CN109536628B - Specific molecular marker and detection kit for helicobacter pylori - Google Patents
Specific molecular marker and detection kit for helicobacter pylori Download PDFInfo
- Publication number
- CN109536628B CN109536628B CN201910054596.6A CN201910054596A CN109536628B CN 109536628 B CN109536628 B CN 109536628B CN 201910054596 A CN201910054596 A CN 201910054596A CN 109536628 B CN109536628 B CN 109536628B
- Authority
- CN
- China
- Prior art keywords
- helicobacter pylori
- detection
- kit
- molecular marker
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
Abstract
The invention relates to a specific molecular marker for helicobacter pylori and a detection kit thereof, which carry out specific detection on the helicobacter pylori in samples such as gastric mucosa, gastric juice, excrement, throat swab and the like according to the detection principle of a PCR-reverse dot hybridization method. The target gene of the specific molecular marker for helicobacter pylori in stomach is urease ureH gene. The kit greatly improves the sensitivity of clinical detection of the gastric helicobacter pylori, and can carry out non-invasive screening on helicobacter pylori infected persons, particularly old people and children, so that early discovery and early treatment can be realized; in addition, other helicobacter pylori genes such as: cag, vec and other drug resistance genes, which can be used as a positive reference to monitor all processes of genome extraction, PCR and hybridization of other genes.
Description
Technical Field
The invention belongs to the field of biological detection, particularly relates to a specific molecular marker and a detection kit for helicobacter pylori, and particularly relates to a kit for detecting the helicobacter pylori by using a PCR-reverse dot hybridization method.
Background
China is a serious disaster area infected by helicobacter pylori (Hp), the infection rate is up to 40% -60%, and the eating habits and sanitary environments of catering and a few underdeveloped areas are poor, so that the infection rate of children is up to 30% -40%. Most adult Hp infections are acquired in childhood, mostly in early childhood, and are generally difficult to spontaneously clear after infection, resulting in life-long infections. Therefore, screening and therapeutic research on Hp are very important for reducing the infection rate of Hp and improving the radical cure rate of Hp.
Currently, there are several approaches to the Hp screening: 1. c13 breath test is carried out by orally taking C-13 urea capsule, and hydrolyzing urea with urease if helicobacter pylori exists in stomach, and hydrolyzing urea to form CO2(carbon dioxide) enters the lungs with the blood and is expelled as gas, and the patient is then tested for the presence of unlabelled C-13, if any, in the exhaled air, which is indicative of the presence of H.pylori, in a relatively simple and rapid mannerThe method is the method used by most of the current Hp diagnosis and screening methods, and the method needs to be used carefully for screening children, and children are not willing to take the method. 2. RUT and immunohistochemical staining, both of which require taking the gastric mucosa under a gastroscope and performing staining analysis on the sample, cause great pain to patients, especially to the elderly and children. 3. The detection of Hp antibody, the method for identifying Hp antibody by using immunological method, has very low sensitivity.
Aiming at the defects of the detection technology of the gastric helicobacter pylori in the prior art, the molecular marker and the detection kit thereof capable of specifically detecting the gastric helicobacter pylori are needed to be provided, so that the gastric helicobacter pylori can be specifically detected.
Disclosure of Invention
The invention aims to provide a specific molecular marker and a detection kit for helicobacter pylori in stomach, and realizes specific detection of the helicobacter pylori according to a PCR-reverse dot hybridization method principle, so that the problems that invasive detection of the helicobacter pylori exists in the prior art, the detection is not suitable for children and old people, the sensitivity is not enough and the like are solved.
Further, the invention aims to provide a specific molecular marker for helicobacter pylori in stomach, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID NO: 1, which is a nucleotide fragment of urease ureH.
Further, it is an object of the present invention to provide a primer set for detecting the molecular marker of claim 1, which can be composed of a primer having a nucleotide sequence as set forth in SEQ ID NO: 2 and the nucleotide sequence of the primer HP-FB is shown as SEQ ID NO: 3, and the primer HP-R shown in the specification.
Further, the object of the present invention is to provide a nucleic acid probe specifically detecting the specific molecular marker of helicobacter pylori, the nucleotide sequence of the nucleic acid probe is shown as SEQ ID NO: 4, respectively.
