CN109576344A - A kind of construction method of the sequencing library of ultra-low volume FFPE sample DNA - Google Patents
A kind of construction method of the sequencing library of ultra-low volume FFPE sample DNA Download PDFInfo
- Publication number
- CN109576344A CN109576344A CN201710891248.5A CN201710891248A CN109576344A CN 109576344 A CN109576344 A CN 109576344A CN 201710891248 A CN201710891248 A CN 201710891248A CN 109576344 A CN109576344 A CN 109576344A
- Authority
- CN
- China
- Prior art keywords
- dna
- cell
- sequencing library
- ffpe
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Bioinformatics & Computational Biology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Immunology (AREA)
- Plant Pathology (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A kind of construction method of the sequencing library of ultra-low volume FFPE sample DNA, includes the following steps: to carry out whole quality inspection by way of PCR amplification house-keeping gene to FFPE tissue DNA；From the FFPE of quality inspection qualification tissue, destination organization or cell are isolated by detection wind lidar；Minim DNA is extracted from the destination organization or cell；Whole genome amplification is carried out to the minim DNA；Using the product of the whole genome amplification as starting DNA sample, the building of sequencing library is carried out.FFPE tissue DNA quality inspection step is introduced, subsequent whole genome amplification is greatly promoted and builds the successful probability in library, improves working efficiency；By detection wind lidar, pure destination organization or cell is obtained, ensures that experimental result undopes other samples；It realizes the building of FFPE DNA ultra-low volume two generations sequencing library, to analyze this sample.
Description
Technical field
The present invention relates to library construction techniques fields, and in particular to a kind of sequencing library of ultra-low volume FFPE sample DNA
Construction method.
Background technique
In recent years, malignant tumour has become the principal disease for seriously threatening human health.With other chronic disease (such as painstaking effort
Pipe disease) it compares, the problems such as prevention of cancer, control and treatment, faces huge challenge.
The preservation of tissue samples mostly uses fixed paraffin embedding (the formalin-fixed paraffin- of formalin
Embedded, FFPE) method, this method has been up to a century in the application of scientific research and clinical field.Enormous amount is returned
The FFPE sample of shelves plays a significant role in terms of retrospective study, Clinical mechanism research, instruction, is mankind's progress
The important precious deposits of correlative study.FFPE sample is mainly used for pathological observation and a few molecules level research at this stage.One
The research of aspect, FFPE sample is extremely challenging: firstly, the medical sample of paraffin embedding is very precious, each sample total has
It limits and irreplaceable；Secondly, degradation takes place after in vitro in tissue samples, the fixed function of formalin can make in tissue
Nucleic acid is broken, intermolecular to crosslink.Part processing can also accelerate DNA degradation during wax stone integral manufacturing.In addition
The FFPE wax stone preservation condition and time made also influence the quality of sample amplifying nucleic acid.To sum up, FFPE sample itself is special
Property make its research have certain challenge.On the other hand, the research of FFPE sample also pole necessity, although now with technology
Development, the technologies such as frozen tissue section are also widely used in clinic with direction of scientific rersearch, but are carried out in many be sliced using FFPE
Pathology identification is goldstandard with tissue morphology observation, can not be substituted.
Second generation sequencing technologies greatly improve sequencing speed, while sequencing cost significantly reduces.BGIseq-500 is Hua Da
The domestic sequenator of gene independent research has many characteristics, such as that at low cost, flux is high.With the development of high throughput sequencing technologies, more
Sequencing library building and high-flux sequence are directed to come the research of more life sciences.Sequencing library is to contain certain
The recombinant DNA clonal population of the random fragment of kind organism all or part genomic DNA is to carry out genome sequencing, structure
The basis of physical map, chromosome walking, genescreen and gene map based cloning is built, is provided by force for the research of genomics
Strong technology platform.The nucleic acid sequencing library construction of special sample such as FFPE sample has always acquiring a certain degree of difficulty.Market at present
On may be implemented convention amount (1 μ g) FFPE DNA sequencing library construction, but some FFPE DNA are extracted originally tired
Difficult, sample preciousness sample, or can only obtain the FFPE DNA of very low amount in many researchs and in applying or research object is
The DNA sample of very low amount, is much not achieved the FFPE DNA for building library initial amount, and the building for how completing sequencing library is always
The technical problem for needing to solve.
