CN109554392A - A kind of construction method of ox mir-145 gene overexpression recombinant adenoviral vector - Google Patents
A kind of construction method of ox mir-145 gene overexpression recombinant adenoviral vector Download PDFInfo
- Publication number
- CN109554392A CN109554392A CN201811547738.4A CN201811547738A CN109554392A CN 109554392 A CN109554392 A CN 109554392A CN 201811547738 A CN201811547738 A CN 201811547738A CN 109554392 A CN109554392 A CN 109554392A
- Authority
- CN
- China
- Prior art keywords
- mir
- gene
- recombinant adenoviral
- bta
- adenoviral vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10041—Use of virus, viral particle or viral elements as a vector
- C12N2710/10043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Abstract
The invention discloses a kind of ox mir-145 gene overexpression recombinant adenoviral vector construction methods, to contain ox mir-145 gene order plasmid as template, design primer and clened cows mir-145 gene；After sequence verification in recombination to expression vector pSB50, conversion enters competent cell, obtains expression plasmid pSB50-bta-mir-145；It is packaged into recombinant adenoviral vector pAd-bta-mir-145 through AdMax adenovirus system, titre is 7.27 × 1010(PFU/ml)；Recombinant adenoviral vector is added to HEK293 cell, expanded, purified；With the recombinant adenoviral vector pAd-bta-mir-145 infected cattle Preadipocyte In Vitro of high concentration, real-time fluorescence quantitative PCR detects the expression quantity of ox mir-145.Its expression is 68 times higher than control group.
Description
Technical field
The invention belongs to recombinant adenoviral vector technical fields more particularly to a kind of ox mir-145 gene overexpression to recombinate
The construction method of adenovirus vector.
Background technique
Mir-145 and mir-143 in genome relatively close to position, mir-143/145 cluster is collectively formed.This
Imply that they may play associated function in biological process.Mir-143 is first being found with regulation
The miRNA of Adipose Differentiation.2012, some researches show that mir-145 can be by inhibiting 1 (insulin of insulin receptor matrix
Receptor substrate 1, IRS1) expression so that inhibit preadipocyte differentiation.MiRNAs expression modal data is shown
The expression of mir-145 is in down regulation trend during Adipose Differentiation.To sum up, mir-145 is considered as a potential fat
Break up regulation person.In order to study the function of mir-145 gene, the means for being overexpressed the gene are very important.Adenovirus table
Stable virion can be generated up to carrier system, useful load is big, and it is highly-safe, it is easier compared to non-viral expression vector
Transfected primary cell.
Summary of the invention
In view of the advantage of mir-145 potential Research Prospects and adenovirus expression carrier, the object of the present invention is to provide
A kind of construction method of ox mir-145 gene overexpression recombinant adenoviral vector.
In order to realize that above-mentioned task, the present invention take following technical solution to be achieved:
A kind of ox mir-145 is overexpressed the construction method of recombinant adenoviral vector, which comprises the following steps:
Step 1, to contain the plasmid as template of ox mir-145 gene order (miRBase:MI000475), design primer
And clened cows mir-145 gene；
Step 2, the ox mir-145 gene that clone is obtained after sequence verification in recombination to expression vector pSB50, turn
Change and enter competent cell, obtains expression plasmid pSB50-bta-mir-145；
Step 3, expression plasmid pSB50-bta-mir-145 are packaged into recombinant adenoviral vector through AdMax adenovirus system
pAd-bta-mir-145；
Recombinant adenoviral vector pAd-bta-mir-145 is added to HEK293 cell, is expanded, purified by step 4；
Step 5, with the recombinant adenoviral vector pAd-bta-mir-145 infected cattle Preadipocyte In Vitro of high concentration, in real time
The expression quantity of fluorescence quantitative PCR detection ox mir-145.
According to the present invention, the primer sequence are as follows:
Primer 1 (F):
GCATGGACGAGCTGTACAAGTGATCCATGGCAACTGAAGCG；
Primer 2 (R):
TCCAGAGGTTGATTATCGATTGGTTCAACCACTGCTCAAC；
PCR product size is 634bp.