Further, the invention aims to provide a detection kit for detecting the helicobacter pylori by utilizing a PCR-reverse dot hybridization method, and the kit consists of a kit I and a kit II.
The kit I comprises PCR reaction liquid, HRP components, positive quality control products and negative quality control products, wherein the PCR reaction liquid comprises Taq enzyme, 1 × Taq Buffer, dNTP (dATP, dCTP, dGTP and dTTP) and amplification primers, the HRP components comprise HRP, phosphate Buffer (pH7.5) and glycerol, and the positive quality control products comprise plasmids (10 of the same) containing RNase P and Ure H gene fragments5Copy/. mu.L) in 10mM Tris, 1mM EDTA, pH 8.0; the negative quality control product comprises a plasmid (10) only containing the RNase P gene fragment5Copy/. mu.L) in 10mM Tris, 1mM EDTA, pH 8.0.
The amplification primers are HP-FB, HP-R, PC-FB and PC-R, wherein the PC-FB and the PC-R are used for amplifying a human RNase P gene fragment, and the nucleotide sequences of the primers are respectively shown as SEQ ID NO: 2-3, 5-6, wherein in SEQ ID NO: 2 and the HP-FB and SEQ ID NO: 5' ends of the primers shown in the PC-FB are all marked with biotin.
The kit II comprises a membrane strip and a TMB component, wherein the membrane strip is a nylon membrane for fixing human ribonuclease P (HP), gastric helicobacter pylori ureH and gastric helicobacter pylori 16s rRNA detection probes; the TMB component is 3, 3 ', 5, 5' -tetramethyl benzidine (TMB) and phosphate buffer (pH7.5).
The detection probes of the HP, the ureH and the 16s rRNA are respectively PC TZ, HP TZ and NC TZ, and the nucleotide sequences are respectively shown as sequences 4 and 7-8.
Wherein, the probe and the nylon membrane are fixed by the common technology in the field, specifically, the pyrimidine base in the probe nucleic acid and the amino group with positive charge on the nylon membrane (for example, Biodyne B membrane of PALL company) are mutually cross-linked, and the combination is firmer by baking in a solid vacuum oven (baking condition can be-0.085 MPa, baking for 2 hours at 80 ℃) or ultraviolet cross-linking (10 minutes).
Further, the sample to which the detection kit of the present invention is applied includes, but is not limited to, gastric mucosa, gastric juice, feces, and pharyngeal swab.
Further, the invention also aims to provide a specific molecular marker of the helicobacter pylori and a primer group and application of a probe thereof in preparing a positive reference reagent, wherein the reagent can be used as a positive reference in the detection of the gene related to the helicobacter pylori genome.
The kit disclosed by the invention is used for specifically detecting the helicobacter pylori according to a PCR-reverse dot hybridization method, and is suitable for detecting the helicobacter pylori infection of genomic DNA extracted from a patient sample, specifically, a specific amplification product is designed according to a HP ureH gene, the genomic DNA is extracted from the patient sample and used as a template, a PCR product with a biotin group is obtained after PCR amplification, the PCR product is hybridized with an HP ureH detection probe fixed on a membrane strip, and the presence of the helicobacter pylori infection of a sample to be detected can be judged by naked eyes through enzymatic reaction color development.
Advantageous effects
The invention has the following beneficial effects:
1) the specificity is strong, the genes such as cag and vec of gastric helicobacter pylori are not all the genes of gastric helicobacter pylori, so that the genes cannot be used as specific detection genes of helicobacter pylori, and the V3 region of 23S rRNA or 16S rRNA is not good enough in specificity, so that non-specific binding with genes of other microorganisms is easy to occur. Although urease is a marker of the breath test of gastric helicobacter pylori C13, the urease gene cluster consists of multiple open reading frames, including ureA, ureB, ureE, ureF, ureG, ureH, etc., and microorganisms of urease also exist in the intestinal microbial flora, so it is very difficult to find a specific region of gastric helicobacter pylori in the urease gene. The amino acid sequence as shown in SEQ ID NO: 1, which can specifically detect the helicobacter pylori of the stomach without non-specific combination with other intestinal and oral microorganisms.