Detection wind lidar (LCM) is a kind of automatic sample preparation technology, is allowed under the microscope from mixing sample
In isolate specific cells.The technology can separate pure sample from heterogeneous mixture, thus in downstream minigenome
Using the more efficient and accurate result of acquisition in (such as sequencing of new-generation sequencing, Sanger, PCR and proteomics).From non-
Specific cells are separated and characterized in uniform cell group, it is particularly important for genetic mutation expression analysis, because normal group
Difference between difference cell type present in knitting can make a significant impact genetic mutation expression analysis.LCM makes it possible to
Answer is obtained from individual cells, and individual cells may include the non-homogeneous of healthy cell, interstitial cell and cancer cell
It is ignored in the entire tissue of mixture.LCM is a kind of accurate, contactless technology, and helping to reduce to pollute and can disclose makes
With answer that may be ignored when non-targeted sample, because of the uniformity of its lesser size or sample.
Tumor Heterogeneity is a big feature of tumour, refers to and passes through multiple division growth during growth of tumour cell,
Different tumour cells there may be it is different mutation and accumulate to get off to be transmitted to progeny cell, make different tumour cells cellular morphology,
It is variant on the morphology such as gene expression, metabolism, proliferation diffusion, metastatic potential and phenotype.These differences can make tumour
The speed of growth, invasive ability generate difference to various aspects such as sensibility, the prognosis of drug.Therefore for tumour cell heterogeneity
Research can further appreciate that origin and the development of cancer, to formulate more targetedly and effective therapeutic scheme.Mammary gland leaching
Lubricant nature micropapillary carcinoma (Invasive Micropapillary Carcinoma of the Breast, IMPC) is a kind of disease
Special Types of Breast Cancer is managed, pathological characters are with micro emulsion head-like structure, mulberries sample appearance, the cream with other no special types
Gland cancer is compared, it has many characteristics, such as high rate of lymph-node metastasis, high lymph vessels infringement rate, high relapse rate and low survival rate, is made
It is unclear always with mechanism.Simple wellability micropapillary carcinoma is considerably less, and most cases are mixed with infiltrating duct carcinoma.I.e.
Make to be pure wellability micropapillary carcinoma, also include a large amount of interstitial tissue in tumor tissues, if effective ways can be utilized
IMPC ingredient is separated from tumor tissues, it will it is studied and plays greatly facilitation, and general IMPC cell mass includes
About 15-50 cell, on the other hand its form only could identify it on FFPE slice, therefore carry out to it
Separation and subsequent analysis handle difficulty all with higher.
The prior art generally cuts 5-10 piece slice from entire paraffin embedded tissues, extracts all DNA.And one in tumor tissues
As tumour cell purity be 70-80%, extraction DNA includes interstitial cell, lymphatic infiltration cell etc. in this way.General dna total amount
1 μ g need to be greater than to carry out building library according to standard Library development flow after then being interrupted according to sample quality.
The prior art has the following disadvantages: that library construction starting investment amount of DNA is high, and generally 1 μ g DNA can not be to extremely low
Library is directly built in amount tissue progress, for lower than the sample for building library initial amount, building Kucheng's power be will be greatly reduced.Experiment materials are whole
A embedding wax block can usually be mixed with normal tissue, can be mixed with Various Tissues DNA in library.FFPE sample in the production process,
Since formaldehyde is fixed, paraffin embedding, DNA can have damage in various degree, DNA quality difference between FFPE sample difference sample
Greatly, just start to carry out quality inspection to sample in experiment without a kind of simple effective method, often to foundation product after pre-PCR
Concentration judgement sample quality pushes away sample quality according to sequencing data is counter, wastes time significantly, resource and manpower.
Summary of the invention
The present invention provides a kind of ultra-low volume for being able to ascend and building Kucheng's power, improving working efficiency and other samples that undope
The construction method of the sequencing library of FFPE sample DNA.
The present invention realizes by following technical solution:
A kind of construction method of the sequencing library of ultra-low volume FFPE sample DNA, includes the following steps:
To FFPE tissue DNA, whole quality inspection is carried out by way of PCR amplification house-keeping gene；
From the FFPE of quality inspection qualification tissue, destination organization or cell are isolated by detection wind lidar；
Minim DNA is extracted from above-mentioned destination organization or cell；
Whole genome amplification is carried out to above-mentioned minim DNA；
Using the product of above-mentioned whole genome amplification as starting DNA sample, the building of sequencing library is carried out.