Further, the PCR is with the plasmid as template containing ox mir-145 gene order, with PrimeSTAR high-fidelity
Archaeal dna polymerase expands ox mir-145 gene, and PCR reflects system are as follows:
Template: 1 μ l, primers F/R: 0.5 10 μ l of μ l, 5 × Buffer (with Mg2+) of each 1 μ l, PrimeSTAR enzyme,
DNTP:4 μ l, H2O:32.5 μ l；
PCR reaction condition are as follows: 98 DEG C of initial denaturation 3min；98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 1min, altogether
30 circulations；10min is reacted in 72 DEG C of terminations.
Further, the ox mir-145 gene order are as follows: miRBase:MI000475.
The advantages of ox mir-145 of the invention is overexpressed the construction method of recombinant adenoviral vector, brings and good effect
It is:
It is mir-145 during ox preadipocyte differentiation by constructing the recombined adhenovirus of ox mir-145 gene
Functional study prepare.
Through sequence verification, the ox mir-145 gene for cloning acquisition is consistent with the gene order that database miRbase is included,
Ox mir-145 gene is recombinated with expression vector pSB50 and is packed with AdMax adenovirus packaging system, recombination gland is obtained
Viral pAd-bta-mir-145, titre are 7.27 × 1010(PFU/ml).Recombined adhenovirus pAd-bta-mir-145 infects ox
After Preadipocyte In Vitro, the expression of ox mir-145 is 68 times higher than control group.So as to sustainedly and stably express the base
Cause.To study after the gene is overexpressed in ox Preadipocyte In Vitro, the influence to cell differentiation provides experiment basis.
By constructing ox mir-145 gene overexpression recombinant adenoviral vector, to detect mir-145 gene body fat before ox
Experiment basis is established in effect in fat cell differentiation procedure.
Detailed description of the invention
Fig. 1 is PCR amplification target gene fragment；
Fig. 2 is tool carrier map；
Fig. 3 is multiple cloning sites restriction enzyme mapping；
Fig. 4 is whole Vector map；
Fig. 5 is bacterium colony PCR qualification figure (4 transformants of picking)；
Fig. 6 is detection knot of taking pictures after ox mir-145 gene overexpression recombined adhenovirus (pAd-bta-mir-145) is packed
Fruit；Wherein three figures in left side are white light group, and it is fluorescence group that figure is opened on right side three；
Fig. 7 is ox mir-145 recombined adhenovirus (pAd-bta-mir-145) titre results picture (100 ×), from top to bottom
It is followed successively by dilution 10-5, dilution 10-6, dilution 10-7, dilution 10-8。
Below in conjunction with drawings and examples, the present invention will be described in further detail.
Specific embodiment
In order to make the purpose of the present invention, technical solution and advantage are more clearly understood, it should be understood that embodiment below is only
Only to explain the present invention, it is not intended to limit the present invention.
The present embodiment provides a kind of ox mir-145 gene overexpression recombinant adenoviral vector construction method, including following step
It is rapid:
Step 1, with the plasmid as template containing ox mir-145 gene order, design primer, and clened cows mir-145 base
Cause；
Step 2, the ox mir-145 gene that clone is obtained after sequence verification in recombination to expression vector pSB50, turn
Change and enter competent cell, obtains expression plasmid pSB50-bta-mir-145；
Step 3, expression plasmid pSB50-bta-mir-145 are packaged into recombinant adenoviral vector through AdMax adenovirus system
pAd-bta-mir-145；
Recombinant adenoviral vector pAd-bta-mir-145 is added to HEK293 cell, is expanded, purified by step 4；
Step 5, with the recombinant adenoviral vector pAd-bta-mir-145 infected cattle Preadipocyte In Vitro of high concentration, in real time
The expression quantity of fluorescence quantitative PCR detection ox mir-145.