2) The kit has high sensitivity, greatly improves the sensitivity of clinical detection of the gastric helicobacter pylori, and the detection limit of the kit can reach 1.0 × 104copies/reaction;
3) the kit is suitable for non-invasive screening, and samples suitable for the kit comprise excrement, throat swabs and the like, and can be used for non-invasive screening of helicobacter pylori infected persons, particularly old people and children, so that early discovery and early treatment can be realized;
4) the specific molecular marker of the helicobacter pylori can be used as a positive reference when other helicobacter pylori genes such as cag and vec and other drug-resistant genes are detected, so that all processes of genome extraction, PCR and hybridization of other genes are monitored, further deep research on the helicobacter pylori is promoted, Hp prevention and treatment are greatly promoted, the Hp infection rate is reduced, and the Hp radical treatment rate is improved.
Drawings
FIG. 1: schematic diagram of membrane strip probe arrangement
(1) PC site: a human Rnase P gene detection probe;
(2) HP site: a probe for detecting the gene of helicobacter pylori (Hp);
(3) NC site: hp bacteria 16S rRNA gene detection probe.
FIG. 2: detection and comparison of pylorus spirochete bacterium negative positive pathological section and kit (chip) in antral stomach
(A) Hematoxylin and Eosin (HE) staining results of positive sample pathological histological sections;
(B) hematoxylin and Eosin (HE) staining results of negative sample pathological histological sections;
(C) staining results of positive sample pathological histological sections by a Warth-Starry method;
(D) staining results of negative sample pathological histological sections by a Warth-Starry method;
(E) detecting a positive sample result using the ureH gene as a reference (i.e., the present kit);
(F) detecting the result of the negative sample by using the ureH gene as a reference (namely the kit);
(G) detecting positive sample results using the ureC gene as a reference;
(H) detecting the result of the negative sample by using the ureC gene as a reference;
(I) detecting the result of the positive sample by using the ureA gene as a reference;
(J) negative sample results were detected using the ureA gene as a reference.
FIG. 3: fecal sample and throat swab sample chip helicobacter pylori detection
(A) Detecting positive stool sample results using the ureH gene as a reference (i.e., the present kit);
(B) the result of a negative stool sample was detected using the ureH gene as a reference (i.e., the present kit);
(C) positive pharyngeal swab sample results were detected using the ureH gene as a reference (i.e. the present kit);
(D) results from negative pharyngeal swab samples were tested using the ureH gene as a reference (i.e., the present kit).
Detailed Description
The present invention is described in more detail below to facilitate an understanding of the present invention.
It should be understood that the terms or words used in the specification and claims should not be construed as having meanings defined in dictionaries, but should be interpreted as having meanings that are consistent with their meanings in the context of the present invention on the basis of the following principles: the concept of terms may be defined appropriately by the inventors for the best explanation of the invention.
Example 1: kit composition for detecting helicobacter pylori
The kit of the invention comprises the following components:
TABLE 1 amounts of the respective components and major Components in the helicobacter pylori detection kit
TABLE 2 PCR amplification primer sequences in helicobacter pylori detection kit
TABLE 3 detection Probe sequences in helicobacter pylori detection kit
Example 2: method for detecting gastric helicobacter pylori
The kit can take gastric mucosa tissues and excrement as samples. Accordingly, the following requirements are to be taken into account when taking samples from the gastric mucosa: during gastroscopy, the gastric mucosa of the focus of a patient is taken and sealed for inspection. Because of the difference of the inhabitation positions of the helicobacter pylori, in order to improve the detection rate, the sampling of the gastric mucosa of multiple positions of each patient is recommended, wherein the gastric antrum mucosa is the most common, and the gastric mucosa specimen is clamped within 5cm from the pylorus at the gastric antrum position; when feces were used as samples: adjusting diet of patients, reducing ingestion of vegetable food, reducing polysaccharide substances in stool samples, and further avoiding PCR inhibition.
[ MEASUREMENT METHOD ]
Extraction of DNA
Extraction of genomic DNA can be performed according to the instructions of commercial DNA extraction kits, for example: qiagen blood, tissue DNA extraction kit, TIANGEN blood/cell/tissue extraction kit, etc.
