimental method comprises the following steps: tumor tissues of breast cancer patients obtained by surgery or puncture were selected, and the expression of ER-alpha 36 in the breast cancer tissues of these patients was determined by the immunohistochemical method of examples 3 and 4. And testing these patients for lymph node metastasis. Note: the expression of ER-alpha 36 as clinically negative indicates that the staining intensity of ER-alpha 36 is 0 or 1+ as detected in example 4, and the two staining intensities are any proportion of tumor cells in the total population; the expression of ER-alpha 36 as clinically positive indicates the case where the staining intensity of ER-alpha 36 is 2+ and the stained tumor cells account for 50% or more of the total tumor cells and the staining intensity is 3+ and the stained tumor cells account for 25% or more of the total tumor cells, as detected in example 4.

The experimental results are as follows:

from the above analysis, it can be seen that in the above 1068 breast cancer patients, the proportion of patients with clinical positivity to ER- α 36 was higher in patients with tumor size over 2cm than in patients with clinical negativity to ER- α 36; the proportion of patients with clinical positive ER-alpha 36 in patients with histology above grade II is higher than that of patients with clinical negative ER-alpha 36; in the patients with lymph node metastasis, the proportion of patients clinically positive for ER- α 36 is larger than that of patients clinically negative for ER- α 36, and the difference between the proportions of patients clinically positive for ER- α 36 and clinically negative for ER- α 36 increases as the number of lymph node metastases increases. Thus, it can be seen that disease progression in breast cancer patients is directly correlated to expression of ER- α 36.

The grading of breast cancer tumors is mainly assessed by evaluating in 3 aspects, 1. The extent of duct formation; 2. nuclear polymorphism; 3. and (4) counting the nuclear fission. According to the classification standard of the international health organization:

1. duct formation (1)% 75% is 1 point, (2)% 10% -75% is 2 points, (3) < 10% is 3 points.

2. The polymorphism of nuclei (1) is 1 point for small, regular and uniform nuclei, (2) is 2 points for moderate variation in the properties and size of nuclei, and (3) is 3 points for marked differentiation in the properties and size of nuclei.

3. The nuclear fission number (X400) (1) (0-5)/10 HPF is 1 min, (2) (6-10)/10 HPR is 2 min, and (3) > 11/10HPF is 3 min.

HPF is a term specific to medical pathology, and is called high power field in chinese, and generally refers to the range of tissues or smears on pathological sections observed under an ocular lens by a microscope ten times and forty times as long as an objective lens.

Adding the fractions determined by the above 3 indexes, wherein 3-5 are divided into histology grade I, and the differentiation is good; 6-7 are divided into histology II grade, medium differentiation; 8-9 divided into histology grade III, poorly differentiated.

Example 11

Relationship between postoperative survival status and ER-alpha 36 expression in breast cancer patients

Postoperative survival of breast cancer patients with ER- α 36 expression as clinically positive and clinically negative is shown in FIGS. 4A-D. The ordinate "overall survival" in the figure refers to the proportion of patients alive during the period from the start of randomization to death due to any cause. The "disease-free survival" is shown as the proportion of patients with no distant metastasis and no shorter recurrence in the local area.

FIG. 4A shows that overall survival for both ER- α 66 and ER- α 36 expression was significantly worse in patients who were clinically positive than in patients who were clinically negative for ER- α 66.

FIG. 4B shows that disease-free survival of patients with both ER- α 66 and ER- α 36 expression was significantly worse than patients with ER- α 66 clinical positive and ER- α 36 clinical negative.

FIG. 4C shows that ER- α 66 is clinically negative, and overall survival for patients with ER- α 36 expression that is clinically positive is significantly worse than for patients with ER- α 66 that are clinically negative for ER- α 36.

FIG. 4D shows that ER- α 66 is clinically negative, and ER- α 36 expression is significantly worse in disease-free survival in patients who are clinically positive than in patients who are clinically negative for ER- α 66 and ER- α 36.

Thus, it can be seen that the overall survival and disease-free survival of patients is inferior to patients with ER- α 36 expression negative, whether ER- α 66 expression is positive or negative, so long as the patient's ER- α 36 expression is clinically positive.

Example 12

Effect of aromatase inhibitors on survival of breast cancer patients that were clinically positive for both ER- α 36 and ER- α 66

147 postmenopausal patients who were clinically positive for both ER- α 36 and ER- α 66 expression were examined by immunohistochemical methods. In some of these patients, some were treated with tamoxifen and the remainder were treated with aromatase inhibitors, with the results shown in the table below.

The following is a multivariate analysis of disease-free survival and metastasis-free survival of these patients.

Multivariate analysis of disease-free survival and metastasis-free survival of ER-alpha 36 and ER-alpha 66 double clinically positive postmenopausal breast cancer patients

Multifactor model regression analysis revealed that tamoxifen treatment is detrimental to disease-free survival (risk =7.705, p = 0.008) in postmenopausal patients; aromatase inhibitors, however, contribute to disease-free survival in patients (risk =0.779, p = 0.629). Therefore, patients with post-menopausal breast cancer who are clinically positive for both ER-alpha 36 and ER-alpha 66 are more suitable for treatment with aromatase inhibitors.

Sequence listing

<110> Beijing 29637, olympic medicine science and technology Limited

<120> kit for detecting ER-alpha 36 expression level in tumor tissue

<141>

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 214

<212> PRT

<213> amino acid sequence of SNGmB1 light chain

<400> 1

Glu Thr Thr Val Thr Gln Ser Pro Ala Ser Leu Ser Met Ala Ile Gly

1 5 10 15

Glu Lys Val Thr Ile Arg Cys Ile Thr Ser Thr Asp Ile Asp Asp Asp

20 25 30

Met Asn Trp Tyr Arg Lys Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile

35 40 45

Ser Glu Gly Asn Thr Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Ser

50 55 60

Ser Gly Tyr Gly Thr Asp Phe Val Phe Thr Ile Glu Asn Met Leu Ser

65 70 75 80

Glu Asp Val Ala Asp Tyr Tyr Cys Leu Gln Ser Asp Asn Leu Pro Leu

85 90 95

Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg Ala Asp Ala Ala

100 105 110

Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln Leu Thr Ser Gly

115 120 125

Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr Pro Lys Asp Ile

130 135 140

Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln Asn Gly Val Leu

145 150 155 160

Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr Tyr Ser Met Ser

165 170 175

Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg His Asn Ser Tyr

180 185 190

Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro Ile Val Lys Ser

195 200 205

Phe Asn Arg Asn Glu Cys

210

<210> 2

<211> 453

<212> PRT

<213> amino acid sequence of SNGmB1 heavy chain

<400> 2

Gln Ala Tyr Leu Gln Gln Ser Gly Ala Glu Leu Val Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser His

20 25 30

Asn Met His Trp Ile Lys Gln Thr Pro Arg Gln Gly Leu Glu Trp Ile

35 40 45

Gly Ala Ile His Pro Val Asn Gly Asp Thr Ala Tyr Asn Gln Lys Phe

50 55 60

Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Leu Gln Leu Ser Ser Leu Thr Ser Glu Glu Ser Ala Val Tyr Phe Cys

85 90 95

Ala Arg Glu Gly Tyr Gly Ser Val Asp Tyr Trp Gly Gln Gly Thr Thr

100 105 110

Leu Thr Val Ser Ser Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu

115 120 125

Ala Pro Gly Cys Gly Asp Thr Thr Gly Ser Ser Val Thr Leu Gly Cys

130 135 140

Leu Val Lys Gly Tyr Phe Pro Glu Ser Val Thr Val Thr Trp Asn Ser

145 150 155 160

Gly Ser Leu Ser Ser Ser Val His Thr Phe Pro Ala Leu Leu Gln Ser

165 170 175

Gly Leu Tyr Thr Met Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp

180 185 190

Pro Ser Gln Thr Val Thr Cys Ser Val Ala His Pro Ala Ser Ser Thr

195 200 205

Thr Val Asp Lys Lys Leu Glu Pro Ser Gly Pro Ile Ser Thr Ile Asn

210 215 220

Pro Cys Pro Pro Cys Lys Glu Cys His Lys Cys Pro Ala Pro Asn Leu

225 230 235 240

Glu Gly Gly Pro Ser Val Phe Ile Phe Pro Pro Asn Ile Lys Asp Val

245 250 255

Leu Met Ile Ser Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Val

260 265 270

Ser Glu Asp Asp Pro Asp Val Gln Ile Ser Trp Phe Val Asn Asn Val

275 280 285

Glu Val His Thr Ala Gln Thr Gln Thr His Arg Glu Asp Tyr Asn Ser

290 295 300

Thr Ile Arg Val Val Ser Thr Leu Pro Ile Gln His Gln Asp Trp Met

305 310 315 320

Ser Gly Lys Glu Phe Lys Cys Lys Val Asn Asn Lys Asp Leu Pro Ser

325 330 335

Pro Ile Glu Arg Thr Ile Ser Lys Ile Lys Gly Leu Val Arg Ala Pro

340 345 350

Gln Val Tyr Ile Leu Pro Pro Pro Ala Glu Gln Leu Ser Arg Lys Asp

355 360 365

Val Ser Leu Thr Cys Leu Val Val Gly Phe Asn Pro Gly Asp Ile Ser

370 375 380

Val Glu Trp Thr Ser Asn Gly His Thr Glu Glu Asn Tyr Lys Asp Thr

385 390 395 400

Ala Pro Val Leu Asp Ser Asp Gly Ser Tyr Phe Ile Tyr Ser Lys Leu

405 410 415

Asn Met Lys Thr Ser Lys Trp Glu Lys Thr Asp Ser Phe Ser Cys Asn

420 425 430

Val Arg His Glu Gly Leu Lys Asn Tyr Tyr Leu Lys Lys Thr Ile Ser

435 440 445

Arg Ser Pro Gly Lys

450

<210> 3

<211> 11

<212> PRT

<213> LCDR1 sequence of SNGmB1 light chain

<400> 3

Ile Thr Ser Thr Asp Ile Asp Asp Asp Met Asn

1 5 10

<210> 4

<211> 7

<212> PRT

<213> LCDR2 sequence of SNGmB1 light chain

<400> 4

Glu Gly Asn Thr Leu Arg Pro

1 5

<210> 5

<211> 9

<212> PRT

<213> LCDR3 sequence of SNGmB1 light chain

<400> 5

Leu Gln Ser Asp Asn Leu Pro Leu Thr

1 5

<210> 6

<211> 5

<212> PRT

<213> SNGmB1 heavy chain HCDR1 sequence

<400> 6

Ser His Asn Met His

1 5

<210> 7

<211> 17

<212> PRT

<213> SNGmB1 heavy chain HCDR2 sequence

<400> 7

Ala Ile His Pro Val Asn Gly Asp Thr Ala Tyr Asn Gln Lys Phe Lys

1 5 10 15

Gly

<210> 8

<211> 8

<212> PRT

<213> SNGmB1 heavy chain HCDR3 sequence

<400> 8

Glu Gly Tyr Gly Ser Val Asp Tyr

1 5

<210> 9

<211> 645

<212> DNA

<213> nucleotide sequence encoding the light chain of the murine antibody SNGmB1

<400> 9

gaaacaactg tgacccagtc tccagcatcc ctgtccatgg ctataggaga aaaagtcacc 60

atcagatgca taaccagcac tgatattgat gatgatatga actggtaccg gaagaagcca 120

gggcaacctc ctaagctcct tatttcagaa ggcaatactc ttcgtcctgg agtcccatcc 180

cgattctcca gcagtggcta tggtacagat tttgttttta caattgaaaa catgctctca 240

gaagatgttg cagattacta ctgtttgcaa agtgataact tgcctcttac gttcggtgct 300

gggaccaagc tggagctgaa acgggctgat gctgcaccaa ctgtatccat cttcccacca 360

tccagtgagc agttaacatc tggaggtgcc tcagtcgtgt gcttcttgaa caacttctac 420

cccaaagaca tcaatgtcaa gtggaagatt gatggcagtg aacgacaaaa tggcgtcctg 480

aacagttgga ctgatcagga cagcaaagac agcacctaca gcatgagcag caccctcacg 540

ttgaccaagg acgagtatga acgacataac agctatacct gtgaggccac tcacaagaca 600

tcaacttcac ccattgtcaa gagcttcaac aggaatgagt gttaa 645

<210> 10

<211> 1362

<212> DNA

<213> nucleotide sequence encoding the heavy chain of the murine antibody SNGmB1

<400> 10

caggcttatc tacagcagtc tggggctgag ctggtgaggc ctggggcctc agtgaagatg 60

tcctgcaagg cttctggcta cacatttacc agtcacaata tgcactggat aaagcagaca 120

cctagacagg gcctggaatg gattggagct attcatccag taaatggtga tactgcctac 180

aatcagaagt tcaagggcaa ggccacactg actgtagaca aatcctccag cacagcctac 240

ctgcaactca gcagcctgac atctgaagag tctgcggtct atttctgtgc aagagagggg 300

tacggtagtg ttgactactg gggccaaggc accactctca ccgtctcctc agctaaaaca 360

acacccccat cagtctatcc actggcccct gggtgtggag atacaactgg ttcctccgtg 420

actctgggat gcctggtcaa gggctacttc cctgagtcag tgactgtgac ttggaactct 480

ggatccctgt ccagcagtgt gcacaccttc ccagctctcc tgcagtctgg actctacact 540

atgagcagct cagtgactgt cccctccagc acttggccaa gtcagaccgt cacctgcagc 600

gttgctcacc cagccagcag caccacggtg gacaaaaaac ttgagcccag cgggcccatt 660

tcaacaatca acccctgtcc tccatgcaag gagtgtcaca aatgcccagc tcctaacctc 720

gagggtggac catccgtctt catcttccct ccaaatatca aggatgtact catgatctcc 780

ctgacaccca aggtcacgtg tgtggtggtg gatgtgagcg aggatgaccc agacgtccag 840

atcagctggt ttgtgaacaa cgtggaagta cacacagctc agacacaaac ccatagagag 900

gattacaaca gtactatccg ggtggtcagc accctcccca tccagcacca ggactggatg 960

agtggcaagg agttcaaatg caaggtcaac aacaaagacc tcccatcacc catcgagaga 1020

accatctcaa aaattaaagg gctagtcaga gctccacaag tatacatctt gccgccacca 1080

gcagagcagt tgtccaggaa agatgtcagt ctcacttgcc tggtcgtggg cttcaaccct 1140

ggagacatca gtgtggagtg gaccagcaat gggcatacag aggagaacta caaggacacc 1200

gcaccagtcc tagactctga cggttcttac ttcatatata gcaagctcaa tatgaaaaca 1260

agcaagtggg agaaaacaga ttccttctca tgcaacgtga gacacgaggg tctgaaaaat 1320

tactacctga agaagaccat ctcccggtct ccgggtaaat aa 1362

Claims

1. A kit for detecting the expression level of ER- α 36 in tumor tissue, the kit comprising: the ER-alpha 36 detection antibody reagent and the breast cancer tissue quality control sheet, wherein the tumor tissue is breast cancer tumor tissue, and the breast cancer tissue quality control sheet comprises clinical negative and clinical positive quality control sheets; the clinical negative quality control tablet has 2 tablets, the clinical positive quality control tablet has 2 tablets, the clinical negative quality control tablet comprises 1: quality control tablet with tumor cell staining intensity of 0; 2: the quality control tablet with the staining intensity of 1+ and the staining intensity of tumor cells accounting for any proportion of total tumor cells, wherein the tumor cells are breast cancer tumor cells, and the clinical positive quality control tablet comprises the components of 1: the staining intensity is 2+ and the stained tumor cells account for more than or equal to 50 percent of the total tumor cells; 2: the kit comprises a quality control tablet, wherein the staining intensity is 3+, the percentage of stained tumor cells in the total tumor cells is more than or equal to 25%, the tumor cells are breast cancer tumor cells, the ER-alpha 36 detection antibody reagent contains a SNGmB1 sequence, the concentration of the ER-alpha 36 detection antibody reagent is 7-25 mu g/ml, the kit also comprises an undyed breast cancer cell line quality control tablet, and the breast cancer cell line quality control tablet comprises a breast cancer cell line MDA-MB-231 positive quality control tablet, a breast cancer cell line MCF-7-ER-alpha 36 positive quality control tablet and a breast cancer cell line MCF-7 negative quality control tablet.

2. The kit according to claim 1, wherein the breast cancer cell line MDA-MB-231 positive quality control tablet is prepared from MDA-MB-231 breast cancer cells highly expressing ER-alpha 36; the breast cancer cell line MCF-7-ER-alpha 36 positive quality control tablet is prepared from MCF-7 breast cancer cells which externally over-express ER-alpha 36; the breast cancer cell line MCF-7 negative property control tablet is prepared from MCF-7 breast cancer cells with low expression of ER-alpha 36.

3. The kit of claim 1, wherein the tumor tissue is breast cancer tumor tissue obtained by surgery or puncture, and the paraffin-embedded breast cancer tumor tissue specimen is fixed by xylene.

4. The kit of claim 1, wherein said detecting the expression level of ER- α 36 in tumor tissue comprises the steps of: 1. preparing tumor tissue wax blocks and slices; 2. staining the sections by immunohistochemical methods; 3. reading the clinical result of the stained section expressing ER-alpha 36 by referring to the breast cancer tissue quality control sheet; the expression level of ER-alpha 36 in the tumor tissue of the subject is evaluated.

5. The kit of claim 1, wherein the clinical negative property control wafer and the clinical positive property control wafer are four quality control wafers as shown in fig. 2.