The primer sequence are as follows:
Primer 1 (F):
GCATGGACGAGCTGTACAAGTGATCCATGGCAACTGAAGCG；
Primer 2 (R):
TCCAGAGGTTGATTATCGATTGGTTCAACCACTGCTCAAC；
PCR product size is 634bp.
The PCR is to be gathered using the plasmid containing ox mir-145 genetic fragment as template with PrimeSTAR high-fidelity DNA
Synthase expands ox mir-145 gene, and PCR reflects system are as follows:
Template: 1 μ l, primers F/R: each 1 μ l, PrimeSTAR enzyme: 0.5 μ l, 5 × Buffer (withMg2+): 10 μ l,
DNTP:4 μ l, H2O:32.5 μ l；
PCR reaction condition are as follows: 98 DEG C of initial denaturation 3min；98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 1min, altogether
30 circulations；10min is reacted in 72 DEG C of terminations.
The ox mir-145 gene order are as follows: miRBase:MI000475.
It is specific embodiment below.
1, the building of ox mir-145 gene overexpression recombinant adenoviral vector
1.1 Ns of mir-145 gene magnifications:
According to the inquiry of database mirbase, ox mir-145 gene order are as follows: miRBase:MI000475 (http:// Www.mirbase.org/cgi-bin/mirna_entry.pl? acc=MI0004756), to contain ox mir-145 gene sequence
The plasmid as template of column, and design primer clened cows mir-145 gene, as shown in appendix 1, gene chemical synthesis is by upper for the primer of design
Hai Shenggong Biotechnology Co., Ltd completes.
Subordinate list 1
PCR amplification target fragment is shown in Fig. 1.Through sequence verification, the ox mir-145 gene and database of acquisition are cloned
The gene order that miRbase is included is consistent.
1.2 homologous recombinations:
Digestion is carried out to expression vector (PSB50) (see Fig. 2) with ClaI and BamHI-HF, recycles 4661bp carrier segments
(see Fig. 3).
The expression vector of ox mir-145 genetic fragment and linearisation that amplification obtains is added in test tube with molar ratio 2:1
Recombining reaction is carried out, obtains recombinant vector (see Fig. 4), is named as pSB50-bta-mir145.30 points are incubated at 42 DEG C after mixing
Clock is then transferred on ice.10 μ l reaction liquids are taken to be transformed into competent cell after placing 2-3 minutes.
It takes competent cell (every 100 μ l of pipe, -80 DEG C of preservations) on ice, 10 μ l connection liquid is added after to be dissolved, gently
Light rotation is placed 30 minutes in ice with mixing content.Pipe is put into pre-heating heat shock 90 into 42 DEG C of thermostat water bath
Second.Quickly pipe is transferred in ice bath, keeps cell 2-3 minutes cooling.Every pipe adds the LB culture solution (commercially available) of 900 μ l, then will
Pipe is transferred on 37 DEG C of shaking tables, and incubating 1 hour makes bacteria resuscitation.The transformed bacteria solution of appropriate amount is taken to be coated on LB agar plate
(the corresponding antibiotic containing expression vector).It is inverted plate, 37 DEG C of cultures in constant incubator, 16 hours.
1.3 positive clone identifications and extracting:
The transformant grown on picking plate is resuspended in the LB culture solution of 10 μ l, is therefrom taken 1 μ l to do template and is carried out bacterium colony
PCR identifies (Fig. 5).Inoculation positive colony, conservation and 100 μ l of packing send sequencing.There is no problem for sequencing, inoculates extracting matter
Grain.Positive colony sequencing interpretation of result: positive colony sequencing is the result shows that consistent with expected objective gene sequence.
2, the packaging of ox mir-145 gene overexpression recombinant adenoviral vector
2.1 packaging process:
Density when in cell inoculation 10cm cell culture vessel, controlling cell transfecting is 70- by the day before transfection
90%.Previous hour taking-up cell culture vessel is transfected, removes original cell culture medium, the Opti-MEMI that 10ml is added subtracts blood
Clear culture medium (commercially available), sends cell back to incubator.