PCR amplification
2.1. The PCR reaction tube is taken out, marked on the tube cover (or the side wall), and centrifuged at low speed for several seconds. Then 5. mu.L of sample DNA to be tested (recommended concentration is lower than 100 ng/. mu.L) with corresponding number is added into each PCR reaction tube according to the mark, and the total volume of each reaction is 25. mu.L. One negative quality control and one positive quality control can be set in each experiment and used as the quality control of the product, the operation is synchronous with the sample to be detected, and the sample adding amount is 5 mu L. After the sample is added, the mixture is centrifuged at low speed for several seconds, and the reaction solution is collected to the bottom of the tube.
2.2 PCR amplification was performed under the following conditions: 95 ℃ for 3min, (95 ℃ for 30sec, 56 ℃ for 40sec, 72 ℃ for 30sec, 40cycles), 72 ℃ for 5 min.
2.3. Taking out the amplification product, storing at 2-8 ℃, and carrying out hybridization detection within 24 hours; or storing at-20 deg.C for hybridization detection within 7 days.
3. Hybridization of
3.1. And taking out the TMB color developing solution from a refrigerator at 4 ℃ and restoring the TMB color developing solution to room temperature for later use. A2 mL centrifuge tube containing the pre-loaded membrane strip was removed, the sample number was marked on the centrifuge tube (or the number of the reaction membrane strip was marked with a pencil), and 1.8mL of solution I (2 XSSC, 0.1% SDS) was added. And (3) putting the PCR amplification product to be detected into a boiling water bath for heating for 10 minutes (or heating for 10 minutes at a temperature of more than 95 ℃ by using a metal bath, a PCR amplification instrument and the like), then putting the PCR amplification product on ice for cooling for more than 3 minutes, and then carrying out low-speed centrifugation and collection. The PCR products of the colorless and purple tubes were then added in their entirety (25. mu.L each) to the centrifuge tube corresponding to the sample number, the centrifuge tube was closed and placed in a hybridization chamber and incubated at 55 ℃ for at least 0.5 hour.
3.2. The hybridization tube was removed, solution I was removed, and 1.8mL of solution II (0.1 XSSC, 0.1% SDS) was added and washed in the hybridization chamber at 55 ℃ for 5 minutes.
4. Color development
4.1. HRP incubation solution (prepared with HRP 1000: 1 as solution I) was prepared, and 2mL of HRP incubation solution was required for each membrane.
4.2. The hybridization tube was removed, solution II removed, and 1.8mL of HRP incubation was added. Incubate gently with shaking for 30 minutes at room temperature.
4.3. The HRP incubation was discarded. Add 1.8mL of II solution and gently shake for 5 minutes.
4.4. Discard solution II and wash the membrane with 1.8mL of solution III (0.1M aqueous sodium citrate) at room temperature for 2 minutes.
4.5. Solution III was removed and 1.8mL of TMB developing solution was added. And soaking the membrane strip in color development liquid to prevent light for color development for at least 30 minutes, and then washing the membrane strip twice by using deionized water to observe the result.
[ interpretation of results ]
1. The sequence of probes on the membrane strip is shown in FIG. 1:
(1) PC site: human Rnase P gene detection probes. If the extraction of the DNA of the gastric mucosa sample is successful, a blue spot exists during the detection, and if no blue spot indicates that the extraction of the DNA of the gastric mucosa sample is unsuccessful, the detection experiment is invalid.
(2) HP site: a Ure H gene detection probe of helicobacter pylori (Hp). If Hp bacteria infection exists, blue spots exist during detection; if there is no blue spot, the Hp-free bacterial infection is detected.
(3) NC site: the Hp bacterium 16S rRNA gene detection probe has no hybridization reaction with a PCR product to be detected, and a blue spot is not needed, and if the blue spot exists, the detection process is polluted.
2. Quality control
2.1. If the color does not appear at the detection point of the PC during the detection, the experiment is invalid, and whether the experiment operation is wrong or the sampling amount of the sample is not enough is checked.
2.2. If the NC detection point is developed in the detection, please check whether the experimental operation is wrong or whether the hybridized reagent is polluted.
2.3. For laboratories and laboratory personnel who use the kit for the first time, experiments on positive quality control materials and negative quality control materials should be carried out to ensure that experimental conditions and operations meet requirements. During normal detection, negative quality control substance and positive quality control substance experiments should be performed regularly.