Further, above-mentioned house-keeping gene is GAPDH；Above-mentioned PCR amplification is multiplexed PCR amplification, expands above-mentioned see respectively
Length is the segment of 100bp, 200bp, 300bp and 400bp in family's gene；Using can amplify 300bp and the above band as
The standard of quality inspection qualification.
Further, the primer of above-mentioned multiplexed PCR amplification is NO:1~8 SEQ ID.
Further, before isolating destination organization or cell by detection wind lidar, by slice, dewaxing,
Rehydration, dyeing and microscopy find above-mentioned destination organization or cell；Preferably, slice with a thickness of 20 μm.
Further, above-mentioned destination organization or cell are tumor tissues or cell, preferably breast invasive micropapillary carcinoma
Tissue or cell.
Further, minim DNA is extracted from above-mentioned destination organization or cell includes: using tissue digestion lysate and egg
The mixed liquor of white enzyme K digests above-mentioned destination organization or cell；Solution crosslinking is carried out to digestion product；The DNA obtained by magnetic beads for purifying；
And carry out DNA reparation.
Further, the criterion of acceptability of above-mentioned whole genome amplification are as follows: 1 μ g of product total amount or more, clip size range are
200-1000bp。
Further, the building of above-mentioned carry out sequencing library includes: to interrupt the product of above-mentioned whole genome amplification in flakes
Section；To interrupting, sample carries out end reparation and end adds A；Repair to end adds the product of A to carry out connector connection with end；It is right
Connector connection product carries out PCR amplification；Single-stranded cyclisation and digestions are carried out to pcr amplification product.
Further, the product of above-mentioned whole genome amplification is broken into the segment for being relatively concentrated in 200-400bp.
Further, above-mentioned sequencing library is sequenced suitable for BGISEQ-500 microarray dataset.
The construction method of sequencing library of the invention introduces FFPE tissue DNA quality inspection step, it is complete to greatly promote subsequent experimental
It genome amplification and builds the successful probability in library, improves working efficiency.By detection wind lidar, pure target group is obtained
It knits or cell, ensures that experimental result undopes other samples.Realize the two generations sequencing of FFPE DNA ultra-low volume (lower than 1ng)
Library construction to analyze this sample.
Detailed description of the invention
Fig. 1 show the PCR quality inspection of breast invasive micropapillary carcinoma FFPE tissue DNA in the embodiment of the present invention as a result,
Wherein M is 100bp DNA ladder, and P is experiment positive control, and N is experiment negative control, and 1-14 is experiment sample 1-14
Number.
Fig. 2 shows breast invasive micropapillary carcinoma FFPE in the embodiment of the present invention to organize the image before LCM, wherein arrow
Head instruction breast invasive micropapillary carcinoma cell.
Fig. 3 shows breast invasive micropapillary carcinoma FFPE in the embodiment of the present invention and organizes the image after LCM, wherein arrow
Head instruction breast invasive micropapillary carcinoma cell is cut to.
Fig. 4 shows breast invasive micropapillary carcinoma FFPE tissue DNA whole genome amplification in the embodiment of the present invention and produces
Object gel electrophoresis figure, wherein M is 100bp DNA ladder, and P is experiment positive control, and N is experiment negative control, and 1-11 is
Experiment sample 1-11.
The library construction that Fig. 5 shows whole genome amplification product in the embodiment of the present invention interrupts product electrophoretogram, wherein M
For DNA ladder, it is up to minimum and is followed successively by 450bp-50bp, 1-8 is experiment sample 1-8.
Specific embodiment
Embodiment of the present invention is described in detail below in conjunction with embodiment, but those skilled in the art will
Understand, following embodiment is merely to illustrate the present invention, and should not be taken as limiting the scope of the invention.Tool is not specified in embodiment
Concrete conditions in the establishment of a specific crime person carries out according to conventional conditions or manufacturer's recommended conditions.Reagents or instruments used without specified manufacturer,
Being can be with conventional products that are commercially available.