The compound for preparing transfection reagent and plasmid takes the Ep Guan Yizhi of 1.5ml, and viral vectors matter to be transfected is added
Grain, with Opti-MEMI culture medium polishing to 500 μ l, mixes gently；The Ep Guan Yizhi of 1.5ml is taken, Trans-EZ solution is added,
With Opti-MEMI culture medium polishing to 500 μ l, mix gently；Trans-EZ dilution is added drop-wise in plasmid dilution, Bian Jia
While being placed at room temperature for 20 minutes after mixing gently, combines DNA and Trans-EZ sufficiently and form stable transfecting complexes.It takes out
DNA-Trans-EZ complex obtained above is added in cell culture vessel, marks, puts back to training by tissue culture plate
Support case.Culture medium is sucked after 6h, PBS is washed once, the culture of 10mL fresh growth medium is added, if any a large amount of cell levitatings, then
Supernatant is not removed, is added 6mL complete medium (commercially available), 37 DEG C are incubated overnight, and next day changes liquid.It changes within three days once, general 7-15 days
There is virus plaque in left and right, purifies after waiting lesion.It is observed when the 11st day after recombined adhenovirus transfection, 293 cell of HEK is a large amount of
It descends slowly and lightly, cell complete lesion (see Fig. 6).
The harvest of 2.2 Ns of mir-145 gene overexpression recombinant adenoviral vectors:
There is typical lesion to most cells, and there is 50% cell to take off wall, collect cell, -70 DEG C anti-with 37 DEG C
It multiple freeze thawing 3 times, collects viral supernatants and is saved in -70 DEG C.
A small amount of amplifications of 2.3 Ns of mir-145 gene overexpression recombination gland carriers:
When the HEK293 cell of culture converges up to 80~90%, culture solution is abandoned, keeps a little covering cell surface；With shifting
10cm is added in the above-mentioned virus liquid of 10 μ l by liquid rifle2Disk in, mix, be put into 37 DEG C, the CO of concentration 5%2In incubator；After 2h
10mL culture solution is added, incubator culture is put into；HEK293 to be cultivated is rounded after 4~5 days, de- wall, some cells floats, and
And its color from it is orange become yellow when show cell lesion, can be collected with liquid-transfering gun, -70 DEG C save backup.
The massive amplification and gradient centrifugation purification of 2.4 Ns of mir-145 gene overexpression recombinant adenoviral vectors:
Using enriching virus in the classical caesium chloride density gradient centrifugation method and 30 × 150mm culture dish of Hitt et al. (1998)
Method.Prepare cell, for 30 × 150mm culture dish: when all infected cell roundings and fraction floats, shaving training
Ware is supported, then cell and supernatant are transferred in 50ml centrifuge tube, 750g, is centrifuged 10 minutes.With the Tris-HCl of the 0.1M of 15ml
(pH 8.0) is resuspended.- 80 degree save.The deoxycholic acid of the concentration 5% of 1.5ml is added in sample dissolution, every 15ml cell dissolution object
Sodium mixes incubation at room temperature 30 minutes.This is the result is that relatively clear, highly viscous suspension.The cell dissolution object of every 15ml
150 μ l magnesium chlorides and I solution of DNase of 75 μ l are added, mix, 37 degree incubations 30-60 minutes, every 10 minutes mixing once.
Viscosity should reduce, only slightly more sticky than water.Using high speed tabletop centrifuge, 4 DEG C, high speed centrifugation 15 minutes.Together
When, prepare cesium chloride gradient (with the ultrapure pipe of SW41 rotor, sample) for 5ml: in each pipe plus 0.5ml
The cesium chloride solution of 1.5g/cc, the cesium chloride solution of the 1.35g/cc that 3ml is spread above gently, gently be then covered with one
The cesium chloride solution of the 1.25g/cc of layer 3ml.Gradient cannot be upset after adding well.The pipe of each gradient is added in step 4
Obtained supernatant 5ml.With SW41 rotor, 4 DEG C, 35000rpm centrifugation, (accelerate and slow down setting 1) collects virus band within 1 hour
(should be between 1.25g/cc and 1.35g/cc).