2.4. The use method of the positive quality control product comprises the following steps: taking a positive quality control product as a sample DNA solution, operating according to the steps of the detection method 2-4, and detecting results that a PC point and an HP point show blue.
The use method of the negative quality control product comprises the following steps: and taking the negative quality control product as a sample DNA solution, and operating according to the steps of the detection method 2-4, wherein the detection result is that only the PC spot is blue.
[ interpretation of test results ]
1. If the PC spot is a blue spot, the remainder are negative, indicating that the patient is not infected with Hp or that the bacterial count is below the detection range, i.e., less than 1.0 × 104copies/reaction.
2. If the PC and HP spots are blue spots, the patient is infected with Hp bacteria.
Example 3: detection of gastric helicobacter pylori infection in patients
To ensure the reliability of the test results, 10 cases of antral mucosa samples of H.pylori-positive patients and 10 cases of antral mucosa samples of H.pylori-negative patients were selected for the subsequent tests.
Histological section staining is a good method for clinical diagnosis of clinicians, and analysis of staining results can definitely judge whether helicobacter pylori infection exists in stomach tissues, tissues with helicobacter pylori infection are positive, and tissues without infection are negative. Histological section staining was selected as a control in this example.
The detection method of example 2 is respectively adopted for the above samples, the specific detection kit for helicobacter pylori is used for detection, the results of all positive samples are shown in figure 2E, and all negative samples are shown in figure 2F, and the detection result of the detection method of the invention is consistent with the staining result of the positive and negative pathological histological section tissues of helicobacter pylori in the antrum of the stomach (figure 2), which shows that the detection kit for helicobacter pylori can specifically detect whether Hp infection exists in the gastric mucosa sample of a patient (figure 2E, F).
In addition, to further determine the specificity of the ureH molecular marker of the present application, the detection of helicobacter pylori was performed according to the detection method of example 2 by using the above-mentioned positive and negative samples and designing amplification primers and probe combinations respectively using the ureC and ureA genes of helicobacter pylori of stomach as target genes, wherein the ureC PCR amplification primer and probe combinations are as follows: amplification primers UC-F0275 'Biotin-TCGGTAAAGACACCAGAA 3' and UC-R1955 'AAAAGGGTTGTGGCTCG 3' and detection probe UC-TZ 5 'AAGCGTTTTCTACCATATAGCCG 3'; the combination of the UreA PCR amplification primer and the probe is as follows: amplification primers UA-F0305 'Biotin-GTTGATGCTCCACTACGC 3' and UA-R1715 'AATTCAGCCGCAGTC 3' and detection probe UA-TZ 5 'TTTAGCCAATTCTCCAGCGTAGT 3'. As can be seen from the results of the detection, there were hybridization signals at all the detection probe sites (FIG. 2G, H and FIG. 2I, J), which may be caused by the interference of other bacterial DNAs having homologous sequences or the amplification of non-specific target sequences. That is, the use of ureC, ureA does not specifically distinguish the presence of H.pylori infection in the antrum of the stomach relative to the ureH molecular marker of the present invention.
Example 4: detection of feces samples and throat swab samples of Hp infected patients and non-infected patients
Fecal samples and throat swab samples from 15 Hp infected patients and 15 uninfected patients were selected for H.pylori detection.
The detection method of example 2 was used for the above samples, respectively, and the specific kit for detecting helicobacter pylori was used for the detection.
The result shows that the kit can better detect whether the Hp infection exists in a patient excrement sample and a pharynx swab sample (figure 3), namely the kit is suitable for carrying out non-invasive detection on the helicobacter pylori through the excrement sample, the pharynx swab sample and the like, relieves the pain of the patient, is particularly suitable for old people and children, and can enable the helicobacter pylori infection to be discovered and treated early, so that the helicobacter pylori infection is avoided.
The foregoing describes preferred embodiments of the present invention, but is not intended to limit the invention thereto. Modifications and variations of the embodiments disclosed herein may be made by those skilled in the art without departing from the scope and spirit of the invention.