In some cases, the present invention it is relevant it is some operation there is no in the description show or describe, this be for
The core of the invention part is avoided to be flooded by excessive description, and to those skilled in the art, this is described in detail
A little relevant operations are not necessary, they can be complete according to the general technology knowledge of description and this field in specification
Whole understanding relevant operation.
Key instrument used is as shown in table 1 in following embodiment:
Table 1
| Instrument title | Company of source |
| Detection wind lidar instrument | ABI company Acturus XT model detection wind lidar instrument |
| DNA interrupts instrument | Covaris company EL220 |
| Two generation sequenators | 500 sequenator of BGI-SEQ |
1 breast invasive micropapillary carcinoma FFPE tissue DNA quality inspection of embodiment
FFPE sample often has very big difference due to manufacture craft and holding time condition and sample itself quality problems
It is different.Here the step of introducing a sample quality inspection, designs 4 pairs on house-keeping gene (House Keeping Gene) GAPDH
PCR primer (table 2) carries out multiplexed PCR amplification, and product length is respectively 100bp, 200bp, 300bp and 400bp, whole to sample
Body DNA mass is assessed.If DNA degradation itself is serious, DNA main sections range in 300bp hereinafter, if product in
There is no 300bp and the above bands, therefore have 300bp and the sample of the above band to be considered as qualification in PCR product.
2 quality inspection the primer sequence of table
| Primer | Primer sequence (5 ' → 3 ') |
| 100bp-F | GTTCCAATATGATTCCACCC (SEQ ID NO:1) |
| 100bp-R | CTCCTGGAAGATGGTGATGG (SEQ ID NO:2) |
| 200bp-F | AGGTGGAGCGAGGCTAGC (SEQ ID NO:3) |
| 200bp-R | TTTTGCGGTGGAAATGTCCT (SEQ ID NO:4) |
| 300bp-F | AGGTGAGACATTCTTGCTGG (SEQ ID NO:5) |
| 300bp-R | TCCACTAACCAGTCAGCGTC (SEQ ID NO:6) |
| 400bp-F | ACAGTCCATGCCATCACTGC (SEQ ID NO:7) |
| 400bp-R | GCTTGACAAAGTGGTCGTTG (SEQ ID NO:8) |
FFPE sample is cut into 20 μ m-thicks, glass slide is simple glass slide, and film-making routinely operates progress.It will be on slide
Tissue scraped down and be put in Eppendorf pipe for extracting with knife.First plus 1 milliliter of dimethylbenzene removes paraffin, and oscillation mixes
Maximum velocity centrifugation 3min afterwards removes supernatant；Add 1 milliliter of dehydrated alcohol washing to remove dimethylbenzene, oscillation maximum speed after mixing
Degree centrifugation 3min removes supernatant, the remaining ethyl alcohol of room temperature volatilization；Add 180 microlitres of lysis buffers and adds 20 microlitres of 20mg/mL eggs
White enzyme K digests 16 hours at 56 DEG C；In 90 DEG C of incubation 60min after digestion, formalin crosslinking is reversed；2.5 times of volumes
Ampure magnetic beads for purifying DNA.
Multiplex PCR: 12.5 μ l of Kappa hifi mix, 1 μ l of primer mixture is carried out according to following system to gained DNA,
DNA 50-100ng, nuclease-free water polishing to 25 μ l.Wherein, primer mixture includes product length point on 4 pairs of GADPH genes
The primer (table 2) of other 400bp, 300bp, 200bp, 100bp, every kind of primer concentration is 5 μM after mixing.
PCR reaction: 95 DEG C of 5min is carried out according to following procedure；95 DEG C of 15s, 55 DEG C of 15s, 72 DEG C of 30s, 40 circulations； 72
℃5min。
PCR product carries out 2% agarose gel electrophoresis, passes through PCR product band judgement sample DNA total quality.Sample is
No qualification determination standard: PCR product has 300bp and the above band is qualification, on the contrary then unqualified.
In the present embodiment, PCR electrophoretogram result such as Fig. 1, it can be seen that sample 1,4,9 in 300bp or more without band,
Quality inspection is unqualified, remaining 11 sample quality inspection is qualified.By such DNA quality inspection, sample that can be more serious by DNA degradation
It excludes, the successful probability of whole genome amplification below can be greatly promoted.