Obtained ox mir-145 gene overexpression recombined adhenovirus band is transferred to the matched sterile tube of SW50.1 rotor
In son, pipe is filled it up with 1.35g/cc solution), it mixes.With SW50.1 rotor, 4 DEG C, 35000rpm, it is centrifuged 16-20 hours.With
Volume collection ox mir-145 gene overexpression recombined adhenovirus (usually 0.5-1ml) as small as possible, is transferred in bag filter, 4
DEG C, the 10Mm Tris-HCl, PH 8.0 of 500 times of volumes (or bigger) dialyses, at least 24 hours, between replace 2 to 3 times it is molten
Liquid.After dialysis, the ox mir-145 gene overexpression recombined adhenovirus of purifying dispenses -80 DEG C of aliquot preservations.
2.5 detection ox mir-145 gene overexpression recombined adhenovirus titres:
Detection use Titer-EZ adenovirus titre detection kit (Microbix company), to specifications the step of into
Row.
HEK293 cell in good condition is chosen, cell is resuspended using complete medium, is prepared into 5.0 × 105/ml's
Cell suspension is planted in each hole of 24 orifice plates into 1ml cell, 37 DEG C, the CO2 culture of concentration 5%.Get out 10 times of gradient dilutions
Ox mir-145 gene overexpression recombined adhenovirus sample, then successively by 10-5To 10-8Diluted ox mir-145 gene crosses table
It is added in 24 orifice plates up to recombinant adenovirus venom, 100 μ l are added in every hole, and each dilution occupies a hole.37 DEG C, concentration 5%
CO2 infects 48 hours.Removal culture solution gently is slowly added into the methanol 0.5ml of pre-cooling along 24 orifice plate side walls, and -20 DEG C solid
Determine 20min (pipette tips not touch cell).Using the flushing cell of PBS gently 3 times, each 5min (is never rushed cell
It rises).37 DEG C of 0.2ml (BSA of concentration 1%) closing 1 hour is added.The primary antibody solution of 0.2ml is added into each hole, 37 DEG C incubate
It educates 1 hour.Using the flushing cell of PBS gently 3 times, each 5min.Then the secondary antibody of 0.2ml is added to every hole, 37 DEG C are incubated for 1
Hour.Using the flushing cell of PBS gently 3 times, each 5min.0.2ml working solution is added to every hole, is incubated at room temperature 5-10min
(incubation time does not exceed 10min).Working solution is abandoned, is cleaned 2 times using PBS, 1mlPBS is added in every hole.Every hole random selection 5
A visual field calculates positive cell number using under 10 × object lens of optical microscopy (see Fig. 7).Calculate being averaged for every hole positive cell
Number and ox mir-145 gene overexpression recombined adhenovirus titre.
2.6 results calculate:
Calculate the mean number of positive cell in microscope downward view.A gradient is selected, has 5-50 in this gradient visual field
A positive cell randomly chooses at least five area count.Calculate the number in every hole visual field in 24 orifice plates.
Calculate titre bibliography: Bewig, B., and W.E.Schmidt (2000) Accelerated titering
Of adenoviruses.BioTechniques 28:870-873.
Recombinant adenoviral vector pAd-bta-mir-145 titre results are as follows:
The positive cell average calculated in 5 visuals field under the microscope is 9.2, this hole ox mir-145 gene overexpression
Recombined adhenovirus dilutes 107Times, ox mir-145 gene overexpression recombined adhenovirus titre is 7.27 × 1010(PFU/ml)。
The present embodiment building AdMax adenovirus expression carrier, can in the functional study of gene wide Fan Yingyong, into
Its mechanism of action during Niu Yuandai preadipocyte differentiation of one step is of great significance.