SEQUENCE LISTING
<110>***
<120> specific molecular marker and detection kit for gastric helicobacter pylori
<130>2016
<160>8
<170>PatentIn version 3.5
<210>1
<211>226
<212>DNA
<213>artificial sequence
<400>1
atgtcagtgg ttttgggatc taaaatcgtg ttgtcataat agatgggttt ctcatcttgc 60
aaaatagaga tttttgtgtg caagcggttg aattggaaca actcattgcg cgccactcgc 120
cctgcgacaa tgatttcact atagagcaat tgagagctag agcgtaaaga aatcgtggtg 180
ttgcccttaa aatgcgcgtt ttcaaagggg attaacggga aaggtg 226
<210>2
<211>18
<212>DNA
<213>artificial sequence
<400>2
cacctttccc gttaatcc 18
<210>3
<211>17
<212>DNA
<213>artificial sequence
<400>3
atgtcagtgg ttttggg 17
<210>4
<211>22
<212>DNA
<213>artificial sequence
<400>4
cgtggtgttg cccttaaaat gc 22
<210>5
<211>16
<212>DNA
<213>artificial sequence
<400>5
tgacctgaag gctctg 16
<210>6
<211>16
<212>DNA
<213>artificial sequence
<400>6
acccatcagg aaatag 16
<210>7
<211>23
<212>DNA
<213>artificial sequence
<400>7
tgagcggctg tctccacaag tcc 23
<210>8
<211>22
<212>DNA
<213>artificial sequence
<400>8
ccgtaaggag gaggaaggtg gg 22
Claims (10)
1. A specific molecular marker for helicobacter pylori in stomach, which is characterized in that: the nucleotide sequence of the molecular marker is shown as SEQID NO: 1, which is a nucleotide fragment of urease ureH.
2. A primer set for detecting the molecular marker of claim 1, wherein: the nucleotide sequence is shown as SEQ ID NO: 2 and the nucleotide sequence of the primer HP-FB is shown as SEQ ID NO: 3, and the primer HP-R shown in the specification.
3. A nucleic acid probe for specifically detecting the molecular marker of claim 1, wherein: the nucleotide sequence of the nucleic acid probe is shown as SEQ ID NO: 4, respectively.
4. A detection kit for detecting helicobacter pylori by using a PCR-reverse dot hybridization method is characterized in that: the kit comprises the molecular marker of claim 1; the kit further comprises the primer set of claim 2.
5. The detection kit according to claim 4, characterized in that: the kit further comprises the nucleic acid probe of claim 3.
6. The test kit according to any one of claims 4 to 5, characterized in that: the kit comprises a kit I and a kit II, wherein the kit I comprises a PCR reaction solution, a streptomycin-labeled horseradish peroxidase HRP, a positive quality control product and a negative quality control product; the kit II comprises a nylon membrane strip and 3, 3 ', 5, 5' -tetramethyl benzidine TMB.
7. The detection kit according to claim 6, characterized in that: the PCR reaction solution consists of Taq enzyme, 1 XTaqbuffer, dNTP and an amplification primer; the positive quality control product comprises a plasmid containing a human ribonuclease P (human RNase P) gene fragment and a plasmid containing a ureH gene fragment; the negative quality control product only comprises a plasmid containing a human Rnase P gene fragment.
8. The detection kit according to claim 6, characterized in that: a detection probe is fixed on the nylon membrane strip; the detection probe detects human RNase P gene, helicobacter pylori ureH gene and helicobacter pylori 16S rRNA gene.
9. The detection kit according to claim 8, characterized in that: the nucleotide sequence of the detection probe is shown as SEQID NO: 4. 7-8.