2 breast invasive micropapillary carcinoma FFPE of embodiment organizes LCM
1. film-making
FFPE slice conventionally carries out, and glass slide uses detection wind lidar (LCM) dedicated overlay film slide,
Slice thickness is 20 μm, and general tumour cell size is no more than 15 μm, therefore this slice thickness can carry out under the microscope
Pathologic structure observation, and intact cell core can be obtained after micro-dissections, it is conducive to followed by whole genome amplification.
2.FFPE dewaxing and rehydration
Dimethylbenzene 5min 2 times；
Dehydrated alcohol 5min 2 times；
95% ethyl alcohol 5min 1 time；
70% ethyl alcohol 5min 1 time；
50% ethyl alcohol 5min 1 time；
30% ethyl alcohol 5min 1 time；
Nuclease-free water 5min 2 times.
3. a pair slice dyes
Then, according to sampling requirement, 5min is dyed using 1% core fast red (Nuclear Fast Red).After completing dyeing,
Slice is carried out dehydrating, such as following steps:
30% ethyl alcohol 3min 1 time；
50% ethyl alcohol 3min 1 time；
70% ethyl alcohol 3min 1 time；
95% ethyl alcohol 3min 1 time；
Dehydrated alcohol 3min 2 times.
4. microscopy and detection wind lidar (LCM)
The slice for completing dyeing is placed in the objective table of detection wind lidar instrument.The slice is scanned under mirror, finds mesh
Tissue or cell are marked, is cut down, cutting front and back is photographed to record, and cutting position is specified.
In the present embodiment, such as Fig. 2 before histotomy cutting to be separated, such as Fig. 3, target microcomponent as shown in the figure after cutting
It is cut.
3 breast invasive micropapillary carcinoma FFPE tissue DNA whole genome amplification of embodiment
1. microcomponent digests
The microcomponent that will be cut down, addition tissue digestion lysate (such as QIAGEN company ATL) and Proteinase K mix
Liquid is closed, is placed in 56 DEG C, is digested 16 hours.After the completion of digestion, digestion product is placed in 90 DEG C and is incubated for 60 minutes, solution crosslinking.This step institute
It is extremely low to obtain DNA total amount, and due to FFPE tissue characteristics, DNA degradation is also more serious.Quan Ji is directly used in tissue digestion cracking
Because of reagent in group amplification kit, guarantee is subsequent not to be had to carry out DNA purifying, reduces the loss of DNA in experimentation to the greatest extent.
2.FFPE DNA is repaired
DNA reparation is carried out using the FFPE DNA repair enzyme of NEB company to DNA obtained by upper step, according to following system into
Row:
Mixing is placed on PCR instrument, 37 DEG C of reaction 30min.
3. minim DNA whole genome amplification
Whole genome amplification uses the WGA4 kit of Sigma company.
1) lysate configures
Proteinase K Solution 2 μ l, 10 × slender cellular lysate and fragmentation buffer (Single Cell Lysis&
Fragmentation Buffer) 32 μ l, it is uniformly mixed.
2) it cracks and interrupts
Positive sample and 9 μ l of negative sample, the 1 μ l of lysate of previous step are uniformly mixed, 99 DEG C of reaction 2min (interrupting),
Since there are DNA degradations for experiment sample itself, therefore without the processing of this step.
3) library tentatively expands (Library Preparation)
Positive sample and negative sample cooled on ice, then whole sample addition 1 × unicellular library prepares buffer
(Single-Cell Library Preparation Buffer) 2 μ l, library stabilize buffer (Library
Stabilization Solution)1μl.Mixing is placed in PCR instrument, 95 DEG C of reaction 2min.
Enzyme (Library Preparation Enzyme) 1 μ l, after mixing, 16 are prepared to cool to 4 DEG C addition libraries of sample
DEG C 20min, 24 DEG C of 20min, 37 DEG C of 20min, 75 DEG C of 5min.
4) it expands
48.5 μ l, 10 × Amplification Master of water, 7.5 μ l, WGA archaeal dna polymerase, 5 μ l is then added, mixes
It is even, 94 DEG C of 3min；30 circulations (94 DEG C of 30s, 65 DEG C of 5min).
PCR product is purified using magnetic bead, product after purification agarose gel electrophoresis quality inspection, and is detected with Qubit HS
Production concentration.Whole genome amplification criterion of acceptability are as follows: 1 μ g of product total amount or more, clip size range are 200-1000bp, electricity
Result of swimming is as shown in Figure 4.
It is detected through Qubit HS, product total amount is successively as shown in table 3:
Table 3
As can be seen that positive sample expands successfully, negative sample is not expanded, and all experimentss sample standard deviation expands successfully.
The building of 4 whole genome amplification product libraries of embodiment
1) sample interrupts: upper step gained whole genome amplification product DNA interrupts instrument LE220 using Covaris ultrasound
(Covaris, the U.S.) is interrupted.Since whole genome amplification product DNA segment ranges itself are 200bp-1000bp, according to just
The intensity that interrupts of ordinary person's genome carries out interrupting the position amount of DNA that will lead to 200-400bp reduction, if made again when interrupting
The DNA of required segment ranges is reduced, and initial amount can be made lower and be unfavorable for library construction.Therefore the present embodiment uses low-intensity
(Duty Cycle 21%, Intensity 500, Cycles per Burst 500) 5 ultrasounds interrupt FFPE DNA, every time
Interrupt time 20s.It can be observed to interrupt segment from Fig. 5 and be relatively concentrated in the position 200-400bp.Interrupt sample Ampure
Magnetic beads for purifying.After purification interrupt sample according to MGI EasyTMDNA library reagent preparation box specification continues library phase after carrying out
Close operation.
2) it interrupts sample end and repairs and add A with end: according to MGI EasyTMDNA library reagent preparation box specification into
Row.
3) connector connects: according to MGI EasyTMDNA library reagent preparation box specification carries out.
4) PCR amplification library: amplified library system is in strict accordance with MGI EasyTMDNA library reagent preparation box specification into
Row operation, wherein amplified library program operates according to the procedure below: 95 DEG C of 3min；98 DEG C of 20S, 60 DEG C of 15S, 72 DEG C of 30S, 11
A circulation；72℃10min；4 DEG C of holdings.The purifying in amplification library is carried out according to kit specification operation.
5) cyclisation and digestions: according to MGI EasyTMDNA library reagent preparation box specification carries out.
6) library quality inspection: according to MGI EasyTMDNA library reagent preparation box specification carries out, and satisfactory library can
Carry out machine on lower step library.
7) sequencing of whole genome amplification product libraries is analyzed with data
The library for meeting quality inspection requirement can carry out upper machine library processing according to the requirement of microarray dataset (such as BGISEQ-500)
And upper machine is analyzed with corresponding lower machine data information.
Use above specific case is illustrated the present invention, is merely used to help understand the present invention, not to limit
The system present invention.For those skilled in the art, according to the thought of the present invention, several letters can also be made
It is single to deduce, deform or replace.
SEQUENCE LISTING
<110>Shenzhen Hua Da life science institute
<120>a kind of construction method of the sequencing library of ultra-low volume FFPE sample DNA
<130> 17I24826
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
gttccaatat gattccaccc 20
<210> 2
<211> 20
<212> DNA
<213>artificial sequence
<400> 2
ctcctggaag atggtgatgg 20
<210> 3
<211> 18
<212> DNA
<213>artificial sequence
<400> 3
aggtggagcg aggctagc 18
<210> 4
<211> 20
<212> DNA
<213>artificial sequence
<400> 4
ttttgcggtg gaaatgtcct 20
<210> 5
<211> 20
<212> DNA
<213>artificial sequence
<400> 5
aggtgagaca ttcttgctgg 20
<210> 6
<211> 20
<212> DNA
<213>artificial sequence
<400> 6
tccactaacc agtcagcgtc 20
<210> 7
<211> 20
<212> DNA
<213>artificial sequence
<400> 7
acagtccatg ccatcactgc 20
<210> 8
<211> 20
<212> DNA
<213>artificial sequence
<400> 8
gcttgacaaa gtggtcgttg 20
Claims (10)
1. a kind of construction method of the sequencing library of ultra-low volume FFPE sample DNA, which comprises the steps of:
To FFPE tissue DNA, whole quality inspection is carried out by way of PCR amplification house-keeping gene；
From the FFPE of quality inspection qualification tissue, destination organization or cell are isolated by detection wind lidar；
Minim DNA is extracted from the destination organization or cell；
Whole genome amplification is carried out to the minim DNA；
Using the product of the whole genome amplification as starting DNA sample, the building of sequencing library is carried out.
2. the construction method of sequencing library according to claim 1, which is characterized in that the house-keeping gene is GAPDH；Institute
Stating PCR amplification is multiplexed PCR amplification, and expanding length in the house-keeping gene respectively is 100bp, 200bp, 300bp and 400bp
Segment；300bp and the above band can be amplified as the standard of quality inspection qualification.
3. the construction method of sequencing library according to claim 2, which is characterized in that the primer of the multiplexed PCR amplification
It is NO:1 ~ 8 SEQ ID.
4. the construction method of sequencing library according to claim 1, which is characterized in that pass through detection wind lidar point
Before separating out destination organization or cell, the destination organization or cell are found by slice, dewaxing, rehydration, dyeing and microscopy；
Preferably, slice with a thickness of 20 μm.
5. the construction method of sequencing library according to claim 1, which is characterized in that the destination organization or cell are swollen
Tumor tissue or cell, preferably breast invasive micropapillary carcinoma tissue or cell.
6. the construction method of sequencing library according to claim 1, which is characterized in that from the destination organization or cell
Extracting minim DNA includes: to digest the destination organization or cell using the mixed liquor of tissue digestion lysate and Proteinase K；It is right
Digestion product carries out solution crosslinking；The DNA obtained by magnetic beads for purifying；And carry out DNA reparation.
7. the construction method of sequencing library according to claim 1, which is characterized in that the qualification of the whole genome amplification
Standard are as follows: 1 μ g of product total amount or more, clip size range are 200-1000bp.
8. the construction method of sequencing library according to claim 1, which is characterized in that the building for carrying out sequencing library
It include: that the product of the whole genome amplification is broken into segment；To interrupting, sample carries out end reparation and end adds A；To end
End is repaired adds the product of A to carry out connector connection with end；Butt joint connection product carries out PCR amplification；Pcr amplification product is carried out
Single-stranded cyclisation and digestions.
9. the construction method of sequencing library according to claim 8, which is characterized in that the product of the whole genome amplification
It is broken into the segment for being relatively concentrated in 200-400bp.
10. the construction method of -9 described in any item sequencing libraries according to claim 1, which is characterized in that the sequencing library
It is sequenced suitable for BGISEQ-500 microarray dataset.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710891248.5A CN109576344A (en) | 2017-09-27 | 2017-09-27 | A kind of construction method of the sequencing library of ultra-low volume FFPE sample DNA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710891248.5A CN109576344A (en) | 2017-09-27 | 2017-09-27 | A kind of construction method of the sequencing library of ultra-low volume FFPE sample DNA |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109576344A true CN109576344A (en) | 2019-04-05 |
Family
ID=65912565
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710891248.5A Pending CN109576344A (en) | 2017-09-27 | 2017-09-27 | A kind of construction method of the sequencing library of ultra-low volume FFPE sample DNA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109576344A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110607563A (en) * | 2019-09-19 | 2019-12-24 | 北京市儿科研究所 | Sequencing library of filter paper sheet dry blood spots and construction method thereof |
| CN111041074A (en) * | 2019-12-31 | 2020-04-21 | 北京优迅医学检验实验室有限公司 | FFPE sample DNA quality evaluation method and library construction method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102485979A (en) * | 2010-12-02 | 2012-06-06 | 深圳华大基因科技有限公司 | Formalin-fixed paraffin-embedded (FFPE) sample nucleic acid library |
| CN105400776A (en) * | 2014-09-12 | 2016-03-16 | 深圳华大基因科技有限公司 | Oligonucleotide linker and applications of oligonucleotide linker in construction of nucleic acid sequencing single-chain cyclic library |
-
2017
- 2017-09-27 CN CN201710891248.5A patent/CN109576344A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102485979A (en) * | 2010-12-02 | 2012-06-06 | 深圳华大基因科技有限公司 | Formalin-fixed paraffin-embedded (FFPE) sample nucleic acid library |
| CN105400776A (en) * | 2014-09-12 | 2016-03-16 | 深圳华大基因科技有限公司 | Oligonucleotide linker and applications of oligonucleotide linker in construction of nucleic acid sequencing single-chain cyclic library |
Non-Patent Citations (4)
| Title |
|---|
| EH VAN BEERS等: "A multiplex PCR predictor for aCGH success of FFPE samples", 《BRITISH JOURNAL OF CANCER》 * |
| FENGFEI WANG等: "DNA degradation test predicts success in whole-genome amplification from diverse clinical samples", 《JOURNAL OF MOLECULAR DIAGNOSTICS》 * |
| PARISA AMINI等: "An optimised protocol for isolation of RNA from small sections of laser-capture microdissected FFPE tissue amenable for next-generation sequencing", 《BMC MOLECULAR BIOLOGY》 * |
| PEDRO MENDEZ等: "Systematic comparison of two whole-genome amplification methods for targeted next-generation sequencing using frozen and FFPE normal and cancer tissues", 《SCIENTIFIC REPORTS》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110607563A (en) * | 2019-09-19 | 2019-12-24 | 北京市儿科研究所 | Sequencing library of filter paper sheet dry blood spots and construction method thereof |
| CN111041074A (en) * | 2019-12-31 | 2020-04-21 | 北京优迅医学检验实验室有限公司 | FFPE sample DNA quality evaluation method and library construction method |
| CN111041074B (en) * | 2019-12-31 | 2022-04-22 | 北京优迅医学检验实验室有限公司 | FFPE sample DNA quality evaluation method and library construction method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Enderle et al. | Characterization of RNA from exosomes and other extracellular vesicles isolated by a novel spin column-based method | |
| CN103938277B (en) | Taking trace amount DNA as basis two generation sequencing library construction method | |
| Walter et al. | Comprehensive microRNA profiling of prostate cancer | |
| EP2895626B1 (en) | Accurate genome sequencing of single cells by single-stranded amplification and sequencing | |
| Hickman et al. | Analysis of the microglial sensome | |
| US20100304978A1 (en) | Methods and compositions for identifying a fetal cell | |
| US20160122753A1 (en) | High-throughput rna-seq | |
| CN109996892A (en) | The construction method of unicellular sequencing library and its application | |
| CN110191962A (en) | The sequencing and analysis of allochthon associated nucleic acid | |
| CN104131072B (en) | A kind of method and system unknown sample being carried out to individual recognition and paternity identification | |
| CN110168108A (en) | Rareness DNA's deconvoluting and detecting in blood plasma | |
| CN107201408A (en) | A kind of method that exploitation sisal hemp SSR primers are sequenced based on transcript profile | |
| Agarwal et al. | Sequencing of first-strand cDNA library reveals full-length transcriptomes | |
| CN104450923A (en) | Method for detecting embryonic chromosome abnormality by virtue of blastochyle free DNA | |
| Macedo et al. | Maximizing total RNA yield from TRIzol reagent protocol: a feasibility study | |
| CN104962643B (en) | Stablize reference gene, its screening technique and the application of expression in white backed planthopper different tissues position | |
| CN109576344A (en) | A kind of construction method of the sequencing library of ultra-low volume FFPE sample DNA | |
| Quek et al. | Processing of voided urine for prostate cancer RNA biomarker analysis | |
| CN105039569B (en) | A kind of breakpoint analysis method of mutual translocation chromosome | |
| WO2016004548A1 (en) | Method for pre-processing micro amounts of paraffin-embedded clinical biopsy tissue | |
| US20180252722A1 (en) | PCR-based Method for Counting Circulating Tumor Cells | |
| WO2014171800A1 (en) | Automatic system for early predicting and diagnosing prognosis of breast cancer | |
| Sampath et al. | Identifying translationally regulated genes during stem cell differentiation | |
| CN104846070B (en) | The biological markers of prostate cancer, therapy target and application thereof | |
| Cho-Vega et al. | Combined laser capture microdissection and serial analysis of gene expression from human tissue samples |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 518083 the comprehensive building of Beishan industrial zone and 11 2 buildings in Yantian District, Shenzhen, Guangdong. Applicant after: Shenzhen Huada Zhizao Technology Co.,Ltd. Address before: 518083 the comprehensive building of Beishan industrial zone and 11 2 buildings in Yantian District, Shenzhen, Guangdong. Applicant before: MGI TECH Co.,Ltd. |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190405 |