Nucleotides sequence list
<110>Xibei Univ. of Agricultural & Forest Science & Technology
<120>a kind of construction method of ox mir-145 gene overexpression recombinant adenoviral vector
<160>
<210>1
<211>40
<212>primer Primer 1(F) sequence
<213>DNA
<220>
<400>
GCATGGACGAGCTGTACAAGTTGAGTTGCTGGATGTCGCC
<210>2
<211>39
<212>primer Primer 2(R) sequence
<213>DNA
<220>
<400>
TCCAGAGGTTGATTATCGATAGCCTCACAGGATGTTGCG
<210>3
<211>22
<212>primer Primer 3(F) sequence
<213>DNA
<220>
<400>
CATGGTCCTGCTGGAGTTCGTG
<210>3
<211>20
<212>primer Primer 4(R) sequence
<213>DNA
<220>
<400>
GAAATTTGTGATGCTATTGC
Claims (4)
1. a kind of ox mir-145 gene overexpression recombinant adenoviral vector construction method, which comprises the following steps:
Step 1, with the plasmid as template containing ox mir-145 gene order, design primer, and clened cows mir-145 gene；
Step 2, the ox mir-145 gene that clone is obtained are transformed into after sequence verification in recombination to expression vector pSB50
Enter competent cell, obtains shuttle plasmid pSB50-bta-mir-145；
Step 3, expression plasmid pSB50-bta-mir-145 are packaged into recombinant adenoviral vector pAd- through AdMax adenovirus system
bta-mir-145；
Recombinant adenoviral vector pAd-bta-mir-145 is added to HEK293 cell, is expanded, purified by step 4；
Step 5, with the recombinant adenoviral vector pAd-bta-mir-145 infected cattle Preadipocyte In Vitro of high concentration, real-time fluorescence
The expression quantity of quantitative PCR detection ox mir-145.
2. the method as described in claim 1, which is characterized in that the primer sequence are as follows:
Primer 1 (F):
GCATGGACGAGCTGTACAAGTGATCCATGGCAACTGAAGCG；
Primer 2 (R):
TCCAGAGGTTGATTATCGATTGGTTCAACCACTGCTCAAC；
PCR product size is 634bp.
3. the method as described in claim 1, which is characterized in that the PCR is with the matter containing ox mir-145 genetic fragment
Grain is template, expands ox mir-145 gene with PrimeSTAR high-fidelity DNA polymerase, PCR reflects system are as follows:
Template: 1 μ l, primers F/R: each 1 μ l, PrimeSTAR enzyme: 0.5 μ l, 5 × Buffer (with Mg2+): 10 μ l, dNTP:4
μ l, H2O:32.5 μ l；
PCR reaction condition are as follows: 98 DEG C of initial denaturation 3min；98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 1min, totally 30
Circulation；10min is reacted in 72 DEG C of terminations.
4. method as described in claim 1, which is characterized in that the ox mir-145 gene order are as follows: miRBase:
MI000475。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811547738.4A CN109554392A (en) | 2018-12-18 | 2018-12-18 | A kind of construction method of ox mir-145 gene overexpression recombinant adenoviral vector |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811547738.4A CN109554392A (en) | 2018-12-18 | 2018-12-18 | A kind of construction method of ox mir-145 gene overexpression recombinant adenoviral vector |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109554392A true CN109554392A (en) | 2019-04-02 |
Family
ID=65870321
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811547738.4A Pending CN109554392A (en) | 2018-12-18 | 2018-12-18 | A kind of construction method of ox mir-145 gene overexpression recombinant adenoviral vector |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109554392A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130149288A1 (en) * | 2010-08-16 | 2013-06-13 | Brainstem Biotec Ltd. | Methods of generating oligodendrocytes and cell populations comprising same |
| CN103505743A (en) * | 2012-06-21 | 2014-01-15 | 北京命码生科科技有限公司 | Cell micro-particles containing functional microRNA/siRNA and application thereof |
| CN107236750A (en) * | 2017-05-05 | 2017-10-10 | 西北农林科技大学 | Ox PDHB gene overexpressions recombinant adenoviral vector is built and packing method |
| US20200071699A1 (en) * | 2018-08-31 | 2020-03-05 | Ghassan S. Kassab | Treatment of alzheimers disease with micro rna and ghrelin |
-
2018
- 2018-12-18 CN CN201811547738.4A patent/CN109554392A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130149288A1 (en) * | 2010-08-16 | 2013-06-13 | Brainstem Biotec Ltd. | Methods of generating oligodendrocytes and cell populations comprising same |
| CN103505743A (en) * | 2012-06-21 | 2014-01-15 | 北京命码生科科技有限公司 | Cell micro-particles containing functional microRNA/siRNA and application thereof |
| CN107236750A (en) * | 2017-05-05 | 2017-10-10 | 西北农林科技大学 | Ox PDHB gene overexpressions recombinant adenoviral vector is built and packing method |
| US20200071699A1 (en) * | 2018-08-31 | 2020-03-05 | Ghassan S. Kassab | Treatment of alzheimers disease with micro rna and ghrelin |
Non-Patent Citations (2)
| Title |
|---|
| YUNXUE GUO ET AL.: "Up-regulated miR-145 Expression Inhibits Porcine Preadipocytes Differentiation by Targeting IRS1", 《INT. J. BIOL. SCI.》 * |
| 林秀贤 等: "miR-145与肿瘤相关研究及其临床应用", 《中国生物化学与分子生物学报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Orias et al. | Tetrahymena as a laboratory organism: useful strains, cell culture, and cell line maintenance | |
| CN105492609A (en) | Method for CRISPR-Cas9 specific knockout of pig GGTA1 gene and sgRNA for specific targeted GGTA1 gene | |
| CN105518140A (en) | Method for pig vWF gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting vWF gene | |
| CN109576284A (en) | One multi-functional myb transcription factor gene and application thereof | |
| CN102304491A (en) | Method for establishing and identifying cynoglossus semilaevis testis cell line | |
| CN105200085A (en) | Production method for recombinant human fibroblast growth factor-18 and application of growth factor-18 | |
| CN110016478A (en) | A kind of close Luo Mu gene M fWRKY7 and its application | |
| CN107604088B (en) | Method for creating and identifying chromosome translocation line between peanut A and peanut B gene groups | |
| CN105886509B (en) | The application of long-chain non-coding RNA ENST00000429456 | |
| CN103937748B (en) | The unicellular from the strain of suspension growth mdck cell and its construction method and application of expression people's TMPRSS2 albumen can be stablized | |
| CN104928250B (en) | Immortalize cow mammary gland epithelial cells system and its construction method and application | |
| CN109392702A (en) | A kind of method of the normal wild rice stem of artificially breeding | |
| CN109750058A (en) | A kind of research method of Candida albicans | |
| CN104178451B (en) | From milk, separate and cultivate method and the special culture media of cow mammary gland epithelial cells | |
| CN109554392A (en) | A kind of construction method of ox mir-145 gene overexpression recombinant adenoviral vector | |
| CN102827875B (en) | Recombinant adenovirus for expressing mouse nerve growth factors and preparation method thereof | |
| Elliott | Nonperfused attachment systems for cell cultivation | |
| CN107217071A (en) | A kind of adenovirus of recombinant rat phospholipase C γ 2, construction method and its application | |
| CN106497974A (en) | Rhabdovirus expression vector and its structure and the application of titre can quickly be determined | |
| CN110747199A (en) | Bee stress-resistance related gene NF-Y and application thereof | |
| CN106754753B (en) | Virus culture method | |
| CN109370922A (en) | A pair of wild rice smut for successfully realizing the normal hay artificially breeding of wild rice stem and its application | |
| CN105233303B (en) | A kind of method and its application by genetic modification vascular endothelial cell wound healing | |
| CN103215309B (en) | The method of express polypeptide | |
| CN108103101A (en) | Tbc1d14 gene overexpressions adenovirus, carrier and structure and packing method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190402 |
|
| RJ01 | Rejection of invention patent application after publication |