10. Use of the molecular marker of claim 1, the primer set of claim 2 and the probe of claim 3 for the detection of genes associated with the helicobacter pylori genome, characterized in that: used for preparing a positive reference reagent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910054596.6A CN109536628B (en) | 2019-01-21 | 2019-01-21 | Specific molecular marker and detection kit for helicobacter pylori |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910054596.6A CN109536628B (en) | 2019-01-21 | 2019-01-21 | Specific molecular marker and detection kit for helicobacter pylori |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109536628A CN109536628A (en) | 2019-03-29 |
| CN109536628B true CN109536628B (en) | 2020-10-13 |
Family
ID=65838173
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910054596.6A Active CN109536628B (en) | 2019-01-21 | 2019-01-21 | Specific molecular marker and detection kit for helicobacter pylori |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109536628B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111944916A (en) * | 2020-09-14 | 2020-11-17 | 壹宏(深圳)基因有限公司 | Reagent for fecal microorganism detection and application thereof in gastric helicobacter pylori detection |
| CN113699261B (en) * | 2021-10-27 | 2022-02-11 | 广东省科学院微生物研究所(广东省微生物分析检测中心) | Specific molecular target, detection primer and rapid detection method for identifying helicobacter pylori |
| CN114705855B (en) * | 2022-03-31 | 2023-06-09 | 四川大学 | Quick detection kit for fecal helicobacter pylori based on colorimetric biosensor |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2682122B1 (en) * | 1991-10-03 | 1995-06-09 | Pasteur Institut | NEW GENES OF HELICOBACTER PYLORI. THEIR USE FOR THE PREPARATION OF RECOMBINANT STRAINS OF H. PYLORI. |
| US20060193866A1 (en) * | 2003-04-22 | 2006-08-31 | Intercell Ag | H pylori antigens |
-
2019
- 2019-01-21 CN CN201910054596.6A patent/CN109536628B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN109536628A (en) | 2019-03-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kabir | Detection of Helicobacter pylori in faeces by culture, PCR and enzyme immunoassay | |
| CN109536628B (en) | Specific molecular marker and detection kit for helicobacter pylori | |
| Makristathis et al. | Diagnosis of Helicobacter pylori infection | |
| Miftahussurur et al. | Identification of Helicobacter pylori infection in symptomatic patients in Surabaya, Indonesia, using five diagnostic tests | |
| CN109593842B (en) | Kit and method for detecting and judging drug resistance of helicobacter pylori | |
| CA2877835C (en) | Method for determining the presence of diarrhoea causing pathogens | |
| Ismail et al. | A newly developed nested PCR assay for the detection of Helicobacter pylori in the oral cavity | |
| CN117305487A (en) | Biomarker composition for early diagnosis of colorectal cancer and application | |
| CN101608210B (en) | Quantitative detection kit for helicobacter pylori nucleic acid | |
| Nakamura | Laboratory tests for the evaluation of Helicobacter pylori infections | |
| Hsieh et al. | Gastric juice‐based PCR assay: An alternative testing method to aid in the management of previously treated Helicobacter pylori infection | |
| Luman et al. | Helicobacter pylori infection is unlikely to be transmitted between partners: evidence from genotypic study in partners of infected patients | |
| CA2718214C (en) | Detection of bacteria belonging to the genus campylobacter by targeting cytolethal distending toxin | |
| Alhussaini | Prevalence of Helicobacter pylori among patients with different gastrointestinal disorders in Saudi Arabia. | |
| Bulajic et al. | Modalities of testing Helicobacter pylori in patients with nonmalignant bile duct diseases | |
| JPH1033179A (en) | Probe for diagnosis of infectious disease | |
| Basso et al. | Gastric juice polymerase chain reaction: an alternative to histology in the diagnosis of Helicobacter pylori infection | |
| CN112553356A (en) | Method for high-throughput detection and determination of drug resistance of helicobacter pylori | |
| CN110777213A (en) | Latent gastric cancer diagnostic kit | |
| EP1466011B1 (en) | New primers for the detection and identification of bacterial indicator groups and virulence factors | |
| Ali et al. | Genotyping of vacA of Helicobacter pylori in patients from Baghdad with gastro-duodenal diseases | |
| Ibrahim | Epidemiology, pathogenicity, risk factors, and management of Helicobacter pylori infection in Saudi Arabia | |
| JP2005198657A (en) | Probe hp-34 for detecting helicobactoer pylori | |
| Al-Shammarri et al. | CagA VIRULENCE GENE OF HELICOBACTER PYLORI ASSOCIATED WITH VIRULENCE FACTORS GENE OF PSEUDOMONAS AERUGINOSA ISOLATED FROM ENDOSCOPY AND GASTRIC BIOPSY. | |
| Mittal | Comparison of Different Diagnostic Methods of Helicobacter pylori in Dyspeptic Patients of a Tertiary Care Hospital of Uttarakhand, India Shiwani Sharma, Garima Mittal, RK Ag arwal, Vivek Ahuja, Rohit Gupta, Sohaib Ahmad |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |