CN109536508A - The plant of pest-resistant performance enhancement and it is related to the construct and method of pest resistance genes - Google Patents
The plant of pest-resistant performance enhancement and it is related to the construct and method of pest resistance genes Download PDFInfo
- Publication number
- CN109536508A CN109536508A CN201710863154.7A CN201710863154A CN109536508A CN 109536508 A CN109536508 A CN 109536508A CN 201710863154 A CN201710863154 A CN 201710863154A CN 109536508 A CN109536508 A CN 109536508A
- Authority
- CN
- China
- Prior art keywords
- accession number
- plant
- sequence
- seq
- polynucleotides
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Abstract
Disclosed herein is isolated polynucleotide and polypeptides, and assign the recombinant dna construct of plant resistance to insect；Composition (such as plant or seed) comprising these recombinant dna construct, and the method using these recombinant dna construct.The recombinant dna construct includes the polynucleotide of functional promoter in operable connection plant, wherein the polynucleotide encodes pest-resistant polypeptide.
Description
Technical field
The art is related to plant breeding and genetics, and more particularly to for assigning plants against pests performance
The control method of recombinant dna construct and insect pest of the plant.
Background of invention
Many insect species are corn and soybean, pea, cotton, rice and the farmings such as similar grain and fibre crops
The important pests of object, causing harm for pest can cause such as Crop damage or the expensive agrochemical of purchase control pest huge every year
Huge economic loss.In past several centuries, the main method for controlling these pests is using chemically synthesized desinsection
Close object, however since compound is non-selective and generation of the insect to the drug resistance of chemicals, chemical compound it is extensive
Using causing many environmental problems.
The development of biotechnology in recent decades provides opportunity, especially plant something lost to control pest by genetic engineering
The development learned is passed, along with the identification of the insect growth factor and abiogenous plant defense compounds or reagent, to create energy
The genetically modified crops for enough generating these defence reagents provide opportunity, protect the plants from attack of insect from this.
Certain kinds of known bacillus (Bacillus) microorganism have insecticidal activity to a series of insect pests,
These insects include Lepidoptera (Lepidoptera), Diptera (Diptera), coleoptera (Coleoptera), Semiptera
(Hemiptera) pest and other pests.Bacillus thuringiensis (Bacillus thuringiensis) (Bt) and Japan
Chafer bacillus (Bacillus popilliae) is the representative of the most successful biocontrol agent found up to now.Elder brother
Worm is pathogenic to be also considered as by bacillus larvae (B.larvae), slow disease bacilli (B.lentimorbus), spherical bud
Caused by the bacterial strain of spore bacillus (B.sphaericus) and bacillus cereus (B.cereus).Microorganism insecticide, especially
The microorganism insecticide that those are obtained from Bacillus strain, agriculturally as the alternative solution of Chemical Control of Harmful Insects
It plays an important role.
Encode the genetically modified plants energy of bacillus thuringiensis (Bt) endotoxin or plant protease inhibitor (PIs) gene
Specific pest is enough resisted, such as the corn of the insecticidal proteins of Bacillus thuringiensis bacterial strain can be generated and cotton has passed through heredity
Engineering obtains, and the crop of these genetic transformations is now widely used in agricultural, and provides environmental-friendly and business for peasant and attract
The conventional method of the substitution insect control of power.Usually, compared with the chemical insecticide of traditional wide spectrum, the dirt of biological insecticides
Dye and environmental hazard risk are lower, and biological insecticides have preferable desired specificities.In addition, biological insecticides production cost
It is low, therefore improve the economic flow rate of various crops.
Biological insecticides have proved to be extremely successful commercialization, these insect-resistant transgenic crops are only narrow to one
Important Economic pest in range is resistant.In some cases, insect generates resistance to different Pesticidal compounds, this is just
Need to identify the substitutability biocontrol agent of control pest.There is still a need for have different range insecticidal to insect pest
Active novel pesticidal proteins, such as the insecticidal protein active to the various insects of Lepidoptera and Semiptera, it is described a variety of
Insect includes but is not limited to the insect pest that resistance has been generated to existing insecticide.
Summary of the invention
The present invention includes that scheme is implemented as follows:
On the one hand, the present invention includes a kind of isolated polynucleotides, and polynucleotides described in overexpression improve Genes For Plant Tolerance evil
Worm property, the polynucleotides include: a kind of (a) polynucleotides, the sequence of nucleotide sequence and SEQ ID NO:4,7 or 10
Consistency is at least 85%；(b) a kind of polynucleotides, the sequence identity of nucleotide sequence and SEQ ID NO:5,8 or 11
At least 85%；(c) a kind of polynucleotides, the amino acid sequence of the polypeptide of coding and the sequence of SEQ ID NO:6,9 and 12
Consistency is at least 90%；Or (d) nucleotide sequence (a), (b) or overall length complementary series (c).The isolated polynucleotides
Including SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10 or SEQ ID NO:
11；The isolated polynucleotide encoding polypeptide, the amino acid sequence of the polypeptide include SEQ ID NO:6, SEQ ID NO:9
Or SEQ ID NO:12.The pest is lepidoptera, especially corn borer (Ostrinia furnacalis).
On the other hand, the present invention includes a kind of recombinant dna construct, can be operated it includes isolated polynucleotides and with it
At least one heterologous regulatory sequence of connection, wherein the polynucleotides include (a) a kind of polynucleotides, nucleotide sequence and
The sequence identity of SEQ ID NO:4,5,7,8,10 or 11 is at least 85%；(b) a kind of polynucleotides, the polypeptide of coding
The sequence identity of amino acid sequence and SEQ ID NO:6,9 or 12 are at least 90%；Or (c) nucleotide sequence (a) or (b)
Overall length complementary series；At least one described regulating and controlling sequence is functional promoter in plant.The isolated polynucleotides are compiled
Code DN-ITP3, DN-ITP4 or DN-ITP5 polypeptide.
On the other hand, the present invention includes a kind of plant, plant cell or seed, the plant, plant cell or kind attached bag
Include a kind of recombinant dna construct, the recombinant dna construct include a kind of polynucleotides and be operatively connected with it at least one
A regulating and controlling sequence, the polynucleotides include (a) a kind of polynucleotides, nucleotide sequence and SEQ ID NO:4,5,7,8,10
Or 11 sequence identity is at least 85%；(b) a kind of polynucleotides, the amino acid sequence and SEQ ID of the polypeptide of coding
The sequence identity of NO:6,9 or 12 is at least 90%；Or (c) nucleotide sequence (a) or overall length complementary series (b).
On the other hand, the present invention includes a kind of plant or plant cell, in its genome includes a kind of recombinant DNA construction
Body, the recombinant dna construct include a kind of polynucleotides and at least one controlling element being operatively connected with it, wherein
The polynucleotides include (a) a kind of polynucleotides, the sequence of nucleotide sequence and SEQ ID NO:4,5,7,8,10 or 11
Consistency is at least 85%；(b) a kind of polynucleotides, the amino acid sequence and SEQ ID NO:6,9 or 12 of the polypeptide of coding
Sequence identity be at least 90%；(c) nucleotide sequence (a) or overall length complementary series (b)；Compared with check plant, institute
State the insect resistace that plant shows enhancing.The insect resistace of the enhancing, which is directed to, is selected from following purpose insect: coleoptera
(Coleoptera), Diptera (Diptera), Hymenoptera (Hymenoptera), Lepidoptera (Lepidoptera), mallophaga mesh
(Mallophaga), Homoptera (Homoptera), Semiptera (Hemiptera), Orthoptera (Orthroptera), Thysanoptera
(Thysanoptera), Dermaptera (Dermaptera), Isoptera (Isoptera), Anoplura (Anoplura), Siphonaptera
(Siphonaptera) and Trichoptera (Trichoptera) etc., especially Lepidoptera (Lepidoptera).The pest is sub-
Continent corn borer (Ostrinia furnacalis).The present invention includes any plant in the present invention, wherein the plant is selected from water
Rice, corn and soybean, sunflower, sorghum, rape, wheat, clover, cotton, barley, grain, sugarcane and switchgrass.
On the other hand, the method for improving plant resistance to insect is provided comprising overexpression encoding D N-ITP3, DN-ITP4
Or at least one polynucleotides of DN-ITP5 polypeptide, the polynucleotides include: a kind of (a) polynucleotides, nucleotide sequence
It is at least 85% with the sequence identity of SEQ ID NO:4,7 or 10；(b) a kind of polynucleotides, nucleotide sequence and SEQ
The sequence identity of ID NO:5,8 or 11 is at least 85%；(c) a kind of polynucleotides, the amino acid sequence of the polypeptide of coding
It is at least 90% with the sequence identity of SEQ ID NO:6,9 or 12.The method for improving plant resistance to insect is included (a) to can
Aftergrowth cell imports recombinant dna construct, and the recombinant dna construct includes to be operatively connected an at least regulating and controlling sequence
Polynucleotides, wherein one polypeptide of the polynucleotide encoding, amino acid sequence and the sequence one of SEQ ID NO:6,9 or 12
Cause property is at least 80%；(b) by the regenerable cell regenerating plants after step (a), wherein genetically modified plants are in its base
Because including recombinant dna construct in group；(c) progeny plant is obtained by the genetically modified plants of step (b), wherein the filial generation is planted
Object includes recombinant dna construct in its genome, compared with the check plant for not including recombinant dna construct, the filial generation
The pest-resistant performance of genetically modified plants display enhancing.The pest is Lepidoptera (Lepidoptera), especially Ostrinia furnacalis
(Ostrinia furnacalis)。
On the other hand, the method for assessment plant resistance to insect is provided comprising: (a) weight is imported to renewable plant cell
Group DNA construct, the recombinant dna construct include a kind of polynucleotides and are operatively connected at least one regulation sequence with it
Column, wherein the sequence identity of the amino acid sequence of the polypeptide of the polynucleotide encoding and SEQ ID NO:6,9 or 12 are at least
It is 80%；(b) by the regenerable cell regenerating plants of step (a), wherein the genetically modified plants are in its genome
Include recombinant dna construct；(c) progeny plant is obtained by the genetically modified plants, wherein in the genome of the progeny plant
Include recombinant dna construct；(d) it is control with the check plant for not including recombinant dna construct, assesses the anti-of progeny plant
Worm performance.The pest is Lepidoptera (Lepidoptera), especially Ostrinia furnacalis (Ostrinia furnacalis).
On the other hand, the present invention relates to a recombinant dna construct, and it includes isolated polymerized nucleosides any in the present invention
Acid, and be operatively connected at least one regulating and controlling sequence；And cell, Plants and Seeds comprising recombinant dna construct.It is described
Cell includes eukaryocyte, such as yeast, insect or plant cell；Or prokaryotic cell, such as bacterium.
Detailed description and sequence table
According to detailed description of the invention below and sequence table, the present invention, detailed description of the invention and sequence below can be more fully understood
Table forms a part of the application.
The number of table 1. sequence table nucleotide sequence and amino acid sequence
Sequence description and associated sequence table are followed such as management patent listed in 37C.F.R. § 1.821-1.825
Rule disclosed in nucleotide and/or amino acid sequence in application.Sequence table include nucleotide sequence character single-letter code with
And the trigram code of amino acid, as in accordance with defined in IUPAC-IUBMB standard, the standard is in Nucleic Acids
It Res.13:3021-3030 (1985) and is described in Biochemical J.219 (No.2): 345-373 (1984),
This two documents are hereby incorporated herein by.Symbol and format for nucleotide and amino acid sequence data follow
The rule listed in 37C.F.R. § 1.822.
SEQ ID NO:1 is the nucleotide sequence of (RB) flanking sequence on the right side of the T-DNA being inserted into AH34721 strain.
SEQ ID NO:2 is the nucleotide sequence of (LB) flanking sequence on the left of the T-DNA being inserted into AH31052 strain.
SEQ ID NO:3 is the nucleotide sequence of (RB) flanking sequence on the right side of the T-DNA being inserted into AH36183 strain.
SEQ ID NO:4 is the nucleotide sequence of OsDN-ITP3 gene cDNA.
SEQ ID NO:5 is the nucleotide sequence of OsDN-ITP3 gene C DS.
SEQ ID NO:6 is the amino acid sequence of OsDN-ITP3 polypeptide.
SEQ ID NO:7 is the nucleotide sequence of OsDN-ITP4 gene gDNA.
SEQ ID NO:8 is the nucleotide sequence of OsDN-ITP4 gene C DS.
SEQ ID NO:9 is the amino acid sequence of OsDN-ITP4 polypeptide.
SEQ ID NO:10 is the nucleotide sequence of OsDN-ITP5 gene gDNA.
SEQ ID NO:11 is the nucleotide sequence of OsDN-ITP5 gene C DS.
SEQ ID NO:12 is the amino acid sequence of OsDN-ITP5 polypeptide.
SEQ ID NO:13 is the forward primer for cloning OsDN-ITP3 gene cDNA.
SEQ ID NO:14 is the reverse primer for cloning OsDN-ITP3 gene cDNA.
SEQ ID NO:15 is the forward primer for cloning OsDN-ITP4 gene gDNA.
SEQ ID NO:16 is the reverse primer for cloning OsDN-ITP4 gene gDNA.
SEQ ID NO:17 is the forward primer for cloning OsDN-ITP5 gene gDNA.
SEQ ID NO:18 is the reverse primer for cloning OsDN-ITP5 gene gDNA.
SEQ ID NO:19 is the forward primer of OsDN-ITP3 gene real-time PCR analysis.
SEQ ID NO:20 is the reverse primer of OsDN-ITP3 gene real-time PCR analysis.
SEQ ID NO:21 is the forward primer of OsDN-ITP4 gene real-time PCR analysis.
SEQ ID NO:22 is the reverse primer of the real-time PCR primer of OsDN-ITP4 gene.
SEQ ID NO:23 is the forward primer of OsDN-ITP5 gene real-time PCR analysis.
SEQ ID NO:24 is the reverse primer of OsDN-ITP5 gene real-time PCR analysis.
Detailed description of the invention
The full text of the disclosure of every listed bibliography is hereby incorporated herein by herein.
As used herein and singular in the dependent claims "one" and " described " include plural references,
Unless the context clearly dictates otherwise.Thus, for example, the connotation of " one plant of plant " includes more plants of such plants.It is " one thin
The connotation of born of the same parents " includes one or more cell and its equivalent known to those skilled in the art, etc..
It is as used herein:
Term " OsDN-ITP3 " is insect resistance albumen 3 (insect tolerance protein 3), is related to paddy gene
Site LOC_Os08g01400.1 coding, it can be improved the polypeptide of vegetable insect resistance, " DN-ITP3 polypeptide " is referred to OsDN-
ITP3 polypeptide and homologue from other plant.
OsDN-ITP3 polypeptide (SEQ ID NO:6) is the coded sequence of paddy gene site LOC_Os08g01400.1
(CDS) polypeptide of (SEQ ID NO:5) or nucleotide sequence (SEQ ID NO:4) coding.The polypeptide is in TIGR (msu.edu/
Index.shtml annotation is " expression albumen " in), and annotation is " unnamed albumen in NCBI (ncbi.nlm.nih.gov)
Product ", but not first function introduction.
Term " OsDN-ITP4 " is insect resistance albumen 4 (insect tolerance protein 4), is related to paddy gene
Site LOC_Os01g61750.1 coding, it can be improved the polypeptide of vegetable insect resistance, " DN-ITP4 polypeptide " is referred to OsDN-
ITP4 polypeptide and homologue from other plant.
OsDN-ITP4 polypeptide (SEQ ID NO:9) is the coded sequence of paddy gene site LOC_Os01g61750.1
(CDS) polypeptide of (SEQ ID NO:8) or nucleotide sequence (SEQ ID NO:7) coding.It is " false that the polypeptide annotates in TIGR
Determine albumen ", but not first function introduction.
Term " OsDN-ITP5 " is insect resistance albumen 5 (insect tolerance protein 5), is related to paddy gene
Site LOC_Os12g01540.1 coding, it can be improved the polypeptide of vegetable insect resistance, " DN-ITP5 polypeptide " is referred to OsDN-
ITP5 polypeptide and homologue from other plant.
OsDN-ITP5 polypeptide (SEQ ID NO:12) is the coded sequence of paddy gene site LOC_Os12g01540.1
(CDS) polypeptide of (SEQ ID NO:11) or nucleotide sequence (SEQ ID NO:10) coding.The polypeptide annotates in TIGR
" expression albumen ", but not first function introduction.
As used herein, " albumen of resistance to worm " and " insect resistance protein " refers to the life for being able to suppress, hindering one or more pests
Polypeptide that is long and/or can killing one or more pests, the pest includes but is not limited to Lepidoptera, Diptera, Semiptera
With the pest of coleoptera.
Monocotyledon in the present invention includes plant gramineous；Dicotyledon includes Cruciferae, pulse family and eggplant
The plant of section.
" overall length complementary series " refers to that the complementary series of given nucleotide sequence, complementary series and nucleotide sequence contain phase
Same few nucleotide, and 100% complementation.
" transgenosis " refer to its genome because heterologous nucleic acids (such as recombinant dna construct) there are due to change it is any
Cell, cell line, callus, tissue, plant part or plant, including those initial transgenic events and from initial
Transgenic event those of is generated by sexual hybridization or asexual reproduction.Term " transgenosis " as used herein is not covered logical
Cross conventional plant breeding method or by such as random allogamy, non-recombinant virus infection, non-recombinant Bacterial Transformation, non-recombinant
Genome caused by the naturally-occurring event of swivel base or spontaneous mutation etc (DNA sequence or dyeing outer-gene group) changes
Become.
" control ", " check plant " or " check plant cell " are the character mutation for measuring tested person plant or plant cell
Reference is provided, due to conversion, the genome change of test plants or plant cell influences target gene, the plant of test or plant
Object cell can be the filial generation of above-mentioned change plant or plant cell, and contain identical change.
Check plant or check plant cell include, for example: (a) phase homogenic type changing for gene as starting material
Sell of one's property the wild-type plant or cell of raw test plants or cell；(b) phase homogenic type as starting material but is transferred to zero load
Body (as with marker gene and do not have influential carrier to the character of target) plant or plant cell；(c) transgenosis is planted
Object or plant cell trait segregation, the non-transgenic progeny plant or plant cell of acquisition；(d) without exposure to can induce
Under the condition or stimulation of gene expression, plant identical with genetically modified plants or plant cell gene group or plant cell；(e)
Specific target gene is not under expression, genetically modified plants or plant cell itself.
In the present invention, ZH11-TC and empty carrier plant refer to check plant.ZH11-TC representative passes through tissue cultures
The rice plant that Zhonghua 11 is obtained, empty carrier represent conversion zero load DP0158 and obtain rice plant.
" genome " not only covers the chromosomal DNA being present in nucleus when for plant cell, but also including
The organelle DNA being present in the subcellular components (such as mitochondria, plasmid) of cell.
" plant " includes the son of entire plant, plant organ, plant tissue, seed and plant cell and same plant
Generation.Plant cell includes but is not limited to the cell for deriving from following substance: seed, suspension culture, embryo, meristematic region, callus group
It knits, leaf, root, bud, gametophyte, sporinite, pollen and microspore.
" filial generation " includes any subsequent generation of plant.
" modified plant " includes the plant of the gene or promoter comprising heterologous polynucleotide or modification in its genome.
Heterologous polynucleotide can be steadily integrated into genome, and heredity is continuous from generation to generation.Heterologous polynucleotide can individually or
Thin consolidation as recombinant dna construct is into genome.T0 plant is directly derived from conversion and regenerative process, the son of T0 plant
On behalf of T1 generation (first filial generation), T2 generation (second filial generation) etc..The gene or promoter of modification can be in Plant Genome
Single or several or one section of deoxynucleotide insertion or deletion.
" heterologous " for sequence means the sequence from alien species, or if coming from same species, refers to
It is made up of premeditated human intervention from its native form and/or the sequence of locus significantly changed.
" polynucleotides ", " nucleic acid sequence ", " nucleotide sequence " or " nucleic acid fragment " are used interchangeably and are optionally to contain
Have synthesis, it is non-natural or change nucleotide base single-stranded or double-stranded RNA or DNA polymer.Nucleotide (usually with
5 '-monophosphate form presence) referred to by they following single letter title: " A " be adenylate or deoxyadenylic acid (point
RNA or DNA is not corresponded to), " C " indicates that cytidine monophosphate or deoxycytidylic acid, " G " indicate that guanylic acid or deoxyguanylic acid, " U " indicate urine
Thuja acid, " T " indicate that deoxythymidylic acid, " R " indicate purine (A or G), and " Y " indicates pyrimidine (C or T), and " K " indicates G or T, " H " table
Show A or C or T, " I " indicates inosine, and " N " indicates any nucleotide.
" polypeptide ", " peptide ", " amino acid sequence " and " protein " is used interchangeably herein, and refers to the poly- of amino acid residue
Close object.The term is suitable for the artificial chemistry class that wherein one or more amino acid residues are corresponding naturally occurring amino acid
Like the amino acid polymer of object, and it is suitable for naturally occurring amino acid polymer.Term " polypeptide ", " peptide ", " amino acid sequence
Column " and " protein " may also include modified forms, including but not limited to glycosylation, lipid connection, sulfation, glutaminic acid residue
γ carboxylation, hydroxylation and ADP- ribosylation.
" mRNA (mRNA) " refers to intronless and can RNA by cell translation at protein.
" cDNA " refers to complementary with mRNA template and utilizes DNA of the reverse transcriptase from mRNA templated synthesis.CDNA can be single
The Klenow segment that chain or available DNA aggregates into enzyme I is converted to double-stranded form.
" maturation " protein refers to the polypeptide of translated post-processing；It has had been removed and has been present in appointing in primary translation product
The polypeptide of what propetide or former peptide.
" precursor " protein refers to the translation Primary product of mRNA；Have the protein of propetide and former peptide.Propetide and former peptide
It can be and be not limited to intracellular localization signals.
" separation " refers to that substance, such as nucleic acid and/or protein, the substance are substantially free, or with its other party
What formula was separated from the component for usually accompanying or interacting with the substance in natural environment.Isolated polynucleotides can
It is purified from their naturally occurring host cells.Conventional nucleic acid purification process known to technical staff can be used for obtaining separation
Polynucleotides.The term is also covered by recombination of polynucleotide and chemically synthesized polynucleotides.
" recombinant " refers to (for example) by chemical synthesis or by manipulating isolated nucleic acid fragment with technique for gene engineering
Come the artificial combination for two sequence fragments separated originally realized." recombinant " also includes referring to have passed through to introduce heterologous nucleic acids
And the cell or carrier modified, or derived from the cell of the cell through modifying in this way, but do not cover not premeditated artificial dry
Disturb and the change of the event (such as spontaneous mutation, Natural Transformation/transduction/swivel base) naturally occurred that occurs to cell or carrier.
" non-genomic nucleic acid sequence ", " non-genomic nucleic acid molecule " or " non genome polynucleotides " refers to and natural or base
Because a group nucleic acid sequence is compared, there are the nucleic acid molecules that one or more nucleic acid sequences change.In certain embodiments, natural or
The change of genomic nucleic acids molecule includes but is not limited to: due to genetic code degeneracy and generate nucleic acid sequence variation；It plants
The nucleic acid sequence codon optimization of object expression；Compared with natural or genome sequence, the substitution of at least one amino acid, insertion,
The variation of nucleic acid sequence caused by deleting and/or adding；The one or more intrones being connected with genomic nucleic acid sequence
It removes；The insertion of one or more heterologous introns；Be connected one or more upstreams or Downstream regulatory with genomic nucleic acid sequence
The deletion in region, the insertion of one or more heterologous upstreams or downstream regulator regions；Be connected with genomic nucleic acid sequence 5 ' and/
Or 3 ' non-translational region deletion；The insertion of one heterologous 5 ' and/or 3 ' non-translational region；With the modification of polyadenylation site.?
In some embodiments, non-genomic nucleic acid molecule is cDNA.In some embodiments, non-genomic nucleic acid molecule is synthesis
Nucleic acid sequence.
" recombinant dna construct " refer in nature usually will not existing nucleic acid fragment together combination.Therefore, it recombinates
DNA construct may include the regulating and controlling sequence and coded sequence or identical source but usually naturally occurring to be different from of separate sources
The mode regulating and controlling sequence and coded sequence that arrange.
Term " entry clones " and " entry vector " are used interchangeably herein.
" regulating and controlling sequence " and " controlling element " is used interchangeably, refer to the upstream (5 ' non-coding sequence) positioned at coded sequence,
Intermediate or downstream (3 ' non-coding sequence), and influence the transcription of related coding sequences, RNA processing or stability or translation
Nucleotide sequence.Regulating and controlling sequence may include but be not limited to promoter, translation leader sequence, introne and polyadenylation identification sequence
Column.
" promoter " refers to control the nucleic acid fragment of another nucleic acid fragment transcription.
" functional promoter in plant " is the promoter that can control the transcription in plant cell, whether is it coming
Derived from plant cell.
" tissue-specific promoter " and " tissue-preferred promoter " is used interchangeably, and refers to main but nonessential single-minded
Ground is expressed in a kind of tissue or organ, the promoter that can also be expressed in a kind of specific cells.
" developmental regulation promoter " refers to the promoter that its activity is determined by development event.
Term " being operably connected " refers to that nucleic acid fragment connects into single segment, so that the function of one of nucleic acid fragment
Regulation by another nucleic acid fragment.For example, when promoter can adjust the transcription of nucleic acid fragment, the promoter and the core
Acid fragment is operably connected.
" expression " refers to the generation of function product.For example, the expression of nucleic acid fragment can refer to the transcription of nucleic acid fragment (such as transcription life
At mRNA or function RNA) and/or RNA translate into precursor or mature protein.
" phenotype " means the detectable feature of cell or organism.
Related " importing " that nucleic acid fragment (such as recombinant dna construct) insertion is intracellular refers to " transfection " or " conversion "
Or " transduction ", and nucleic acid fragment is integrated into eukaryon or prokaryotic cell including referring to, it can be integrated in the cell center acid fragment
Into in the genome (such as chromosome, plasmid, plastid or mitochondrial DNA) of cell, it is transformed into autonomous replicon or transient expression
(such as the mRNA of transfection).
" transformed cells " are that nucleic acid fragment (such as recombinant dna construct) is imported any cell therein.
" conversion " used herein refers to both stable conversion and instantaneous conversion.
" stable conversion ", which refers to, to be imported nucleic acid fragment in the genome of host organisms, and gene is caused to stablize heredity.Once
Stable conversion, nucleic acid fragment are steadily integrated into host organisms and the genome in any successive generation.
" instantaneous conversion ", which refers to, imports nucleic acid fragment in the core of host organisms or in the organelle comprising DNA, causes base
Because expression stablizes heredity without gene.
" allele " is the one of which for occupying several selective forms on chromosome to the gene of anchor point.When two
Given on pair of homologous chromosome in times body plant allele present on locus it is identical when, the plant is at the locus
It is homozygous.If it is different to give allele present on locus in diplont on pair of homologous chromosome, should
Plant is heterozygosis at the locus.If transgenosis be present in diplont in pair of homologous chromosome wherein it
On one, then the plant is hemizygous at the locus.
" chloroplast transit peptides " be with albumen collaborative translation and will albumen guiding chloroplaset or translate albumen cell in deposit
Other plastid types amino acid sequence." chloroplast transit sequence " refers to the nucleotide sequence of encoding chloroplast transit peptide.
" signal peptide " is a kind of amino acid sequence (Chrispeels, M. that secretory is oriented to albumen collaborative translation and by albumen
(1991) Ann.Rev.PlantPhys.Plant Mol.Biol.42:21-53).It, can be another if the albumen is oriented to vacuole
Additional upper vacuole targets signal, or if the albumen is oriented to endoplasmic reticulum, can add endoplasmic reticulum retention signal.If by egg
White guiding nucleus will remove any existing signal peptide and substitute (Raikhel (1992) Plant to nuclear localization signal
Phys.100:1627-1632)." mitochondrial signal peptide " is the amino acid sequence (Zhang for guiding precursor protein to enter mitochondria
With Glaser (2002) Trends Plant Sci 7:14-21).
Sequence alignment and homogeneity percentage are measured using a variety of comparative approach designed for detection homologous sequence, this
A little methods include but is not limited to the program that biological information calculates packet (Inc., Madison, WI).Unless otherwise stated, provided herein is
Sequence multiple alignment with Clustal V comparison method (Higgins and Sharp, 1989, CABIOS.5:151-153) use
Default parameters (gap penalty=10, GAP LENGTH PENALTY=10) executes.With Clustal V method carry out in contrast with to and albumen
The default parameters that the homogeneity percentage of matter sequence calculates is KTUPLE=1, gap penalty (GAP PENALTY)=3, window
And DIAGONALS SAVED=5 (WINDOW)=5.And for nucleic acid, these parameters are KTUPLE=2, gap penalty=5,
Window=4 and DIAGONALS SAVED=4.It, can be by checking in same program after Clustal V program aligned sequences
" sequence distance " table obtain " homogeneity percentage " and " divergence " value.Unless otherwise stated, provided herein and statement
Homogeneity percentage and divergence degree are to calculate in this way.
Standard recombinant dna and molecule clone technology used herein are known in the art and have in the following literature
A more complete description: Sambrook, J., Fritsch, E.F. and Maniatis, T., Molecular Cloning:A
Laboratory Manual；Cold Spring HarborLaboratory Press:Cold Spring Harbor, 1989
(hereinafter referred to as " Sambrook ").
Turning now to embodiment:
Embodiment includes isolated polynucleotides and polypeptides, the recombinant dna construct for assigning Genes For Plant Tolerance insect pest, comprising this
The composition (such as plant or seed) of a little recombinant dna construct, and the method using these recombinant dna construct.
Isolated polynucleotides and polypeptides:
The present invention includes the polynucleotides and polypeptides separated as follows:
In some embodiments, polynucleotide encoding DN-ITP3, DN-ITP4 or DN-ITP5.
In some embodiments, isolated polynucleotides include: a kind of (i) nucleic acid sequence for encoding polypeptide, described more
The amino acid sequence that peptide has when being compared with SEQ ID NO:6,9 or 12 have at least 50%, 51%, 52%, 53%,
54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%,
69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%,
84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
99% or 100% sequence identity；Or the overall length complementary series of (ii) nucleic acid sequence (i), wherein overall length complementary series and core
Acid sequence (i) is made of equal number of nucleotide and is 100% complementation.Any above-mentioned isolated polynucleotides can be used for
Any recombinant dna construct of the invention.
In some embodiments, isolated polypeptide, amino acid sequence are compared with SEQ ID NO:6,9 or 12
When have at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%,
63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%,
78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%,
93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity.The polypeptide is pest-resistant polypeptide DN-
ITP3, DN-ITP4 or DN-ITP5.
In some embodiments, isolated polynucleotides comprising: a kind of (i) nucleic acid sequence, the nucleotide sequence
When being compared with SEQ ID NO:4,5,7,8,10 or 11 have at least 50%, 51%, 52%, 53%, 54%, 55%,
56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%,
71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%,
86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%
Sequence identity；Or the overall length complementary series of (ii) nucleic acid sequence (i).Any above-mentioned isolated polynucleotides can be used for this hair
Bright any recombinant dna construct.Isolated polynucleotides preferably encode insect resistance protein.It is overexpressed pest-resistant polypeptide and increases plant
Resistance of the object to pest.
Recombinant dna construct
On the one hand, the present invention includes recombinant dna construct.
In one embodiment, recombinant dna construct includes and is operably coupled to less a kind of regulating and controlling sequence (e.g., to exist
Functional promoter in plant) polynucleotides, wherein the polynucleotides include a kind of (i) nucleic acid sequence, the nucleic acid
Have at least 50% when the amino acid sequence of sequential coding and SEQ ID NO:6,9 or 12 are compared, 51%, 52%,
53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%,
68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%,
83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98%, 99% or 100% sequence identity；Or the overall length complementary series of (ii) nucleic acid sequence (i).
In another embodiment, recombinant dna construct includes to be operably coupled to less a kind of regulating and controlling sequence (e.g.,
The functional promoter in plant) polynucleotides, wherein the polynucleotides include a kind of (i) nucleic acid sequence, the core
Nucleotide sequence when being compared with SEQ ID NO:4,5,7,8,10 or 11 have at least 50%, 51%, 52%, 53%,
54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%,
69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%,
84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
99% or 100% sequence identity；Or the overall length complementary series of (ii) nucleic acid sequence (i).
In another embodiment, recombinant dna construct includes and is operably coupled to less a kind of regulating and controlling sequence (e.g., to exist
Functional promoter in plant) polynucleotides, wherein described polynucleotide encoding DN-ITP3, DN-ITP4 or DN-ITP5
Polypeptide.These polypeptides have the activity of anti-pest, and may be from, such as rice (Oryza sativa), wild rice (Oryza
Australiensis), short tongue wild rice (Oryza barthii), African type rice (Oryza glaberrima), broad-leaved rice
(Oryza latifolia), long male wild rice (Oryza longistaminata), southern wild rice (Oryza
Meridionalis), oryza officinalis (Oryza officinalis), Oryza punctata (Oryza punctata), common open country
Raw rice (Oryza rufipogon) (red rice), India's wild rice (Oryza nivara), arabidopsis (Arabidopsis
Thaliana), corn (Zea mays), soybean (Glycine max), cigarette beans (Glycine tabacina), Wild soybean
(Glycine soja) and glycine tomentella (Glycine tomentella).
It should understand that (as will be appreciated by one of skill in the art), the present invention not only covers these specific examples
Property sequence.Cause to amino acid chemically of equal value is generated at anchor point but do not influence coded polypeptide functional characteristic nucleic acid
Change in segment is well-known in the art.For example, a kind of codon of alanine (hydrophobic amino acid) can be encoded
The weaker residue of another hydrophobicity (such as glycine) or the stronger residue of hydrophobicity (such as valine, leucine or different bright
Propylhomoserin) codon replace.Similarly, a negatively charged residue is caused to replace with another negatively charged residue (example
Such as, aspartic acid for glutamic acid) or a positively charged residue replace with another positively charged residue (for example,
Lysine replace arginine) changes be also contemplated by generate functionally equivalence product.Lead to the end N- and the C- of peptide molecule
The nucleotide variation that end section changes is also by the estimated activity that will not change polypeptide.Each in the modification proposed is complete
Entirely in the routine techniques of this field, the reservation of the bioactivity of encoded product is such as measured.
Regulating and controlling sequence:
Recombinant dna construct of the invention may include at least one regulating and controlling sequence.
Regulating and controlling sequence can be promoter or enhancer.
In a variety of promoter recombinant dna construct for use in the present invention.Promoter can be selected depending on the desired results, and
And may include constitutive promoter for being expressed in host organisms, tissue-specific promoter, inducible promoter or
Other promoters.
The promoter for causing gene to be expressed in most cases in most cell types is generally known as " composing type starting
Son ".
Although its effect can be predicted when driving and expressing by constitutive promoter in candidate gene, candidate gene is in 35S
Or high level, the constitutive expression under the control of UBI promoter can have multiple-effect.It is special using organizing specific and/or stress
Promoter can eliminate unwanted effect but retain the ability of insect resistace.The effect has been had been observed that in Arabidopsis
(Kasuga et al. (1999) Nature Biotechnol.17:287-91).
Constitutive promoter suitable for plant host cell include (for example) the core promoter of Rsyn7 promoter and
Other constitutive promoters disclosed in WO 99/43838 and United States Patent (USP) 6,072,050；CaMV 35S core promoter
(Odell et al., Nature 313:810-812 (1985))；Rice actin (McElroy et al., Plant Cell 2:163-
171(1990))；Ubiquitin promoter (Christensen et al., Plant Mol.Biol.12:619-632 (1989) and
Christensen et al., Plant Mol.Biol.18:675-689 (1992))；PEMU (Last et al.,
Theor.Appl.Genet.81:581-588 (1991))；MAS (Velten et al., EMBO are J.3:2723-2730 (1984))；
ALS promoter (United States Patent (USP) 5,659,026) etc..Other constitutive promoters include for example in United States Patent (USP) 5,608,149,5,
608,144,5,604,121,5,569,597,5,466,785,5,399,680,5,268,463,5,608,142 and 6,177,
Those promoters disclosed in 611.
When selecting promoter to be used for the method for the present invention, it can be advantageous that adjusted using tissue-specific promoter or development
Save promoter.
Tissue-specific promoter or growth adjustment promoter are such DNA sequence dnas, adjust DNA sequence dna selectively
It is expressed in tassel being developed, being set seeds or both important plant cell/tissue, and limits this DNA sequence dna only in plant
It is expressed between tassel development or seed maturity.It is any cause required spatial and temporal expression to identify that promoter is used equally for of the invention
In method.
Promoter seed or embryo-specific and for use in the present invention includes Soybean Kunitz Trypsin enzyme inhibitor
(Kti3, Jofuku and Goldberg, Plant Cell 1:1079-1093 (1989)), patatin (potato tubers)
(Rocha-Sosa, M. et al., 1989, EMBOJ.8:23-29), convicilin, vicilin and legumin (pea
Leaf) Rerie, W.G. et al., 1991, Mol.Gen.Genet.259:149-157；Newbigin, E.J. et al., 1990,
Planta 180:461-470；Higgins, T.J.V. et al., 1988, Plant.Mol.Biol.11:683-695), corn egg
White (corn embryosperm) (Schemthaner, J.P. et al., 1988, EMBO J.7:1249-1255), Phaseolin (Kidney bean cotyledon)
(Segupta-Gopalan, C. et al., 1985, Proc.Natl.Acad.Sci.U.S.A.82:3320-3324), plant blood cell
Agglutinin (Kidney bean cotyledon) (Voelker, T. et al., 1987, EMBO J.6:3571-3577), B- are with globulin and soybean ball egg
White (soybean cotyledon) (Chen, Z-L et al., 1988, EMBOJ.7:297-302), glutelin (rice endosperm), hordein
(barley endosperm) (Marris, C. et al., 1988, Plant Mol.Biol.10:359-366), glutenin and gliadin
(wheat endosperm) (Colot, V. et al., 1987, EMBO J.6:3559-3564) and sweet potato storing albumen (sporamin) (sweet potato
Root tuber) (Hattori, T. et al., 1990, Plant Mol.Biol.14:595-604).It is operably coupled to mosaic gene structure
The promoter for the Seed-Specific Gene for building body heterologous coding regions keeps their spatial and temporal expression profile in transgenic plants.This
The embodiment of sample includes the Arabidopsis that enkephalins is expressed in arabidopsis and cabbage type rape (Brassica napus) seed
2S seed storage protein gene promoter (Vanderkerckhove et al., Bio/Technology7:L929-932 (1989)),
Phaseolus vulgaris agglutinin and β-phaseolin promoter (Riggs et al., PlantSci.63:47-57 of expressing luciferase
(1989)), and expression chloramphenicol acetyltransferase wheat gluten promoter (Colot et al., EMBOJ6:3559-3564
(1987))。
Inducible promoters respond the presence of endogenous or external source sexual stimulus, for example, by compound (chemical inducer),
Or in response to environment, hormone, chemical signal and/or development signal and selective expression can manipulate the DNA sequence dna of connection.It is derivable
Or modulated promoter includes (for example) light, heat, stress, waterlogging or arid, plant hormone, wound or such as ethyl alcohol, jasmine
The promoter of the chemicals regulation of jasmine keto ester, salicylic acid or safener etc.
Include following promoter for promoter of the invention: 1) stress induced RD29A promoter (Kasuga et al.,
1999, Nature Biotechnol.17:287-91)；2) barley promoter B22E；The expression of B22E is developmental Corn Seeds
Specific (" the Primary Structure of a Novel Barley Gene Differentially of handle in grain
Expressed inImmature Aleurone Layers (in prematurity aleurone the one of the new barley gene of differential expression
Level structure) ".Klemsdal, S.S. et al., Mol.Gen.Genet.228 (1/2): 9-16 (1991))；With 3) corn promoter,
Zag2 (" Identification and molecularcharacterization of ZAG1, the maize homolog
Of the Arabidopsis floralhomeotic gene AGAMOUS ", Schmidt, R.J. et al., Plant Cell 5
(7): 729-737 (1993)；" Structural characterization, chromosomal localizationand
phylogenetic evaluation of two pairs of AGAMOUS-like MADS-boxgenes from
Maize ", Theissen et al., (1995) Gene 156 (2): 155-166；NCBI GenBank accession number X80206)).Zag2
Transcript can be detected for 5 days before pollination for 7 to 8 days to (DAP) after pollination, and guide Ciml in developmental female inflorescence
It is expressed in carpel, Ciml is specific for the seed benevolence of developmental corn kernel.Ciml transcript is 4 to 5 before pollination
It is detected for 6 to 8 days to after pollinating.Other available promoters are maternal with developmental female little Hua including may originate from its expression
Any promoter of relevant gene.
For the polynucleotide expressed in development seed tissue, special promoter includes that seed preferably starts
Son, especially early stage seed/embryo promoter and advanced stage seed/endosperm promoter, the development of seed can substantially divide after pollination
Deadtime for three root phases, seed growth originates in after pollination 0 day Dao 10-12 days, and during this period, seed is no longer obvious
Growth, but determine seed vigor critical event (such as cell builds up number) will occur during this period.Linear kernel grouting
Phase 10-12 days originated in after pollination and 40 days or so be extended to after pollination.During Grain Development, seed reaches final
Quality, and generate a variety of reserve substances such as starch, protein and oil etc.；The final maturity period arrives for about 40 days after originating in pollination
It harvests, during this of Grain Development, seed starts suspend mode, dries out." early stage seed/endosperm promoter " in the present invention refers to
Mainly the starting of gene expression is driven in the deadtime of seed development (namely pollinating the 0th day after arriving pollination during the 12nd day)
Son；" later period seed/endosperm promoter " mainly driving gene is expressed in 12 days seeds into maturation after pollination；Expression
Window might have some overlappings, will be according to the sequence and desired Phenotypic Selection promoter of the ABA coupling used.
Early stage seed/embryo promoter includes Cim1, is active in specific organization (WO 00/ within the 5th day after pollination
11177)；Other early stage seed/embryo promoters include seed-preferred promoters end1, are expressed within 7-10 days after pollination, and
End2 is expressed for 9-14 days after pollination in whole kernel, expresses (WO00/12733) in endosperm and pericarp within 10 days after pollination.
Other early stage seed/endosperm promoters that ad hoc approach in the present invention uses include that (U.S. is special by seed-preferred promoters ltp2
Benefit number is 5,525,716)；Corn Zm40 promoter (U.S. Patent number 6,403,862)；Corn nuc1c (U.S. Patent number 6,407,
315)；Corn ckx1-2 promoter (U.S. Patent number 6,921,815 and U.S. Patent Application Publication No. 2006/0037103)；It is beautiful
Rice lec1 promoter (U.S. Patent number 7,122,658)；Corn ESR promoter (U.S. Patent number 7,276,596)；Corn ZAP
Promoter (U.S. Patent Application Publication No. 20040025206 and 20070136891)；(the United States Patent (USP) Shen corn promoter eep1
It please publication number 20070169226)；With (U.S. Patent Application No. August in 60/963,878,2007 Shen on the 7th corn promoter ADF4
Please).
Promoter can entirely be derived from natural gene, or the different elements by being derived from different naturally occurring promoters
Composition, or even include the DNA fragmentation of synthesis.
For promoter of the invention include: RIP2, mLIP15, ZmCOR1, Rab17, CaMV 35S, RD29A, B22E,
Zag2, SAM synzyme, ubiquitin, CaMV19S, no, Adh, sucrose synthase, R- allele, vascular tissue preferred promoter
S2A (Genbank accession number EF030816) and S2B (Genbank accession number EF030817) and from corn composing type starting
Sub- GOS2.Other promoters include the preferred promoter of root, such as corn NAS2 promoter, corn C yclo promoter (US
2006/0156439, be disclosed on July 13rd, 2006), (WO05063998 is disclosed in 2005 7 corn ROOTMET2 promoter
Months 14 days), CRlBIO promoter (WO06055487 is disclosed on May 26th, 2006), CRWAQ81 (WO05035770, it is open
On April 21st, 2005) and corn ZRP2.47 promoter (NCBI accession number: U38790；GI No.1063664).
Recombinant dna construct of the invention may also comprise other regulating and controlling sequences, including but not limited to translation leader sequence, interior
Sequence is identified containing son and polyadenylation.In another embodiment of the present invention, recombinant dna construct of the invention is also wrapped
Include enhancer or silencer.
Intron sequences can add to 5 ' non-translational regions, protein-coding region or 3 ' non-translational regions and be accumulated in endochylema with increasing
The amount of mature information.It has been shown that in the transcript unit of the expression construct of both plant and animals comprising can montage include
Son can make gene expression up to 1000 times of enhancing on mRNA and protein level.Referring to Buchman and Berg, Mol.Cell
Biol.8:4395-4405 (1988)；Callis et al., Genes Dev.1:1183-1200 (1987).
Enhancer or enhancer element refer to the transcriptional regulatory element of a cis acting, i.e. cis element, it is adjustable
The one aspect of polynucleotide sequence entirety expression pattern is controlled, but is typically not enough to that the multicore that transcription is operatively connected is operated alone
Nucleotide sequence.Isolated enhancer element can merge the promoter cis element that form one chimeric with a promoter, from
And adjust gene expression.Those skilled in the art knows that enhancer, enhancer include SV40 enhancer region, CaMV 35S
Enhancer element etc..Some enhancers also can change the expression pattern of common controlling element, for example, when there is no enhancer,
Lead to controlling element constitutive expression, when there are enhancer, same controlling element is in a certain specific organization or certain specific groups
Knit expression.CaMV 35S promoter repeat upstream region show about enhance 10 times expression quantity (Kay, R.et al.,
(1987) Science 236:1299-1302).
Enhancer used in the present invention includes that (Benfey, et al., (1990) EMBO is J.9:1685- by CaMV 35S
96), 4xB3P-CaMV.35 enhancer region-tetra- copy series connection the region B3 (208 to 155) (U.S. Patent number 5,097,025),
The copy series connection of 4xAS-1P-CaMV 35S enhancer region-four activation sequence (83 to 62) (U.S. Patent number 5,097,025),
The 2xB1-B2P-CaMV 35S enhancer region-bis- copy series connection region B1-B2 (148 to 90) (U.S. Patent number 5,097,
025), 2xA1-B3P-CaMV 35S enhancer region-bis- copy series connection the region A1-B3 (208 to 46) (U.S. Patent number 5,
097,025), 2xB1-B5P-CaMV 35S enhancer region-bis- copy the region B1-B5 (343 to 90) (U.S. Patent number 5,
097,025), omega enhancer or the basic enhancer of omega (Gallie etc. (1989) Molecular Biology of
RNA ed.Cech (Liss, New York) 237-256 and Gallie etc. (1987) Gene 60:217-25), U.S. Patent number 7,
803,992 enhancer and sugarcane rhabdovirus (SCBV) enhancer element (WO2013130813).
Any plant, which may be selected to identify, will be used for the regulating and controlling sequence and gene of recombinant dna construct of the present invention.
Suitable for un-mixing bases because and the example of target plant of regulating and controlling sequence should include but is not limited to clover, apple, apricot, arabidopsis, ocean
Ji, asparagus, avocado, banana, barley, beans, beet, blackberry, blueberry, blueberry, broccoli, brussels sprout, cabbage, adds and takes rocket salad
Big rape, muskmelon, carrot, cassava, castor bean, cauliflower, celery, cherry, witloof, coriander, citrus, the small citrus of Ke Laimenshi, three
It is leaf grass, coconut, coffee, corn, cotton, Cranberry, cucumber, pesudotsuga taxifolia, eggplant, witloof, thatch dish, eucalyptus, fennel, fig, big
Garlic, cucurbit, grape, grapefruit, honey dew melon, yam bean, Kiwi berry, romaine lettuce, leek, lemon, bitter orange, torch pine, linseed, awns
Fruit, muskmelon, mushroom, nectarine, nut, oat, oil palm, rape, gumbo, Chinese olive tree, onion, orange, ornamental plant, palm, pawpaw
Tree, parsley, parsnip, pea, peach, peanut, pear tree, pepper, persimmon, pine tree, pineapple, Asiatic plantain, Japanese plum, pomegranate
It is tree, white poplar, potato, pumpkin, quince, pine, red witloof, radish, rape, raspberry, rice, rye, sorghum, Southern Pine, big
Beans, spinach, pumpkin, strawberry, beet, sugarcane, sunflower, sweet potato, Chinese sweet gum, citrus, tea, tobacco, tomato, triticale, turf
Grass, turnip, vine, watermelon, wheat, Chinese yam and cucurbita pepo.
Composition:
Composition of the invention is (to be begged for above such as in its genome comprising any recombinant dna construct of the invention
Opinion any construct) plant.Composition also includes the filial generation of any plant, and is obtained from plant or its filial generation
Any seed, wherein the filial generation or seed include recombinant dna construct in its genome.Filial generation include by plant from
The successive generation spending pollination or cutcross and obtaining.Filial generation also includes cenospecies and self-mating system.
In the crops of hybrid seed breeding, mature genetically modified plants can self-pollination and generate homozygous self-mating system
Plant.The self-mating system plant generates the seed containing the recombinant dna construct newly imported.These seeds can grow and generate will
The plant of the agronomy attribute changed is shown, or can be used for the procedure of breeding to generate hybrid seed, these hybrid seeds can give birth to
Long and generation will show the plant of the agronomy attribute such as change.The seed can be corn seed or rice paddy seed.
Plant can be monocotyledon or dicotyledon, such as corn or bean plant, such as corn hybrid plant or jade
Rice self-mating system plant.Plant can also be sunflower, jowar, rape, wheat, clover, cotton, rice, barley or broomcorn millet.
Recombinant dna construct can be steadily integrated into the genome of plant.
Embodiment includes but is not limited to following embodiments:
1. including the plant (such as rice, corn or bean plant) of recombinant dna construct, the recombination in genome
DNA construct includes the polynucleotides for being operably coupled to less a kind of heterologous regulatory sequence, wherein the polynucleotide encoding
Polypeptide, the amino acid sequence of the polypeptide when being compared with SEQ ID NO:6,9 or 12 have at least 50%, 51%,
52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%,
67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%,
82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, 99% or 100% sequence identity, and wherein the plant with do not include the recombinant dna construct
Check plant show increased insect pest when being compared.
2. the genetically modified plants of embodiment 1, wherein polynucleotide encoding D N-ITP3, DN-ITP4 or DN-ITP5 are more
Peptide, N-ITP3, DN-ITP4 or DN-ITP5 polypeptide may be from rice (Oryza sativa), wild rice (Oryza
Australiensis), short tongue wild rice (Oryza barthii), African type rice (Oryza glaberrima), broad-leaved rice
(Oryza latifolia), long male wild rice (Oryza longistaminata), southern wild rice (Oryza
Meridionalis), oryza officinalis (Oryza officinalis), Oryza punctata (Oryza punctata), common open country
Raw rice (Oryza rufipogon) (red rice), India's wild rice (Oryza nivara), arabidopsis (Arabidopsis
Thaliana), chick-pea (Cicer arietinum), potato (Solanum tuberosum), wild cabbage (Brassica
Oleracea), corn (Zea mays), soybean (Glycine max), cigarette beans (Glycine tabacina), Wild soybean
(Glycine soja) and glycine tomentella (Glycine tomentella).
3. any genetically modified plants in embodiment 1 or 2, wherein the genetically modified plants further include that at least one coding kills
The polynucleotides of worm polypeptide.
4. any genetically modified plants in embodiment 1 or 2, wherein the genetically modified plants further include that at least one coding closes
The recombination of polynucleotide of the polypeptide of note
5. the filial generation of any plant described in embodiment 1-4, the seed of any plant described in embodiment 1-4 is real
The seed of any Progeny plants described in scheme 1-4 is applied, and from any plant and the Progeny plants in embodiment 1-4
Cell.
In any one in foregoing embodiments 1-5 or other embodiments disclosed by the invention, recombinant dna construct
It further include at least one heterologous promoter functional in plant as regulating and controlling sequence.
" insecticidal proteins " used herein refer to a kind of polypeptide or its homologous protein to the toxic effect of one or more pests,
The pest includes but is not limited to, Lepidoptera (Lepidoptera), Diptera (Diptera), Semiptera (Hemiptera) and
Coleoptera (Coleoptera) member or Nemathelminthes (Nematoda phylum).Insecticidal proteins are isolated from organism,
For example, bacillus (Bacillus sp.), pseudomonas (Pseudomonas sp.), Photobacterium
(Photorhabdus sp.), Xenorhabdus (Xenorhabdus sp.) Clostridium bifermentans category (Clostridium
) and Bacillus popilliae category (Paenibacillus popilliae) bifermentans.Insecticidal proteins include but not
It is limited to the insecticidal proteins from pseudomonas (Pseudomonas sp.), such as PSEEN3174 (Monalysin；(2011)
PLoS Pathogens 7:1-13), be derived from pseudomonas (Pseudomonas protegens) bacterial strain CHA0 and Pf-5
Insecticidal proteins (Pechy-Tarr, (2008) Environmental of (previously fluorescens)
Microbiology 10:2368-2386；GenBank accession number EU400157), be derived from Mount Huang pseudomonad (Pseudomonas
Taiwanensis insecticidal proteins (Liu et al. (2010) J.Agric.Food Chem., 58:12343-12349)) and derived from vacation
Insecticidal proteins (Zhang etc. (2009) Annals of of unit cell Alcaligenes (Pseudomonas pseudoalcligenes)
Microbiology 59:45-50and Li et al. (2007) Plant Cell Tiss.Organ Cult.89:159-168)；Come
Derived from the insecticidal proteins of Photobacterium (Photorhabdus sp.) and Xenorhabdus (Xenorhabdus sp.)
(Hinchliffe etc. (2010) The Open Toxicology Journal, 3:101-118and Morgan, waits (2001)
Applied and Envir.Micro.67:2062-2069)；U.S. Patent number 6,048,838 and U.S. Patent number 6,379,
The PIP-1 polypeptide of 946, US publication US2014008054, the AfIP-1A and/or AfIP- of U.S. serial 13/800233
1B polypeptide, the PHI-4 polypeptide and delta-endotoxin of U.S. serial 13/839702.The delta-endotoxin includes but is not limited to that δ-is interior
Cry1, Cry2 of toxin gene, Cry3, Cry4, Cry5, Cry6, Cry7, Cry8, Cry9, Cry10, Cry11, Cry12,
Cry13、Cry14、Cry15、Cry16、Cry17、Cry18、Cry19、Cry20、Cry21、Cry22、Cry23、Cry24、
Cry25、Cry26、Cry27、Cry 28、Cry 29、Cry 30、Cry31、Cry32、Cry33、Cry34、Cry35、Cry36、
Cry37、Cry38、Cry39、Cry40、Cry41、Cry42、Cry43、Cry44、Cry45、Cry 46、Cry47、Cry49、Cry
51、Cry55、Cry56、Cry57、Cry58、Cry59、Cry60、Cry61、Cry62、Cry63、Cry64、Cry65、Cry66、
Cry67, Cry68, Cry69, Cry70, Cry71 and Cry72 class and bacillus thuringiensis (B.thuringiensis) cell
Cyt1 the and cyt2 gene of dissolution.The member of B. thuringiensis insecticidal albumen includes, but are not limited to Cry1Aa1 (accession number
AAA22353), Cry1Aa2 (accession number AAA22552), Cry1Aa3 (accession number BAA00257), Cry1Aa4 (accession number
CAA31886), Cry1Aa5 (accession number BAA04468), Cry1Aa6 (accession number AAA86265), Cry1Aa7 (accession number
AAD46139), Cry1Aa8 (accession number I26149), Cry1Aa9 (accession number BAA77213), Cry1Aa10 (accession number
AAD55382), Cry1Aa11 (accession number CAA70856), Cry1Aa12 (accession number AAP80146), Cry1Aa13 (accession number
AAM44305), Cry1Aa14 (accession number AAP40639), Cry1Aa15 (accession number AAY66993), Cry1Aa16 (accession number
HQ439776), Cry1Aa17 (accession number HQ439788), Cry1Aa18 (accession number HQ439790), Cry1Aa19 (accession number
HQ685121), Cry1Aa20 (accession number JF340156), Cry1Aa21 (accession number JN651496), Cry1Aa22 (accession number
KC158223), Cry1Ab1 (accession number AAA22330), Cry1Ab2 (accession number AAA22613), Cry1Ab3 (accession number
AAA22561), Cry1Ab4 (accession number BAA00071), Cry1Ab5 (accession number CAA28405), Cry1Ab6 (accession number
AAA22420), Cry1Ab7 (accession number CAA31620), Cry1Ab8 (accession number AAA22551), Cry1Ab9 (accession number
CAA38701), Cry1Ab10 (accession number A29125), Cry1Ab11 (accession number I12419), Cry1Ab12 (accession number
AAC64003), Cry1Ab13 (accession number AAN76494), Cry1Ab14 (accession number AAG16877), Cry1Ab15 (accession number
AAO13302), Cry1Ab16 (accession number AAK55546), Cry1Ab17 (accession number AAT46415), Cry1Ab18 (accession number
AAQ88259), Cry1Ab19 (accession number AAW31761), Cry1Ab20 (accession number ABB72460), Cry1Ab21 (accession number
ABS18384), Cry1Ab22 (accession number ABW87320), Cry1Ab23 (accession number HQ439777), Cry1Ab24 (accession number
HQ439778), Cry1Ab25 (accession number HQ685122), Cry1Ab26 (accession number HQ847729), Cry1Ab27 (accession number
JN135249), Cry1Ab28 (accession number JN135250), Cry1Ab29 (accession number JN135251), Cry1Ab30 (accession number
JN135252), Cry1Ab31 (accession number JN135253), Cry1Ab32 (accession number JN135254), Cry1Ab33 (accession number
AAS93798), Cry1Ab34 (accession number KC156668), Cry1Ab-like (accession number AAK14336), Cry1Ab-like (are stepped on
Record AAK14337), Cry1Ab-like (accession number AAK14338), Cry1Ab-like (accession number ABG88858), Cry1Ac1
(accession number AAA22331), Cry1Ac2 (accession number AAA22338), Cry1Ac3 (accession number CAA38098), Cry1Ac4 (are logged in
Number AAA73077), Cry1Ac5 (accession number AAA22339), Cry1Ac6 (accession number AAA86266), Cry1Ac7 (accession number
AAB46989), Cry1Ac8 (accession number AAC44841), Cry1Ac9 (accession number AAB49768), Cry1Ac10 (accession number
CAA05505), Cry1Ac11 (accession number CAA10270), Cry1Ac12 (accession number I12418), Cry1Ac13 (accession number
AAD38701), Cry1Ac14 (accession number AAQ06607), Cry1Ac15 (accession number AAN07788), Cry1Ac16 (accession number
AAU87037), Cry1Ac17 (accession number AAX18704), Cry1Ac18 (accession number AAY88347), Cry1Ac19 (accession number
ABD37053), Cry1Ac20 (accession number ABB89046), Cry1Ac21 (accession number AAY66992), Cry1Ac22 (accession number
ABZ01836), Cry1Ac23 (accession number CAQ30431), Cry1Ac24 (accession number ABL01535), Cry1Ac25 (accession number
FJ513324), Cry1Ac26 (accession number FJ617446), Cry1Ac27 (accession number FJ617447), Cry1Ac28 (accession number
ACM90319), Cry1Ac29 (accession number DQ438941), Cry1Ac30 (accession number GQ227507), Cry1Ac31 (accession number
GU446674), Cry1Ac32 (accession number HM061081), Cry1Ac33 (accession number GQ866913), Cry1Ac34 (accession number
HQ230364), Cry1Ac35 (accession number JF340157), Cry1Ac36 (accession number JN387137), Cry1Ac37 (accession number
JQ317685), Cry1Ad1 (accession number AAA22340), Cry1Ad2 (accession number CAA01880), Cry1Ae1 (accession number
AAA22410), Cry1Af1 (accession number AAB82749), Cry1Ag1 (accession number AAD46137), Cry1Ah1 (accession number
AAQ14326), Cry1Ah2 (accession number ABB76664), Cry1Ah3 (accession number HQ439779), Cry1Ai1 (accession number
AAO39719), Cry1Ai2 (accession number HQ439780), Cry1A-like (accession number AAK14339), Cry1Ba1 (accession number
CAA29898), Cry1Ba2 (accession number CAA65003), Cry1Ba3 (accession number AAK63251), Cry1Ba4 (accession number
AAK51084), Cry1Ba5 (accession number ABO20894), Cry1Ba6 (accession number ABL60921), Cry1Ba7 (accession number
HQ439781), Cry1Bb1 (accession number AAA22344), Cry1Bb2 (accession number HQ439782), Cry1Bc1 (accession number
CAA86568), Cry1Bd1 (accession number AAD10292), Cry1Bd2 (accession number AAM93496), Cry1Be1 (accession number
AAC32850), Cry1Be2 (accession number AAQ52387), Cry1Be3 (accession number ACV96720), Cry1Be4 (accession number
HM070026), Cry1Bf1 (accession number CAC50778), Cry1Bf2 (accession number AAQ52380), Cry1Bg1 (accession number
AAO39720), Cry1Bh1 (accession number HQ589331), Cry1Bi1 (accession number KC156700), Cry1Ca1 (accession number
CAA30396), Cry1Ca2 (accession number CAA31951), Cry1Ca3 (accession number AAA22343), Cry1Ca4 (accession number
CAA01886), Cry1Ca5 (accession number CAA65457), Cry1Ca6 [1] (accession number AAF37224), Cry1Ca7 (accession number
AAG50438), Cry1Ca8 (accession number AAM00264), Cry1Ca9 (accession number AAL79362), Cry1Ca10 (accession number
AAN16462), Cry1Ca11 (accession number AAX53094), Cry1Ca12 (accession number HM070027), Cry1Ca13 (accession number
HQ412621), Cry1Ca14 (accession number JN651493), Cry1Cb1 (accession number M97880), Cry1Cb2 (accession number
AAG35409), Cry1Cb3 (accession number ACD50894), Cry1Cb-like (accession number AAX63901), Cry1Da1 (accession number
CAA38099), Cry1Da2 (accession number I76415), Cry1Da3 (accession number HQ439784), Cry1Db1 (accession number
CAA80234), Cry1Db2 (accession number AAK48937), Cry1Dc1 (accession number ABK35074), Cry1Ea1 (accession number
CAA37933), Cry1Ea2 (accession number CAA39609), Cry1Ea3 (accession number AAA22345), Cry1Ea4 (accession number
AAD04732), Cry1Ea5 (accession number A15535), Cry1Ea6 (accession number AAL50330), Cry1Ea7 (accession number
AAW72936), Cry1Ea8 (accession number ABX11258), Cry1Ea9 (accession number HQ439785), Cry1Ea10 (accession number
ADR00398), Cry1Ea11 (accession number JQ652456), Cry1Eb1 (accession number AAA22346), Cry1Fa1 (accession number
AAA22348), Cry1Fa2 (accession number AAA22347), Cry1Fa3 (accession number HM070028), Cry1Fa4 (accession number
HM439638), Cry1Fb1 (accession number CAA80235), Cry1Fb2 (accession number BAA25298), Cry1Fb3 (accession number
AAF21767), Cry1Fb4 (accession number AAC10641), Cry1Fb5 (accession number AAO13295), Cry1Fb6 (accession number
ACD50892), Cry1Fb7 (accession number ACD50893), Cry1Ga1 (accession number CAA80233), Cry1Ga2 (accession number
CAA70506), Cry1Gb1 (accession number AAD10291), Cry1Gb2 (accession number AAO13756), Cry1Gc1 (accession number
AAQ52381), Cry1Ha1 (accession number CAA80236), Cry1Hb1 (accession number AAA79694), Cry1Hb2 (accession number
HQ439786), Cry1H-like (accession number AAF01213), Cry1Ia1 (accession number CAA44633), Cry1Ia2 (accession number
AAA22354), Cry1Ia3 (accession number AAC36999), Cry1Ia4 (accession number AAB00958), Cry1Ia5 (accession number
CAA70124), Cry1Ia6 (accession number AAC26910), Cry1Ia7 (accession number AAM73516), Cry1Ia8 (accession number
AAK66742), Cry1Ia9 (accession number AAQ08616), Cry1Ia10 (accession number AAP86782), Cry1Ia11 (accession number
CAC85964), Cry1Ia12 (accession number AAV53390), Cry1Ia13 (accession number ABF83202), Cry1Ia14 (accession number
ACG63871), Cry1Ia15 (accession number FJ617445), Cry1Ia16 (accession number FJ617448), Cry1Ia17 (accession number
GU989199), Cry1Ia18 (accession number ADK23801), Cry1Ia19 (accession number HQ439787), Cry1Ia20 (accession number
JQ228426), Cry1Ia21 (accession number JQ228424), Cry1Ia22 (accession number JQ228427), Cry1Ia23 (accession number
JQ228428), Cry1Ia24 (accession number JQ228429), Cry1Ia25 (accession number JQ228430), Cry1Ia26 (accession number
JQ228431), Cry1Ia27 (accession number JQ228432), Cry1Ia28 (accession number JQ228433), Cry1Ia29 (accession number
JQ228434), Cry1Ia30 (accession number JQ317686), Cry1Ia31 (accession number JX944038), Cry1Ia32 (accession number
JX944039), Cry1Ia33 (accession number JX944040), Cry1Ib1 (accession number AAA82114), Cry1Ib2 (accession number
ABW88019), Cry1Ib3 (accession number ACD75515), Cry1Ib4 (accession number HM051227), Cry1Ib5 (accession number
HM070028), Cry1Ib6 (accession number ADK38579), Cry1Ib7 (accession number JN571740), Cry1Ib8 (accession number
JN675714), Cry1Ib9 (accession number JN675715), Cry1Ib10 (accession number JN675716), Cry1Ib11 (accession number
JQ228423), Cry1Ic1 (accession number AAC62933), Cry1Ic2 (accession number AAE71691), Cry1Id1 (accession number
AAD44366), Cry1Id2 (accession number JQ228422), Cry1Ie1 (accession number AAG43526), Cry1Ie2 (accession number
HM439636), Cry1Ie3 (accession number KC156647), Cry1Ie4 (accession number KC156681), Cry1If1 (accession number
AAQ52382), Cry1Ig1 (accession number KC156701), Cry1I-like (accession number AAC31094), Cry1I-like (are logged in
Number ABG88859), Cry1Ja1 (accession number AAA22341), Cry1Ja2 (accession number HM070030), Cry1Ja3 (accession number
JQ228425), Cry1Jb1 (accession number AAA98959), Cry1Jc1 (accession number AAC31092), Cry1Jc2 (accession number
AAQ52372), Cry1Jd1 (accession number CAC50779), Cry1Ka1 (accession number AAB00376), Cry1Ka2 (accession number
HQ439783), Cry1La1 (accession number AAS60191), Cry1La2 (accession number HM070031), Cry1Ma1 (accession number
FJ884067), Cry1Ma2 (accession number KC156659), Cry1Na1 (accession number KC156648), Cry1Nb1 (accession number
KC156678), Cry1-like (accession number AAC31091), Cry2Aa1 (accession number AAA22335), Cry2Aa2 (accession number
AAA83516), Cry2Aa3 (accession number D86064), Cry2Aa4 (accession number AAC04867), Cry2Aa5 (accession number
CAA10671), Cry2Aa6 (accession number CAA10672), Cry2Aa7 (accession number CAA10670), Cry2Aa8 (accession number
AAO13734), Cry2Aa9 (accession number AAO13750), Cry2Aa10 (accession number AAQ04263), Cry2Aa11 (accession number
AAQ52384), Cry2Aa12 (accession number ABI83671), Cry2Aa13 (accession number ABL01536), Cry2Aa14 (accession number
ACF04939), Cry2Aa15 (accession number JN426947), Cry2Ab1 (accession number AAA22342), Cry2Ab2 (accession number
CAA39075), Cry2Ab3 (accession number AAG36762), Cry2Ab4 (accession number AAO13296), Cry2Ab5 (accession number
AAQ04609), Cry2Ab6 (accession number AAP59457), Cry2Ab7 (accession number AAZ66347), Cry2Ab8 (accession number
ABC95996), Cry2Ab9 (accession number ABC74968), Cry2Ab10 (accession number EF157306), Cry2Ab11 (accession number
CAM84575), Cry2Ab12 (accession number ABM21764), Cry2Ab13 (accession number ACG76120), Cry2Ab14 (accession number
ACG76121), Cry2Ab15 (accession number HM037126), Cry2Ab16 (accession number GQ866914), Cry2Ab17 (accession number
HQ439789), Cry2Ab18 (accession number JN135255), Cry2Ab19 (accession number JN135256), Cry2Ab20 (accession number
JN135257), Cry2Ab21 (accession number JN135258), Cry2Ab22 (accession number JN135259), Cry2Ab23 (accession number
JN135260), Cry2Ab24 (accession number JN135261), Cry2Ab25 (accession number JN415485), Cry2Ab26 (accession number
JN426946), Cry2Ab27 (accession number JN415764), Cry2Ab28 (accession number JN651494), Cry2Ac1 (accession number
CAA40536), Cry2Ac2 (accession number AAG35410), Cry2Ac3 (accession number AAQ52385), Cry2Ac4 (accession number
ABC95997), Cry2Ac5 (accession number ABC74969), Cry2Ac6 (accession number ABC74793), Cry2Ac7 (accession number
CAL18690), Cry2Ac8 (accession number CAM09325), Cry2Ac9 (accession number CAM09326), Cry2Ac10 (accession number
ABN15104), Cry2Ac11 (accession number CAM83895), Cry2Ac12 (accession number CAM83896), Cry2Ad1 (accession number
AAF09583), Cry2Ad2 (accession number ABC86927), Cry2Ad3 (accession number CAK29504), Cry2Ad4 (accession number
CAM32331), Cry2Ad5 (accession number CAO78739), Cry2Ae1 (accession number AAQ52362), Cry2Af1 (accession number
ABO30519), Cry2Af2 (accession number GQ866915), Cry2Ag1 (accession number ACH91610), Cry2Ah1 (accession number
EU939453), Cry2Ah2 (accession number ACL80665), Cry2Ah3 (accession number GU073380), Cry2Ah4 (accession number
KC156702), Cry2Ai1 (accession number FJ788388), Cry2Aj (accession number), Cry2Ak1 (accession number KC156660),
Cry2Ba1 (accession number KC156658), Cry3Aa1 (accession number AAA22336), Cry3Aa2 (accession number AAA22541),
Cry3Aa3 (accession number CAA68482), Cry3Aa4 (accession number AAA22542), Cry3Aa5 (accession number AAA50255),
Cry3Aa6 (accession number AAC43266), Cry3Aa7 (accession number CAB41411), Cry3Aa8 (accession number AAS79487),
Cry3Aa9 (accession number AAW05659), Cry3Aa10 (accession number AAU29411), Cry3Aa11 (accession number AAW82872),
Cry3Aa12 (accession number ABY49136), Cry3Ba1 (accession number CAA34983), Cry3Ba2 (accession number CAA00645),
Cry3Ba3 (accession number JQ397327), Cry3Bb1 (accession number AAA22334), Cry3Bb2 (accession number AAA74198),
Cry3Bb3 (accession number I15475), Cry3Ca1 (accession number CAA42469), Cry4Aa1 (accession number CAA68485), Cry4Aa2
(accession number BAA00179), Cry4Aa3 (accession number CAD30148), Cry4Aa4 (accession number AFB18317), Cry4A-like
(accession number AAY96321), Cry4Ba1 (accession number CAA30312), Cry4Ba2 (accession number CAA30114), Cry4Ba3 (are logged in
Number AAA22337), Cry4Ba4 (accession number BAA00178), Cry4Ba5 (accession number CAD30095), Cry4Ba-like (log in
Number ABC47686), Cry4Ca1 (accession number EU646202), Cry4Cb1 (accession number FJ403208), Cry4Cb2 (accession number
FJ597622), Cry4Cc1 (accession number FJ403207), Cry5Aa1 (accession number AAA67694), Cry5Ab1 (accession number
AAA67693), Cry5Ac1 (accession number I34543), Cry5Ad1 (accession number ABQ82087), Cry5Ba1 (accession number
AAA68598), Cry5Ba2 (accession number ABW88931), Cry5Ba3 (accession number AFJ04417), Cry5Ca1 (accession number
HM461869), Cry5Ca2 (accession number ZP_04123426), Cry5Da1 (accession number HM461870), Cry5Da2 (accession number
ZP_04123980), Cry5Ea1 (accession number HM485580), Cry5Ea2 (accession number ZP_04124038), Cry6Aa1 (are logged in
Number AAA22357), Cry6Aa2 (accession number AAM46849), Cry6Aa3 (accession number ABH03377), Cry6Ba1 (accession number
AAA22358), Cry7Aa1 (accession number AAA22351), Cry7Ab1 (accession number AAA21120), Cry7Ab2 (accession number
AAA21121), Cry7Ab3 (accession number ABX24522), Cry7Ab4 (accession number EU380678), Cry7Ab5 (accession number
ABX79555), Cry7Ab6 (accession number ACI44005), Cry7Ab7 (accession number ADB89216), Cry7Ab8 (accession number
GU145299), Cry7Ab9 (accession number ADD92572), Cry7Ba1 (accession number ABB70817), Cry7Bb1 (accession number
KC156653), Cry7Ca1 (accession number ABR67863), Cry7Cb1 (accession number KC156698), Cry7Da1 (accession number
ACQ99547), Cry7Da2 (accession number HM572236), Cry7Da3 (accession number KC156679), Cry7Ea1 (accession number
HM035086), Cry7Ea2 (accession number HM132124), Cry7Ea3 (accession number EEM19403), Cry7Fa1 (accession number
HM035088), Cry7Fa2 (accession number EEM19090), Cry7Fb1 (accession number HM572235), Cry7Fb2 (accession number
KC156682), Cry7Ga1 (accession number HM572237), Cry7Ga2 (accession number KC156669), Cry7Gb1 (accession number
KC156650), Cry7Gc1 (accession number KC156654), Cry7Gd1 (accession number KC156697), Cry7Ha1 (accession number
KC156651), Cry7Ia1 (accession number KC156665), Cry7Ja1 (accession number KC156671), Cry7Ka1 (accession number
KC156680), Cry7Kb1 (accession number BAM99306), Cry7La1 (accession number BAM99307), Cry8Aa1 (accession number
AAA21117), Cry8Ab1 (accession number EU044830), Cry8Ac1 (accession number KC156662), Cry8Ad1 (accession number
KC156684), Cry8Ba1 (accession number AAA21118), Cry8Bb1 (accession number CAD57542), Cry8Bc1 (accession number
CAD57543), Cry8Ca1 (accession number AAA21119), Cry8Ca2 (accession number AAR98783), Cry8Ca3 (accession number
EU625349), Cry8Ca4 (accession number ADB54826), Cry8Da1 (accession number BAC07226), Cry8Da2 (accession number
BD133574), Cry8Da3 (accession number BD133575), Cry8Db1 (accession number BAF93483), Cry8Ea1 (accession number
AAQ73470), Cry8Ea2 (accession number EU047597), Cry8Ea3 (accession number KC855216), Cry8Fa1 (accession number
AAT48690), Cry8Fa2 (accession number HQ174208), Cry8Fa3 (accession number AFH78109), Cry8Ga1 (accession number
AAT46073), Cry8Ga2 (accession number ABC42043), Cry8Ga3 (accession number FJ198072), Cry8Ha1 (accession number
AAW81032), Cry8Ia1 (accession number EU381044), Cry8Ia2 (accession number GU073381), Cry8Ia3 (accession number
HM044664), Cry8Ia4 (accession number KC156674), Cry8Ib1 (accession number GU325772), Cry8Ib2 (accession number
KC156677), Cry8Ja1 (accession number EU625348), Cry8Ka1 (accession number FJ422558), Cry8Ka2 (accession number
ACN87262), Cry8Kb1 (accession number HM123758), Cry8Kb2 (accession number KC156675), Cry8La1 (accession number
GU325771), Cry8Ma1 (accession number HM044665), Cry8Ma2 (accession number EEM86551), Cry8Ma3 (accession number
HM210574), Cry8Na1 (accession number HM640939), Cry8Pa1 (accession number HQ388415), Cry8Qa1 (accession number
HQ441166), Cry8Qa2 (accession number KC152468), Cry8Ra1 (accession number AFP87548), Cry8Sa1 (accession number
JQ740599), Cry8Ta1 (accession number KC156673), Cry8-like (accession number FJ770571), Cry8-like (accession number
ABS53003), Cry9Aa1 (accession number CAA41122), Cry9Aa2 (accession number CAA41425), Cry9Aa3 (accession number
GQ249293), Cry9Aa4 (accession number GQ249294), Cry9Aa5 (accession number JX174110), Cry9Aa like (accession number
AAQ52376), Cry9Ba1 (accession number CAA52927), Cry9Ba2 (accession number GU299522), Cry9Bb1 (accession number
AAV28716), Cry9Ca1 (accession number CAA85764), Cry9Ca2 (accession number AAQ52375), Cry9Da1 (accession number
BAA19948), Cry9Da2 (accession number AAB97923), Cry9Da3 (accession number GQ249293), Cry9Da4 (accession number
GQ249297), Cry9Db1 (accession number AAX78439), Cry9Dc1 (accession number KC156683), Cry9Ea1 (accession number
BAA34908), Cry9Ea2 (accession number AAO12908), Cry9Ea3 (accession number ABM21765), Cry9Ea4 (accession number
ACE88267), Cry9Ea5 (accession number ACF04743), Cry9Ea6 (accession number ACG63872), Cry9Ea7 (accession number
FJ380927), Cry9Ea8 (accession number GQ249292), Cry9Ea9 (accession number JN651495), Cry9Eb1 (accession number
CAC50780), Cry9Eb2 (accession number GQ249298), Cry9Eb3 (accession number KC156646), Cry9Ec1 (accession number
AAC63366), Cry9Ed1 (accession number AAX78440), Cry9Ee1 (accession number GQ249296), Cry9Ee2 (accession number
KC156664), Cry9Fa1 (accession number KC156692), Cry9Ga1 (accession number KC156699), Cry9-like (accession number
AAC63366), Cry10Aa1 (accession number AAA22614), Cry10Aa2 (accession number E00614), Cry10Aa3 (accession number
CAD30098), Cry10Aa4 (accession number AFB18318), Cry10A-like (accession number DQ167578), Cry11Aa1 (are logged in
Number AAA22352), Cry11Aa2 (accession number AAA22611), Cry11Aa3 (accession number CAD30081), Cry11Aa4 (accession number
AFB18319), Cry11Aa-like (accession number DQ166531), Cry11Ba1 (accession number CAA60504), Cry11Bb1 (are logged in
Number AAC97162), Cry11Bb2 (accession number HM068615), Cry12Aa1 (accession number AAA22355), Cry13Aa1 (accession number
AAA22356), Cry14Aa1 (accession number AAA21516), Cry14Ab1 (accession number KC156652), Cry15Aa1 (accession number
AAA22333), Cry16Aa1 (accession number CAA63860), Cry17Aa1 (accession number CAA67841), Cry18Aa1 (accession number
CAA67506), Cry18Ba1 (accession number AAF89667), Cry18Ca1 (accession number AAF89668), Cry19Aa1 (accession number
CAA68875), Cry19Ba1 (accession number BAA32397), Cry19Ca1 (accession number AFM37572), Cry20Aa1 (accession number
AAB93476), Cry20Ba1 (accession number ACS93601), Cry20Ba2 (accession number KC156694), Cry20-like (accession number
GQ144333), Cry21Aa1 (accession number I32932), Cry21Aa2 (accession number I66477), Cry21Ba1 (accession number
BAC06484), Cry21Ca1 (accession number JF521577), Cry21Ca2 (accession number KC156687), Cry21Da1 (accession number
JF521578), Cry22Aa1 (accession number I34547), Cry22Aa2 (accession number CAD43579), Cry22Aa3 (accession number
ACD93211), Cry22Ab1 (accession number AAK50456), Cry22Ab2 (accession number CAD43577), Cry22Ba1 (accession number
CAD43578), Cry22Bb1 (accession number KC156672), Cry23Aa1 (accession number AAF76375), Cry24Aa1 (accession number
AAC61891), Cry24Ba1 (accession number BAD32657), Cry24Ca1 (accession number CAJ43600), Cry25Aa1 (accession number
AAC61892), Cry26Aa1 (accession number AAD25075), Cry27Aa1 (accession number BAA82796), Cry28Aa1 (accession number
AAD24189), Cry28Aa2 (accession number AAG00235), Cry29Aa1 (accession number CAC80985), Cry30Aa1 (accession number
CAC80986), Cry30Ba1 (accession number BAD00052), Cry30Ca1 (accession number BAD67157), Cry30Ca2 (accession number
ACU24781), Cry30Da1 (accession number EF095955), Cry30Db1 (accession number BAE80088), Cry30Ea1 (accession number
ACC95445), Cry30Ea2 (accession number FJ499389), Cry30Fa1 (accession number ACI22625), Cry30Ga1 (accession number
ACG60020), Cry30Ga2 (accession number HQ638217), Cry31Aa1 (accession number BAB11757), Cry31Aa2 (accession number
AAL87458), Cry31Aa3 (accession number BAE79808), Cry31Aa4 (accession number BAF32571), Cry31Aa5 (accession number
BAF32572), Cry31Aa6 (accession number BAI44026), Cry31Ab1 (accession number BAE79809), Cry31Ab2 (accession number
BAF32570), Cry31Ac1 (accession number BAF34368), Cry31Ac2 (accession number AB731600), Cry31Ad1 (accession number
BAI44022), Cry32Aa1 (accession number AAG36711), Cry32Aa2 (accession number GU063849), Cry32Ab1 (accession number
GU063850), Cry32Ba1 (accession number BAB78601), Cry32Ca1 (accession number BAB78602), Cry32Cb1 (accession number
KC156708), Cry32Da1 (accession number BAB78603), Cry32Ea1 (accession number GU324274), Cry32Ea2 (accession number
KC156686), Cry32Eb1 (accession number KC156663), Cry32Fa1 (accession number KC156656), Cry32Ga1 (accession number
KC156657), Cry32Ha1 (accession number KC156661), Cry32Hb1 (accession number KC156666), Cry32Ia1 (accession number
KC156667), Cry32Ja1 (accession number KC156685), Cry32Ka1 (accession number KC156688), Cry32La1 (accession number
KC156689), Cry32Ma1 (accession number KC156690), Cry32Mb1 (accession number KC156704), Cry32Na1 (accession number
KC156691), Cry32Oa1 (accession number KC156703), Cry32Pa1 (accession number KC156705), Cry32Qa1 (accession number
KC156706), Cry32Ra1 (accession number KC156707), Cry32Sa1 (accession number KC156709), Cry32Ta1 (accession number
KC156710), Cry32Ua1 (accession number KC156655), Cry33Aa1 (accession number AAL26871), Cry34Aa1 (accession number
AAG50341), Cry34Aa2 (accession number AAK64560), Cry34Aa3 (accession number AAT29032), Cry34Aa4 (accession number
AAT29030), Cry34Ab1 (accession number AAG41671), Cry34Ac1 (accession number AAG50118), Cry34Ac2 (accession number
AAK64562), Cry34Ac3 (accession number AAT29029), Cry34Ba1 (accession number AAK64565), Cry34Ba2 (accession number
AAT29033), Cry34Ba3 (accession number AAT29031), Cry35Aa1 (accession number AAG50342), Cry35Aa2 (accession number
AAK64561), Cry35Aa3 (accession number AAT29028), Cry35Aa4 (accession number AAT29025), Cry35Ab1 (accession number
AAG41672), Cry35Ab2 (accession number AAK64563), Cry35Ab3 (accession number AY536891), Cry35Ac1 (accession number
AAG50117), Cry35Ba1 (accession number AAK64566), Cry35Ba2 (accession number AAT29027), Cry35Ba3 (accession number
AAT29026), Cry36Aa1 (accession number AAK64558), Cry37Aa1 (accession number AAF76376), Cry38Aa1 (accession number
AAK64559), Cry39Aa1 (accession number BAB72016), Cry40Aa1 (accession number BAB72018), Cry40Ba1 (accession number
BAC77648), Cry40Ca1 (accession number EU381045), Cry40Da1 (accession number ACF15199), Cry41Aa1 (accession number
BAD35157), Cry41Ab1 (accession number BAD35163), Cry41Ba1 (accession number HM461871), Cry41Ba2 (accession number
ZP_04099652), Cry42Aa1 (accession number BAD35166), Cry43Aa1 (accession number BAD15301), Cry43Aa2 (are logged in
Number BAD95474), Cry43Ba1 (accession number BAD15303), Cry43Ca1 (accession number KC156676), Cry43Cb1 (accession number
KC156695), Cry43Cc1 (accession number KC156696), Cry43-like (accession number BAD15305), Cry44Aa (accession number
BAD08532), Cry45Aa (accession number BAD22577), Cry46Aa (accession number BAC79010), Cry46Aa2 (accession number
BAG68906), Cry46Ab (accession number BAD35170), Cry47Aa (accession number AAY24695), Cry48Aa (accession number
CAJ18351), Cry48Aa2 (accession number CAJ86545), Cry48Aa3 (accession number CAJ86546), Cry48Ab (accession number
CAJ86548), Cry48Ab2 (accession number CAJ86549), Cry49Aa (accession number CAH56541), Cry49Aa2 (accession number
CAJ86541), Cry49Aa3 (accession number CAJ86543), Cry49Aa4 (accession number CAJ86544), Cry49Ab1 (accession number
CAJ86542), Cry50Aa1 (accession number BAE86999), Cry50Ba1 (accession number GU446675), Cry50Ba2 (accession number
GU446676), Cry51Aa1 (accession number ABI14444), Cry51Aa2 (accession number GU570697), Cry52Aa1 (accession number
EF613489), Cry52Ba1 (accession number FJ361760), Cry53Aa1 (accession number EF633476), Cry53Ab1 (accession number
FJ361759), Cry54Aa1 (accession number ACA52194), Cry54Aa2 (accession number GQ140349), Cry54Ba1 (accession number
GU446677), Cry55Aa1 (accession number ABW88932), Cry54Ab1 (accession number JQ916908), Cry55Aa2 (accession number
AAE33526), Cry56Aa1 (accession number ACU57499), Cry56Aa2 (accession number GQ483512), Cry56Aa3 (accession number
JX025567), Cry57Aa1 (accession number ANC87261), Cry58Aa1 (accession number ANC87260), Cry59Ba1 (accession number
JN790647), Cry59Aa1 (accession number ACR43758), Cry60Aa1 (accession number ACU24782), Cry60Aa2 (accession number
EAO57254), Cry60Aa3 (accession number EEM99278), Cry60Ba1 (accession number GU810818), Cry60Ba2 (accession number
EAO57253), Cry60Ba3 (accession number EEM99279), Cry61Aa1 (accession number HM035087), Cry61Aa2 (accession number
HM132125), Cry61Aa3 (accession number EEM19308), Cry62Aa1 (accession number HM054509), Cry63Aa1 (accession number
BAI44028), Cry64Aa1 (accession number BAJ05397), Cry65Aa1 (accession number HM461868), Cry65Aa2 (accession number
ZP_04123838), Cry66Aa1 (accession number HM485581), Cry66Aa2 (accession number ZP_04099945), Cry67Aa1 (are stepped on
Record HM485582), Cry67Aa2 (accession number ZP_04148882), Cry68Aa1 (accession number HQ113114), Cry69Aa1
(accession number HQ401006), Cry69Aa2 (accession number JQ821388), Cry69Ab1 (accession number JN209957), Cry70Aa1
(accession number JN646781), Cry70Ba1 (accession number ADO51070), Cry70Bb1 (accession number EEL67276), Cry71Aa1
(accession number JX025568), Cry72Aa1 (accession number JX025569), Cyt1Aa (GenBank accession number X03182), Cyt1Ab
(GenBank accession number X98793), Cyt1B (GenBank accession number U37196), Cyt2A (GenBank accession number Z14147),
And Cyt2B (GenBank accession number U52043).
The example of delta-endotoxin include but is not limited to 5,880,275 and 7,858,849 in U.S. Patent number in Cry1A egg
It is white, DIG-3 the or DIG-11 toxin (α-that the end N- is deleted in U.S. Patent number 8,304,604,8,304,605 and 8,476,226
2 variant cry albumen of helix 1 and/or α-helix, such as Cry1A, Cry3A), U.S. Patent Application Serial: 10/525,
318 Cry1B, the US patent No. 6,033,874 Cry1C, the Cry1F of U.S. Patent number 5,188,960 and 6,218,188, the U.S.
The patent No. 7,070,982,6,962,705 and 6,713,063Cry1A/F chimera chimeras；The Cry2 albumen such as U.S. is special
Cry2Ab albumen in benefit number 7,064,249；Cry3A albumen include but is not limited at least two difference Cry albumen variable region and
Merge genetic engineering hybridization insecticidal proteins (eHIP) (U.S. Patent Application Publication No. 2010/ that unique combination generates in conserved region
0017914)；Cry4 albumen；Cry5 albumen；Cry6 albumen；U.S. Patent number 7,329,736,7,449,552,7,803,943,
7,476,781,7,105,332,7,378,499 and 7,462,760 Cry8 albumen；Cry9 albumen such as Cry9A, Cry9B,
Cry9C, Cry9D, Cry9E and Cry9F family member；Cry15 albumen (the 2008Applied such as Naimov and
Environmental Microbiology,74:7145-7151)；U.S. Patent number 6,127,180,6,624,145 and 6,
Cry22 and Cry34Ab1 albumen in 340,593；U.S. Patent number 6,248,535,6,326,351,6,399,330,6,949,
626, CryET33 and cryET34 albumen in 7,385,107 and 7,504,229；U.S. Patent Publication No. 2006/0191034,
CryET33 and CryET34 homologue in 2012/0278954 and PCT Publication WO 2012/139004；U.S. Patent number 6,
083,499, Cry35Ab1 albumen in 6,548,291 and 6,340,593；Cry46 albumen, 51 albumen of Cry, Cry binary toxin,
TIC901 or associated toxin；TIC807 in U.S. Patent Application Publication No. 2008/0295207；PCT application US 2006/033867
Middle ET29, ET37, TIC809, TIC810, TIC812, TIC127, TIC128；AXMI-027 in U.S. Patent number 8,236,757,
AXMI-036 and AXMI-038；AXMI-031, AXMI-039, AXMI-040, AXMI-049 in U.S. Patent number 7,923,602；
AXMI-018, AXMI-020 and AXMI-021 in WO 2006/083891；AXMI-010 in WO 2005/038032；WO 2005/
AXMI-003 in 021585；AXMI-008 in U.S. Patent Application Publication No. 2004/0250311；U.S. Patent Application Publication No.
AXMI-006 in 2004/0216186；AXMI-007 in U.S. Patent Application Publication No. 2004/0210965；U.S. Patent application
AXMI-009 in number 2004/0210964；AXMI-014 in U.S. Patent Application Publication No. 2004/0197917；United States Patent (USP) Shen
It please AXMI-004 in publication number 2004/0197916；AXMI-028 and AXMI-029 in WO 2006/119457；WO 2004/
AXMI-007, AXMI-008, AXMI-0080rf2, AXMI-009, AXMI-014 and AXMI-004 in 074462；The US patent No. 8,
AXMI-150 in 084,416；AXMI-205 in U.S. Patent Application Publication No. 2011/0023184；U.S. Patent Application Publication No.
AXMI-011, AXMI-012 in 2011/0263488, AXMI-013, AXMI-015, AXMI-019, AXMI-044, AXMI-037,
AXMI-043, AXMI-033, AXMI-034, AXMI-022, AXMI-023, AXMI-041, AXMI-063 and AXMI-064；The U.S.
AXMI-R1 and GAP-associated protein GAP in patent application publication number 2010/0197592；AXMI221Z in WO 2011/103248,
AXMI222z, AXMI223z, AXMI224z and AXMI225z；AXMI218, AXMI219 in WO 2011/103247, AXMI220,
AXMI226, AXMI227, AXMI228, AXMI229, AXMI230 and AXMI231；AXMI- in U.S. Patent number 8,334,431
115, AXMI-113, AXMI-005, AXMI-163 and AXMI-184；In U.S. Patent Application Publication No. 2010/0298211
AXMI-001, AXMI-002, AXMI-030, AXMI-035 and AXMI-045；U.S. Patent Application Publication No. 2009/0144852
Middle AXMI-066 and AXMI-076；AXMI128, AXMI130 in U.S. Patent number 8,318,900, AXMI131, AXMI133,
AXMI140、AXMI141、AXMI142、AXMI143、AXMI144、AXMI146、AXMI148、AXMI149、AXMI152、
AXMI153、AXMI154、AXMI155、AXMI156、AXMI157、AXMI158、AXMI162、AXMI165、AXMI166、
AXMI167、AXMI168、AXMI169、AXMI170、AXMI171、AXMI172、AXMI173、AXMI174、AXMI175、
AXMI176、AXMI177、AXMI178、AXMI179、AXMI180、AXMI181、AXMI182、AXMI185、AXMI186、
AXMI187,AXMI188,AXMI189；AXMI079, AXMI080 in U.S. Patent Application Publication No. 2010/0005543,
AXMI081、AXMI082、AXMI091、AXMI092、AXMI096、AXMI097、AXMI098、AXMI099、AXMI100、
AXMI101、AXMI102、AXMI103、AXMI104、AXMI107、AXMI108、AXMI109、AXMI110、AXMI111、
AXMI112、AXMI114、AXMI116、AXMI117、AXMI118、AXMI119、AXMI120、AXMI121、AXMI122、
AXMI123、AXMI124、AXMI1257、AXMI1268、AXMI127、AXMI129、AXMI164、AXMI151、AXMI161、
AXMI183,AXMI132,AXMI138,AXMI137；AXMI232 in U.S. Patent Application Publication No. 201400962281,
AXMI233 and AXMI249；Cry1A of the cry albumen for example with modification proteolysis sites in U.S. Patent number 8,319,019
And Cry3A；Bacillus thuringiensis (Bacillus is derived from U.S. Patent Application Publication No. 2011/0064710
Thuringiensis) Cry1Ac, Cry2Aa and Cry1Ca toxin protein of bacterial strain VBTS 2528.Those skilled in the art are known
Other Cry albumen (see " bacillus thuringiensis (Bacillus thuringiensis) the toxin system life such as Crickmore
Name method " (2011), at www.lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/).Those skilled in the art
The known Cry albumen of member insecticidal activity (be detailed in summary, van Frannkenhuyzen, (2009) J.Invert.Path.101:
1-16).As genetically modified plants character, Cry- genetically modified plants have been regulated the known cry albumen of those skilled in the art
License, these genetically modified plants include but is not limited to express Cry1Ac, Cry1Ac+Cry2Ab, Cry1Ab, Cry1A.105,
Cry1F、Cry1Fa2、Cry1F+Cry1Ac、Cry2Ab、Cry3A、mCry3A、Cry3Bb1、Cry34Ab1、Cry35Ab1、
The plant of Vip3A, Cry9c and CBI-Bt (are detailed in Sanahuja, (2011) Plant Biotech Journal 9:283-300
With the environmental risk assessment GM Crop Database Center for Environmental of genetically modified crops database hub
Risk Assessment (2010) (CERA), ILSI Research Foundation, Washington D.C. www.cera-gmc.org/
Index.php? action=gm_crop_database).The desinsection egg well known to those skilled in the art expressed in plant
It is white to include, such as Vip3Ab&Cry1Fa (US2012/0317682), Cry1BE&Cry1F (US2012/0311746), Cry1CA&
Cry1AB (US2012/0311745), Cry1&CryCa (US2012/0317681), Cry1DA&Cry1BE (US2012/
0331590), Cry1DA&Cry1Fa (US2012/0331589), Cry1AB&Cry1BE (US2012/0324606), Cry1Fa&
Cry2Aa and Cry1I&Cry1E (US2012/0324605), Cry34Ab/35Ab and Cry6Aa (US20130167269),
Cry34Ab/VCry35Ab&Cry3Aa (US20130167268) and Cry3A and Cry1Ab or Vip3Aa
(US20130116170).Insecticidal proteins also include desinsection lipase comprising the fatty acyl group water of U.S. Patent number 7,491,869
Solve enzyme, and cholesterol oxidase (Purcell etc. (1993) Biochem Biophys Res Commun derived from streptomycete
15:1406-1413).Insecticidal proteins also include U.S. Patent number 5,877,012,6,107,279,6,137,033,7,244,
820,7,615,686,8,237,020 equal VIP (vegetative insecticidal protein, vegetative insecticidal proteins)
Toxin.Other VIP albumen well known to those skilled in the art are shown in lifesci.sussex.ac.uk/home/Neil_
Crickmore/Bt/vip.html.Insecticidal proteins also include derived from Xenorhabdus nematophilus category (Xenorhabdus), nascent type
Toxin complex (the toxin complex of Photobacterium (Photorhabdus) and series bacillus (Paenibacillus)
(TC)) (see U.S. Patent number 7,491,698 and 8,084,418).Some TC albumen have the insecticidal activity of " independence ", other
TC albumen enhances the activity for the independent TC albumen that same given organism generates, and the activity of " independence " TC albumen is (for example, be derived from
Luminous bacillus, Xenorhabdus or bacillus) it can be by one or more source different genera organism TC albumen " reinforcing agent "
Enhanced.There are mainly three types of type TC albumen, and referred to type A albumen (" a-protein ") is monomer toxin herein.Type B
The toxicity of albumen (" PROTEIN B ") and Type C albumen (" protein C ") enhancing type A albumen.The example of type A albumen has
TcbA, TcdA, XptA1 and XptA2, the example of type B albumen have TcaC, TcdB, XptB1Xb and XptC1Wi, Type C albumen
Example have TccC, XptC1Xb and XptB1Wi.Insecticidal proteins also include spider, snake and scorpion venom protein.The example of spider phallotoxins
Including but not limited to lycotoxin-1 peptide and its mutant (U.S. Patent number 8,334,366).
Following example describes some representative methods and techniques for simulating plant insect feeding condition and/or to comment
Estimate the resistance situation of plant under this condition.
1. the filial generation of the plant of conversion, the plant of the conversion is hemizygous, the filial generation for recombinant dna construct
Be separated into and include or the plant not comprising the DNA construct: the filial generation comprising the recombinant dna construct will be usually relative to not wrapping
Filial generation containing the recombinant dna construct come measure (that is, do not include the recombinant dna construct filial generation be control or reference
Plant).
2. recombinant dna construct gene transgression is into inbred strais, such as in corn or gene transgression is into mutation, example
Such as in soybean: gene transgression strain will be measured usually relative to parental inbred lines or mutation strain (that is, parental inbred lines
Or cultivars and strains are compareed or referring to plant).
3. double cross system, wherein the first hybridization system is generated by two parental inbred lines, and the second hybridization system is by identical two
A parental inbred lines generate, the difference is that one of parental inbred lines contain recombinant dna construct: the second hybridization system usually will
(the i.e. first hybridization system is for check plant or referring to plant) is measured relative to the first hybridization system.
4. including the plant of recombinant dna construct: the plant can be evaluated or be surveyed relative to such check plant
Amount, the check plant do not include recombinant dna construct, but have with the comparable genetic background of the plant (for example, with comprising recombination
The plant of DNA construct compares, the inhereditary material have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, 99% or 100% sequence identity).There are many can be used for analyzing, compares and characterize plant genetic background
Laboratory technology；Wherein these technologies are isozyme electrophoresis, restriction fragment length polymorphism (RFLPs), random amplification
Polymorphic dna (RAPDs), any primed polymerase chain reaction (AP-PCR), DNA cloning fingerprint (DAF), sequence specific amplification
Region (SCARs), amplified fragment length polymorphism (And the simple sequence repeats of also referred to as microsatellite (SSRs) s).
In addition, those skilled in the art will readily appreciate that, the agronomy attribute of genetically modified plants is evaluated or measured
When phenotype suitably control or will not include previously being directed to required agronomy attribute or phenotype referring to plant, pass through mutagenesis
Or the plant of conversion and selection.
" pest " includes but is not limited to insect, fungi, bacterium, Nemata, mite, lice etc..Insect pest includes selected from following
Each purpose insect: coleoptera (Coleoptera), Diptera (Diptera), Hymenoptera (Hymenoptera), Lepidoptera
(Lepidoptera), mallophaga (Mallophaga), Homoptera (Homoptera), Semiptera (Hemiptera), Orthoptera
(Orthroptera), Thysanoptera (Thysanoptera), Dermaptera (Dermaptera), Isoptera (Isoptera), Anoplura
(Anoplura), Siphonaptera (Siphonaptera), Trichoptera (Trichoptera) etc., especially Lepidoptera (Lepidoptera)
With coleoptera (Coleoptera).
Those skilled in the art recognize, and not all compound can effectively tackle all pests, the present embodiment
Compound can tackle insect pest, these pests include economic important agricultural, forestry, greenhouse, nursery flowers, food and
Fiber, the public and animal health, family and pattern of trade, family and storage pest.
The larva of Lepidoptera (Lepidoptera) include but is not limited to the mythimna separata of Noctuidae (Noctuidae), cutworm,
Looper and heliothine: autumn armyworm (Spodoptera frugiperda JE Smith, fall armyworm)；Beet night
Moth (S.exigua H ü bner, beet armyworm)；Prodenia litura (S.litura Fabhcius, tobacco cutworm,
cluster caterpillar)；Bud band noctuid (Mamestra configurata Walker, bertha armyworm)；It is sweet
Blue noctuid (M.brassicae Linnaeus, cabbage moth)；Black cutworm (Agrotis ipsilon Hufnagel,
black cutworm)；Western cutworm (A.orthogonia Morrison, western cutworm)；Particle noctuid
(A.subterranea Fabricius, granulate cutworm), kapok worm (Alabama argillacea H ü bner,
cotton leaf worm)；Cabbage looper (Trichoplusia ni H ü bner, cabbage looper)；Soybean noctuid
(Pseudoplusia includens Walker, soybean looper)；Black beans noctuid (Anticarsia gemmatalis
H ü bner, velvetbean caterpillar)；The green noctuid of clover (Hypena scabra Fabricius,
greencloverworm)；Tobacco budworm (Heliothis virescens Fabricius, tobacco budworm)；One star
Mythimna separata (Pseudaletia unipuncta Haworth, armyworm)；Rough bark noctuid (Athetis mindara Barnes
And Mcdunnough, rough skinned cutworm)；Dark edge cutworm (Euxoa messoria Harris,
darksided cutworm)；Egyptian gold steel bores (Earias insulana Boisduval, spiny bollworm)；Emerald green line
Jin Gang bores (E.vittella Fabricius, spotted bollworm)；Heliothis zea (Helicoverpa armigera
H ü bner, American bollworm)；Paddy reality noctuid (H.zea Boddie, corn earworm or cotton
bollworm)；Line butterfly caterpillar (Melanchra picta Harris, zebra caterpillar)；Citrus noctuid (Egira
(Xylomyges) curialis Grote, citrus cutworm)；Mythimna separate(Oriental
Armyworm)；Borer, sheath moth larvae, web spinner, cone moth and the careless moth of Crambidae (Crambidae): Asia corn
Snout moth's larva (Ostrinia furnacalis, Asian Corn Borer)；European corn borer (Ostrinia nubilalis,
European corn borer) and；Pyralidae (Pyralidae) European corn borer (Ostrinia nubilalis H ü bner,
European corn borer) defoliator (skeletonizers)；Navel orangeworm (Amyelois transitella
Walker, naval orangeworm)；Anagasta kuehniella (Anagasta kuehniella Zeller,
Mediterranean flour moth)；Cadra cautella (Cadra cautella Walker, almond moth)；Striped rice borer
(Chilo suppressalis Walker, rice stem borer)；Spot dogstail snout moth's larva (C.partellus, sorghum
borer)；Rice moth (Corcyra cephalonicaStainton, rice moth)；Corn root web spinner (Crambus
Caliginosellus Clemens, corn root webworm)；Bluegrass web spinner (C.teterrellus Zincken,
bluegrass webworm)；Cnaphalocrocis medinalls guenee (Cnaphalocrocis medinalis Guenee, rice leaf
roller)；Grape leaf folder (Desmia funeralis H ü bner, grape leaffolder)；Melon worm
(Diaphania hyalinata Linnaeus, melon worm)；Pickles worm (D.nitidalis Stoll,
pickleworm)；Southwest Maize snout moth's larva (Diatraea grandiosella Dyar, southwestern corn borer)；It is small
Sugarcane borer (D.saccharalis Fabricius, surgarcane borer)；Mexico's rice borer (Eoreuma loftini
Dyar, Mexican rice borer)；Cacac moth (Ephestia elutella H ü bner, tobacco (cacao)
moth)；Galleria mellonella waxmoth (Galleria mellonella Linnaeus, greater wax moth)；Wild snout moth's larva (Herpetogramma
Licarsisalis Walker, sod webworm)；Sunflower phycitid (Homoeosoma electellum Hulst,
sunflower moth)；South America maize seedling phycitid (Elasmopalpus lignosellus Zeller, lesser
cornstalk borer)；Lesser wax-moth (Achroia grisella Fabricius, lesser wax moth)；Loxostege sticticalis
(Loxostege sticticalis Linnaeus, beet webworm)；Tea tree snout moth's larva (Orthaga thyrisalis
Walker, tea tree web moth)；Beans open country snout moth's larva (Maruca testulalis Geyer, bean pod borer)；India
Paddy snout moth's larva (Plodia interpunctella H ü bner, Indian meal moth)；Yellow rice borer (Scirpophaga
Incertulas Walker, yellow stem borer)；Greenhouse snout moth's larva (Udea rubigalis Guenee, celery
leaftier)；And leaf folder, aphid, kind reality worm and the fruit worm of Tortricidae (Tortricidae): blackhead leaf roller
(Acleris gloverana Walsingham, Western blackheaded budworm)；Blackhead Acleris spp
(A.variana Fernald, Eastern blackheaded budworm)；Fruit tree Huang rolls up moth (Archips
Argyrospila Walker, fruit tree leaf roller)；European leaf roller (A.rosana Linnaeus,
European leaf roller)；And other Archips spp (Archips) species: adoxophyes moth (Adoxophyes
orana Fischer von summer fruit tortrix moth)；Striped sunflower moth (Cochylis hospes
Walsingham, banded sunflower moth)；Hazel steinernema (Cydia latiferreana Walsingham,
filbertworm)；Carpocapsa pononella (C.pomonella Linnaeus, coding moth)；Variegated leaf roller (Platynota
Flavedana Clemens, variegated leafroller)；Carnation steinernema (P.stultana
Walsingham, omnivorous leafroller)；European grape olethreutid (Lobesia botrana Denis&
Schifferm ü ller, European grape vine moth)；Spilonota lechriaspis (Spilonota ocellana Denis&
Schifferm ü ller, eyespotted bud moth)；Grape fruit moth (Endopiza viteana Clemens, grape
berry moth)；Ligustrum fine tortricidae (Eupoecilia ambiguella H ü bner, vine moth)；Brazilian apple skin worm
(Bonagota salubricola Meyrick, Brazilian apple leafroller)；Oriental fruit months
(Grapholita molesta Busck, oriental fruit moth)；Sunflower bud moth (Suleima helianthana
Riley, sunflower budmoth)；Silver lap moth (Argyrotaenia spp.)；A tail a kind of butterfly harmful to crop plants (Choristoneura
spp.)。
Selected other agronomy pests of Lepidoptera (Lepidoptera) include but is not limited to: fall cankerworm (Alsophila
Pometaria Harris, fall cankerworm)；Peach branch gelechiid (Anarsia lineatella Zeller, peach
twig borer)；Rhinoceros volume moth (Anisota senatoria J.E.Smith, orange striped oakworm)；Tussah
(Antheraea pernyi Guerin-Meneville, Chinese Oak Tussah Moth)；Silkworm (Bombyx mori
Linnaeus, Silkworm)；Cotton lyonetid (Bucculatrix thurberiella Busck, cotton leaf
perforator)；Clover Huang butterfly (Colias eurytheme Boisduval, alfalfa caterpillar)；English walnut Huang butterfly
(Datana integerrima Grote&Robinson, walnut caterpillar)；Dendrolimus sibiricus (Dendrolimus
Sibiricus Tschetwerikov, Siberian silk moth)；White looper (Ennomos subsignaria H ü
Bner, elm spanworm)；Bodhi looper (Erannis tiliaria Harris, linden looper)；Pornography and drug moth
(Euproctis chrysorrhoea Linnaeus, browntail moth)；Black quasi- sandfly moth (Harrisina americana
Guerin-Meneville, grapeleaf skeletonizer)；Range caterpillar moth (Hemileuca oliviae
Cockrell, range caterpillar)；Fall webworms (Hyphantria cunea Drury, fall webworm)；Kind
Eggplant moth moth (Keiferia lycopersicella Walsingham, tomato pinworm)；Polyura narcaea (Lambdina
Fiscellaria fiscellaria Hulst, Eastern hemlock looper)；Western hemlock looper
(L.fiscellaria lugubrosa Hulst, Western hemlock looper)；Leucoma candida (Leucoma salicis
Linnaeus, satin moth)；Gypsymoth (Lymantria dispar Linnaeus, gypsy moth)；Tomato hawkmoth
(Manduca quinquemaculata Haworth, five spotted hawk moth, tomato hornworm)；Tobacco
Hawkmoth (M.sexta Haworth, tomato hornworm, tobacco hornworm)；Winter looper (Operophtera
Brumata Linnaeus, winter moth)；Spring looper (Paleacrita vernata Peck, spring
cankerworm)；Big swallowtail butterfly (Papilio cresphontes Cramer, giant swallowtail, orange dog)；
California strain worm (Phryganidia californica Packard, California oakworm)；Phyllocnistis citrella stainton
(Phyllocnistis citrella Stainton, citrus leafminer)；Spot curtain leaf miner (Phyllonorycter
Blancardella Fabricius, spotted tentiform leafminer)；Large white butterfly (Pieris brassicae
Linnaeus, large white butterfly)；Pieris rapae (P.rapae Linnaeus, small white
butterfly)；Dark arteries and veins cabbage butterfly (P.napi Linnaeus, green veined white butterfly)；Arithoke plume moth
(Platyptilia carduidactyla Riley, artichoke plume moth)；Water chestnut spot starves (Plutella
Xylostella Linnaeus, diamondback moth)；Pink bollworm (Pectinophora gossypiella
Saunders, pink bollworm)；Southern diamond-back moth (Pontia protodice Boisduval&Leconte, Southern
cabbageworm)；Omnivorous looper (Sabulodes aegrotata Guenee, omnivorous looper)；Blatta concinna
(Schizura concinna J.E.Smith, red humped caterpillar)；Gelechiid (Sitotroga
Cerealella Olivier, Angoumois grain moth)；Song Yi band moth (Thaumetopoea pityocampa
Schiffermuller, pine processionary caterpillar)；Knot casemaking clothes moth (Tineola bisselliella
Hummel, webbing clothesmoth)；Liriomyza brponiae (Tuta absoluta Meyrick, tomato
leafminer)；Apple ermine moth (Yponomeuta padella Linnaeus, ermine moth)；Heliothis
subflexa Guenee；Tent caterpillar (Malacosoma spp)；And poison moth (Orgyia spp).
The larva and adult of coleoptera (Coleoptera) include long angle Curculionidae (Anthribidae), Bruchidae
(Bruchidae) and the weevil of Culculionidae (Curculionidae) (including but not limited to: anthonomus grandis (Anthonomus
Grandis Boheman, boll weevil)；Rice water weevil (Lissorhoptrus oryzophilus Kuschel, rice
water weevil)；Grain weevil (Sitophilus granarius Linnaeus, granary weevil)；Rice weevil
(S.oryzae Linnaeus, rice weevil)；Clover leaf weevil (Hypera punctata Fabricius, clover
leaf weevil)；Sunflower stem weevil (Cylindrocopturus adspersus LeConte, sunflower stem
weevil)；Red sunflower seeds weevil worm (Smicronyx fulvus LeConte, red sunflower seed weevil)；
Grey sunflower seeds weevil worm (S.sordidus LeConte, gray sunflower seed weevil)；Maize billbug
(Sphenophorus maidis Chittenden, maize billbug)；First is disturbed in the jump of Chrysomelidae (Chrysomelidae)
Worm, cucumber leaf beetle, rootworm, chrysomelid worm, colorado potato beetles and leaf miner are (including but not limited to: state of Colorado potato
Beetle (Leptinotarsa decemlineata Say, Colorado potato beetle)；Diabroticavirgifera
(Diabrotica virgifera virgifera LeConte, western corn rootworm)；Pasteur's root is chrysomelid
(D.barberi Smith&Lawrence, northern corn rootworm)；Southern corn rootworm
(D.undecimpunctata howardi Barber, southern corn rootworm)；Corn flea beetle
(Chaetocnema pulicaria Melsheimer, corn flea beetle)；Brassicaceous vegetable flea beetle
(Phyllotreta cruciferae Goeze, Crucifer flea beetle)；Phyllotreta striolata (Phyllotreta
Striolata, stripped flea beetle)；Grape colaspsis (Colaspis brunnea Fabricius, grape
colaspis)；Black angle scotellaris (Oulema melanopus Linnaeus, cereal leaf beetle)；Sunflower is chrysomelid
(Zygogramma exclamationis Fabricius, sunflower beetle))；Coccinellidae (Coccinellidae)
Beetle (including but not limited to: mexican bean ladybird (Epilachna varivestis Mulsant, Mexican bean
beetle)；The chafer of dung beetle section (Scarabaeidae) and other beetles are (including but not limited to: Japanese beetle
(Popillia japonica Newman, Japanese beetle)；Northern round end rhinoceros cockchafer (Cyclocephala
Borealis Arrow, northern masked chafer, white grub)；Southern round end rhinoceros cockchafer (C.immaculata
Olivier, southern masked chafer, white grub)；European cockchafer (Rhizotrogus majalis
Razoumowsky, European chafer)；Grub (Phyllophaga crinita Burmeister, white grub)；
Carrot beetle (Ligyrus gibbosus De Geer, carrot beetle))；The carpet of Dermestidae (Dermestidae)
Circle khapra beetle；The nematode of Elateridae (Elateridae): pseudo- wireworm (Eleodes spp.), comb grab click beetle (Melanotus
Spp.), single leaf click beetle (Conoderus spp.), wireworm (Limonius spp.), cone tail click beetle (Agriotes spp.),
Click beetle category (Ctenicera spp.), Aeolus spp.；The bark beetle of Scolytidae (Scolytidae) and paragraph
(Tenebrionidae) beetle.
The adult and larva of Diptera (Diptera) include: such as corn spot Liriomyza (Agromyza parvicornis
Loew, corn blotch leafminer) Liriomyza；Mosquito is (including but not limited to: sorghum cecidomyiia (Contarinia
Sorghicola Coquillett, sorghum midge)；Hessian fly (Mayetiola destructor Say,
Hessian fly)；Wheat midge (Sitodiplosis mosellana Gehin, wheat midge)；Sunflower seeds mosquito
(Neolasioptera murtfeldtiana Felt, sunflower seed midge))；Drosophila (Tephritidae
(Tephritidae)), Sweden stem maggot (Oscinella frit Linnaeus, frit flies)；Maggot (including but not limited to:
Delia platura (Delia platura Meigen, seedcorn maggot)；Wheat bulb fly (D.coarctata Fallen,
wheat bulb fly)；And other ground Hylemyia Platura Meigen (Delia spp.), America stem maggot (Meromyza americana Fitch,
wheat stem maggot)；It gives up fly (Musca domestica Linnaeus, house flies)；Fannia canicularis (Fannia
Canicularis Linnaeus), hutch fly (F.femoralis Stein, lesser house flies)；Tatukira
(Stomoxys calcitrans Linnaeus, stable flies))；Face fly, horn fly, calliphorid, golden fly (Chrysomya
spp.)；It lies prostrate fly (Phormia spp.)；And other moss fly pests, horse botfly, horsefly (Tabanus spp.)；Stomach fly
(Gastrophilus spp.)；Botfly (Oestrus spp.)；Ox maggot fly (Hypoderma spp.)；Spot horsefly (Chrysops
spp.)；Sheep hippoboscid (Melophagus ovinus Linnaeus, keds)；And other Brachyceras
(Brachycera), mosquito, yellow-fever mosquito (Aedes spp.)；Anopheles (Anopheles spp.)；Culex (Culex spp.)；It is black
Fly, former buffalo gnat (Prosimulium spp.)；Buffalo gnat (Simulium spp.)；Sting midge, sand fly, mushroom fly and other Nematoceras
(Nematocera)。
The adult and nymph of Semiptera (Hemiptera) and Homoptera (Homoptera) include insect, such as but unlimited
In: the adelgid of Adelgidae (Adelgidae), the fleahopper of Miridae (Miridae), Cicadidae (Cicadidae) cicada, Cicadellidae
(Cicadellidae) leafhopper, smaller green leaf hopper (Empoasca spp.)；The great Ye of great Ye buddhist section (Cicadellidae) is green
Buddhist, water chestnut Delphacidae (Cixiidae), Flatidae (Flatidae), fulgoroidea (Fulgoroidea), circle Delphacidae
(Issidae) and the plant hopper of Dao Shi section (Delphacidae)；The horned frog of Membracidae (Membracidae)；Psyllidae
(Psyllidae) wood louse；The aleyrodid of Aleyrodidae (Aleyrodidae)；The aphid of Aphidiadae (Aphididae)；Phylloxera Aphididae
(Phylloxeridae) radicola；The mealybug of Pseudococcidae (Pseudococcidae)；Chain Coccidae
(Asterolecanidae), soft Coccidae (Coccidae), fuchsin a red-spotted lizard section (Dactylopiidae), shield Coccidae
(Diaspididae), Eriococcinae (Eriococcidae), ancient type of banner hoisted on a featherdecked mast Coccidae (Ortheziidae), thorn certain herbaceous plants with big flowers Coccidae
(Phoenicococcidae) and the scale insect of large Coccidae (Margarodidae)；The net of Tingidae (Tingidae)
Stinkbug；The aspongopus of Pentatomiddae (Pentatomidae)；The China bug of Lygaeidae (Lygaeidae), long Chinese toon (Blissus spp.)；With
And other stinkbug classes (seed bugs), the froghopper of Cercopidae (Cercopidae), Coreidae (Coreidae) squash bug,
And tetranychus autumnalis and the cotton stinkbug of Pyrrhocoridae (Pyrrhocoridae).
Member important on agronomy further includes but is not limited in Homoptera (Homoptera): acyrthosiphum pisim
(Acyrthisiphon pisum Harris, pea aphid)；Cowpea aphid (Aphis craccivora Koch, cowpea
aphid)；Black bean aphid (A.fabae Scopoli, black bean aphid)；Cotten aphid (A.gossypii Glover, cotton
Aphid, melon aphid)；Corn root aphid (A.maidiradicis Forbes, corn root aphid)；Apple yellow aphid
(A.pomi De Geer, apple aphid)；Spiraea aphid (A.spiraecola Patch, spirea aphid)；Eggplant ditch without
Net aphid (Aulacorthum solani Kaltenbach, foxglove aphid)；Strawberry follows closely aphid (Chaetosiphon
Fragaefolii Cockerell, strawberry aphid)；Diuraphis noxia (Diuraphis noxia Kurdjumov/
Mordvilko, Russian wheat aphid)；Rose apple aphid (Dysaphis plantaginea Paaserini, rosy
apple aphid)；Eriosoma lanigerum (Eriosoma lanigerum Hausmann, woolly apple aphid)；Brevicoryne brassicae
(Brevicoryne brassicae Linnaeus, cabbage aphid)；Hyaloptera aphid (Hyalopterus pruni
Geoffroy, mealy plum aphid)；Radish aphid (Lipaphis erysimi Kaltenbach, turnip aphid)；Wheat
Without net Macrosiphus spp (Metopolophium dirrhodum Walker, cereal aphid)；Root of Beijing euphorbia Macrosiphus spp
(Macrosiphum euphorbiae Thomas, potato aphid)；Cigarette black peach aphid (Myzus persicae Sulzer,
Peach-potato aphid, green peach aphid)；Lettuce aphid (Nasonovia ribisnigri Mosley,
lettuce aphid)；Goitre woolly aphid (Pemphigus spp., root aphids and gall aphids)；Corn leaf aphids
(Rhopalosiphum maidis Fitch, corn leaf aphid)；Rhopalosiphum padi (R.padi Linnaeus, bird
cherry-oat aphid)；Green bugs (Schizaphis graminum Rondani, greenbug)；Yellow sugarcane aphid
(Sipha flava Forbes, yellow sugarcane aphid)；Grain aphid (Sitobion avenae
Fabricius, English grain aphid)；Clover spot aphid (Therioaphis maculata Buckton, spotted
alfalfa aphid)；Black citrus aphid (Toxoptera aurantii Boyer de Fonscolombe, black
Citrus aphid) and brown citrus aphid (T.citricida Kirkaldy, brown citrus aphid)；Adelgid
(Adelges spp.,adelgids)；Pecan radicola (Phylloxera devastatrix Pergande, pecan
phylloxera)；Sweet potato whitefly (Bemisia tabaci Gennadius, tobacco whitefly, sweetpotato
whitefly)；Bemisia argentifolii (B.argentifolii Bellows&Perring, silverleaf whitefly)；Citrus powder
Lice (Dialeurodes citri Ashmead, citrus whitefly)；Bemisia tabaci (Trialeurodes
Abutiloneus, bandedwinged whitefly) and Trialeurodes vaporariorum Westwood (T.vaporariorum Westwood,
greenhouse whitefly)；Potato empoascafabae (Empoasca fabae Harris, potato leafhopper)；
Small brown rice planthopper (Laodelphax striatellus Fallen, smaller brown planthopper)；Aster leafhopper
(Macrolestes quadrilineatus Forbes,aster leafhopper)；Rice green leafhopper (Nephotettix
cinticeps Uhler,green leafhopper)；Two rice green leafhoppers (N.nigropictus Stal, rice
leafhopper)；Brown paddy plant hopper (Nilaparvata lugens Stal, brown planthopper)；Corn plant hopper
(Peregrinus maidis Ashmead,corn planthopper)；White backed planthopper (Sogatella furcifera
Horvath,white-backed planthopper)；Planthopper (Sogatodes orizicola Muir, rice
delphacid)；The white leafhopper of apple (Typhlocyba pomaria McAtee, white apple leafhopper)；Grape
Leafhopper (Erythroneoura spp., grape leafhoppers)；17 years cicada (Magicicada septendecim
Linnaeus,periodical cicada)；Icerya purchasi (Icerya purchasi Maskell, cottony cushion
scale)；Theatre armored scale (Quadraspidiotus perniciosus Comstock, San Jose scale)；Citrus stern line
Mealybug (Planococcus citri Risso, citrus mealybug)；Kind (Pseudococcus spp.) (its of mealybug
His mealybug system group)；Pear sucker (Cacopsylla pyricola Foerster, pear psylla)；Kaki lice (Trioza
diospyri Ashmead,persimmon psylla)。
Species important on agronomy include but is not limited in Semiptera (Hemiptera): green rice bug (Acrosternum
hilare Say,green stink bug)；Squash bug (Anasa tristis De Geer, squash bug)；China bug
(Blissus leucopterus leucopterus Say,chinch bug)；Square wing lace bug (Corythuca gossypii
Fabricius,cotton lace bug)；Tomato stinkbug (Cyrtopeltis modesta Distant, tomato bug)；Cotton
Stinkbug (Dysdercus suturellus Herrich-Schaffer, cotton stainer)；Brown smelly stinkbug (Euschistus
servus Say,brown stink bug)；The smelly stinkbug of one spot (E.variolarius Palisot de Beauvois, one-
spotted stink bug)；Chinch bug (Graptostethus spp.) (fruit stinkbug system group (complex of seed
bugs))；Pine needle root stinkbug (Leptoglossus corculus Say, leaf-footed pine seed bug)；U.S. herbage
Fleahopper (Lygus lineolaris Palisot de Beauvois, tarnished plant bug)；Lygushesperus
(L.Hesperus Knight,Western tarnished plant bug)；Tarnished plant bug (L.pratensis
Linnaeus,common meadow bug)；Become mildewed lygus bug (L.rugulipennis Poppius, European
tarnished plant bug)；Long green plant bug (Lygocoris pabulinus Linnaeus, common green
capsid)；Rice green rice bug (Nezara viridula Linnaeus, southern green stink bug)；Rice stinkbug
(Oebalus pugnax Fabricius,rice stink bug)；Coign chinch bug (Oncopeltus fasciatus
Dallas,large milkweed bug)；Cotton plant bug (Pseudatomoscelis seriatus Reuter, cotton
fleahopper)。
The pest for including in Semiptera (Hemiptera) include: strawberry stinkbug (Calocoris norvegicus Gmelin,
strawberry bug)；Orthops campestris Linnaeus；Apple capsid (Plesiocoris rugicollis
Fallen,apple capsid)；Tomato stinkbug (Cyrtopeltis modestus Distant, tomato bug)；Tobacco is small blind
Stinkbug (Cyrtopeltis notatus Distant, suckfly)；Hickie fleahopper (Spanagonicus albofasciatus
Reuter,whitemarked fleahopper)；Chinese honey locust stinkbug (Diaphnocoris chlorionis Say, honeylocust
plant bug)；Onion stinkbug (Labopidicola allii Knight, onion plant bug)；Cotton plant bug
(Pseudatomoscelis seriatus Reuter,cotton fleahopper)；Rapid plant bug (Adelphocoris
rapidus Say,rapid plant bug)；Four line fleahoppers (Poecilocapsus lineatus Fabricius, four-
lined plant bug)；Quasi- China bug (Nysius ericae Schilling, false chinch bug)；Scirothrips dorsalis
(Nysius raphanus Howard,false chinch bug)；Rice blueness stinkbug (Nezara viridula Linnaeus,
Southern green stink bug)；Eurygasterspp (Eurygaster spp.)；Coried (Coreidae spp.)；Red stinkbug
(Pyrrhocoridae spp.)；Rain moth (Tinidae spp.)；Belostomatid (Blostomatidae spp.)；Hunt stinkbug
(Reduviidae spp.)；And smelly stinkbug (Cimicidae spp.).
(mite (mites) purpose adult and larva include: wheat leaf roll mite (Aceria tosichella to mite (Acari)
Keifer,wheat curl mite)；The small Acarus hordei of brown (Petrobia latens M ü ller, brown wheat mite)；
The spider mite and trombiculid of Tetranychidae (Tetranychidae), European tetranychid (Panonychus ulmi Koch, European red
mite)；Tetranychus urticae (Tetranychus urticae Koch, two spotted spider mite)；Step tetranychid
(T.mcdanieli McGregor,McDaniel mite)；Tetranychus cinnabarinus (T.cinnabarinus Boisduval,
carmine spider mite)；O.turkestanicumvar. tuberculata (T.turkestani Ugarov&Nikolski, strawberry
spider mite)；The flat mite of Tenuipalpidae (Tenuipalpidae), grape brevipalpus (Brevipalpus lewisi
McGregor,citrus flat mite)；The rust mite of Eriophyidae (Eriophyidae) is He Ya Ying mite and other food tetranychids
With to the important mite of human and animal's health, rust mite in Ji Qing section (Epidermoptidae), Demodicidae
(Demodicidae) demodex folliculorum in, the paddy mite of Shi Tian mite section (Glycyphagidae), the tick of Ying Pi section (Ixodidae),
Blacklegged tick (Ixodes scapularis Say, deer tick)；Ixodes holocyclus (I.holocyclus Neumann,
Australian paralysis tick)；U.S.'s dog tick (Dermacentor variabilis Say, American dog
tick)；America tick (Amblyomma americanum Linnaeus, lone star tick)；And itch mite section
(Psoroptidae), the itch mite and itch mite of Pyemotidae (Pyemotidae) and Sarcoptidae (Sarcoptidae).
Insect pest in Thysanoptera (Thysanura) merits attention, such as silverfiss (Lepisma
saccharina Linnaeus,silverfish)；Special mess silverfish (Thermobia domestica Packard,
firebrat)。
Other arthropod pests covered include the spider in Araneida (Araneae), such as brown reclusion spider
(Loxosceles reclusa Gertsch&Mulaik,brown recluse spider)；And latrodectus mactans
(Latrodectus mactans Fabricius,black widow spider)；With common house centipede mesh (Scutigeromorpha)
Centipede, such as common house centipede (Scutigera coleoptrata Linnaeus, house centipede).
Insect pest of interest includes the Superfamily of stinkbug Superfamily He other relevant insects, including but not limited to stinkbug section
(green rice bug (Nezara viridula), eating attraction (Halyomorpha halys), wall stinkbug (Piezodorus guildini),
Brown smelly stinkbug (Euschistus servus) is intended coried (Acrosternum hilare), Soybean Brown Spot stinkbug (Euschistus
), heros Euschistus tristigmus, Dichelops furcatus, Dichelops melacanthus, and ancient name for Chinese cabbage stinkbug
(Bagrada hilaris)), tortoise Pentatomiddae (sieve beans tortoise stinkbug-globular stink bug (Megacopta cribraria-Bean plataspid)
With the species of Cydnidae (root stinkbug (Scaptocoris castanea-Root stink bug))；And the species of Lepidoptera,
Including but not limited to diamond-back moth (diamond-back moth), such as heliothis zea (Helicoverpa zea Boddie)；Soybean
Looper (soybean looper), such as soybean noctuid；And black beans caterpillar (velvet bean caterpillar), such as black beans
Noctuid (Anticarsia gemmatalis H ü bner).
Nematode (Nematodes) includes parasitic nematode, such as root knot, cyst and lesion nematode, including Heterodera
Species (Heterodera spp.), root-knot nematode species (Meloidogyne spp.) and ball golden nematode species
(Globodera spp.)；The especially member of cyst nematode, including but not limited to, soybean cyst nematode Heterodera glycines (Heterodera
Glycines, soybean cyst nematode)；The nematode worm of beet (Heterodera schachtii, beet cyst
nematode)；Polymyxa graminis (Heterodera avenae, cereal cyst nematode) and potato gold thread
Worm (Globodera rostochiensis) and G.pallida (Globodera pailida, potato cyst
nematodes).Lesion nematode includes Pratylenchidae species (Pratylenchus spp.).
Method for measuring insecticidal activity is well known in the art.See, for example, Czapla and Lang, (1990)
J.Econ.Entomol.83:2480-2485；Andrews etc., (1988) Biochem.J.252:199-206；Marrone etc.,
(1985) J.of Economic Entomology78:290-293 and U.S. Patent number 5,743,477, all these documents
It is incorporated by reference and is incorporated herein.In general, albumen is mixed and the measurement that is used to ingest.See, for example, Marrone etc.
(1985) J.of Economic Entomology78:290-293.Such measuring method may include by plant and one or more evils
Worm contact and the survival of measurement plant and/or the ability for promoting pest death.
As used herein, " insecticidal activity " refers to the activity of organism or substance (such as, such as albumen), regardless of organism
Whether living or substance is toxic or inhibits, and measurement can be through but not limited to Mortality of insect, pest weight loss, pest drive
Other behaviors of pest and object after keeping away property (repellency), pest growth retardation and feed and the appropriate long-time of exposure
Reason variation.Thus, organism or substance with insecticidal activity negatively affect at least one measurable pest health parameters.
Equally, when " insecticidal activity " refers to that pest is insect " insecticidal activity "." hindering growth and development " refers to greater than 50% by weight
The growth inhibition of amount.For example, " insecticidal proteins " are itself display or show the albumen of insecticidal activity with other protein combinations.Monitoring
The general procedure of insecticidal activity includes in the food source that tentative compound or organism are added in sealing container.It comments
The test of valence insecticidal activity is well known in the art.See, for example, U.S. Patent number 6,570,005 and 6,339,144, document is complete
Text is herein incorporated by reference.Insect of interest be used for test insecticidal activity the best stage of development be larva or not at
Ripe insect.Insect can complete darkness, 20~30 DEG C and 30%~70% relative humidity under raise.Bioassay can be with
According to Czapla and Lang (1990) J.Econ.Entomol.83 (6): the description of 2480-2485 is operated.Raise insect children
The method of worm and the method for bioassay are known to one of ordinary skill in the art.
The toxicity and inhibiting effect of insecticidal protein include but is not limited to, compared with feeding wild plant, feeding transgenosis
Plant hinders larva growth and development, kills worm's ovum or larva, the weight for mitigating adult or larva；Induction insect's food-taking is built
The avlidance behavior of nest or breeding.Plant resist it is insects can have by the nucleic acid sequences of encoding insecticidal proteins introduce organism or
Insecticidal substance is applied to organism (a part of such as plant or plant) and is assigned, wherein insecticidal substance includes but is not limited to
Insecticidal protein.As utilized herein, " control pest population " or " control pest " refer to damage caused by limitation pest to evil
Any influence of worm.Control pest includes but is not limited to the fertility or development kill off the insect pests, inhibit pest development, changing pest
So that pests on plants generates smaller damage, reduces pest and generate the quantity of offspring, generate hypogenetic pest, generation
Pest is easier that pests plant is attacked or prevented by predator.
Method:
Method includes but is not limited to: for enhancing the method for plant resistance to insect, the method for evaluating plant resistance to insect, using
In the method for control insect population, method for killing insect population, for controlling insect population to insecticidal polypeptide resistance
Method, and the method for being used to prepare seed.
Method includes but is not limited to following method:
The method of transformed cells includes with any isolated polynucleotides transformed cells of the invention.It also include by this
The cell of method conversion.In a particular embodiment, the cell is eukaryocyte, such as yeast, insect or plant cell, or
Prokaryotic cell such as bacterial cell.
The method for generating genetically modified plants comprising with any isolated polynucleotides or recombinant DNA construction of the invention
Plant cell regenerating plants of the body to convert plant cell and by converting.The present invention also relates to what is prepared by this method to turn
Gene plant, and the transgenic seed obtained from the genetically modified plants.
Method for separating polypeptide of the present invention from cell or cell culture medium, wherein the cell includes to have this hair
The recombinant dna construct of bright polynucleotides, the recombinant dna construct include that polynucleotides of the invention are operably connected to
At least one regulating and controlling sequence, and the host cell wherein converted is grown under conditions of being suitable for recombinant dna construct expression.
Change the method for polypeptide expression level of the present invention in host cell, comprising: (a) is with recombinant DNA construction of the invention
Body converts host cell；And (b) make the cell growth of conversion under conditions of being suitable for and expressing the recombinant dna construct,
The expression of middle recombinant dna construct causes the content of peptides of the present invention in the host cell of conversion to change.
The method for enhancing plant resistance to insect, includes (a) importeding into recombinant dna construct in reproducible plant cell,
The recombinant dna construct includes to be operably coupled to less a kind of regulating and controlling sequence (such as functional promoter in plant)
Polynucleotides, wherein the polynucleotide encoding polypeptide, the amino acid sequence that the polypeptide has with SEQ ID NO:6,9
Or 12 have at least 50% when being compared, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%,
61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%,
76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity；(b) in step
(a) after, by the reproducible plant cell regenerating plants, wherein the genetically modified plants are wrapped in its genome
It is shown containing the recombinant dna construct, and when being compared with the check plant for not including the recombinant dna construct
The insect resistace of enhancing.The method may also include (c) and obtain the progeny plant for deriving from the genetically modified plants, wherein the son
In its genome include recombinant dna construct for plant, and with do not include the recombinant dna construct check plant
The insect resistace of enhancing is shown when being compared.
The method for enhancing plant resistance to insect, includes (a) importeding into recombinant dna construct in reproducible plant cell,
The recombinant dna construct includes the polynucleotides for being operably coupled to less a kind of heterologous regulatory element, wherein the multicore
Thuja acid encoding D N-ITP3, DN-ITP4 or DN-ITP5 in plant；(b) base is turned by the aftergrowth cytothesis of step (a)
Because of plant, wherein genetically modified plants include DNA construct in its genome, in genetically modified plants DN-ITP3, DN-ITP4 or
The expression of DN-ITP5 polypeptide increases, and the pest-resistant of enhancing is shown when compared with the check plant for not including DNA construct
Property.This method further includes that (c) obtains the progeny plant for being derived from genetically modified plants, wherein the progeny plant wraps in its genome
Containing DNA construct, there is increased DN-ITP3, DN-ITP4 or DN-ITP5 polypeptide of expression quantity, and be free of DNA construct
Check plant compared to showing increased insect resistace.
In some embodiments, the method for controlling pest is included in overexpression DN-ITP3, DN-ITP4 or DN- in plant
ITP5 polypeptide, in some embodiments, the method for controlling pest include with DNA construct conversion plant of the invention or plant
Cell.
In some embodiments, the method to kill off the insect pests is included in overexpression DN-ITP3, DN-ITP4 or DN- in plant
ITP5 polypeptide.In some embodiments, the method to kill off the insect pests includes with DNA construct conversion plant of the invention or plant
Cell.
The method for assessing plant resistance to insect includes: that recombinant dna construct is imported into renewable plant cell by (a), institute
Recombinant dna construct is stated to include a polynucleotides and be operably coupled to a few regulating and controlling sequence (such as in plant with it
Functional promoter), wherein the amino acid sequence of the polypeptide of the polynucleotide encoding compares with SEQ ID NO:6,9 or 12
Compared with when, have at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%,
62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%,
77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity；(b) step (a) it
Afterwards, by the reproducible plant cell regenerating plants, wherein the genetically modified plants include institute in its genome
State recombinant dna construct；(c) genetically modified plants insect resistace is assessed compared with the check plant for not including recombinant dna construct.
This method can further comprise that (d) obtains the progeny plant for being derived from genetically modified plants, and wherein progeny plant wraps in its genome
Containing recombinant dna construct；(e) insect resistace of progeny plant is assessed compared with the check plant for not including recombinant dna construct.
Seed bearing method is produced, this method includes any above-mentioned method, and further includes obtaining from the progeny plant
Seed, wherein the seed includes the recombinant dna construct in its genome.
In some embodiments, the seed in the present invention includes recombinant dna construct of the invention in its genome.
Seed treatment:
In order to protect and improve yield yield and character technology, seed treatment option can provide additional crop plan spirit
Activity simultaneously effectively controls insect, weeds and disease.One or more insecticidal proteins disclosed herein or polypeptide processing kind can be used
Sub- material, such as seed is handled with above-mentioned seed treatment, the seed is the transgenic corns containing transgene traits, greatly
Beans, rape, cotton or rice.One or more insecticidal proteins or polypeptide disclosed herein can be traditional with other seed treatment
Agent is applied in combination.Can with include chemistry or biological weed killer, herbicide-safener, insecticide, fungicide, Germination suppression agent
With reinforcing agent, nutrient, plant growth regulator and activator, bactericide, nematicide, avicide and/or to kill software dynamic
The composition of agent, handles seed material, is usually surface-treated.These compounds are usually and in formulation art
The auxiliary agent of other carriers, surfactant or the promotion application that usually use is prepared together.Coating can be by with liquid preparation
Dipping propagation material is implemented by being coated with the wet or dry preparation of mixing.It can be used as the various types chemical combination of seed treatment
The example of object is by the The published by British Crop protective committee (British Crop Production Council)
Pesticide Manual:A World Compendium, C.D.S.Tomlin Ed. (" Pesticide Manual: world's outline ",
C.D.S.Tomlin is edited) in provide, place is incorporated by reference the document accordingly.
The some seed treatments that can be used on crop seed include but is not limited to following one or more: abscisic acid,
My acid benzene-S-methyl, avermectin, Amrol, oxygen ring azoles, azospirillum, nimbin, Fluoxastrobin, bacillus object
Kind (including bacillus cereus, bacillus firmus, bacillus megaterium, bacillus pumilus, Bacillus sphaericus, withered grass
One of bacillus and/or bacillus thuringiensis are a variety of), Bradyrhizobium species (bradyrhizobium
Spp.) (including bacillus cereus, bacillus firmus, Erichsen raw rhizobium, Xi Biaodao raw rhizobium, big slowly slowly
Beans raw rhizobium, Liaoning raw rhizobium, pachyrhizus raw rhizobium and/or Yuanmingyuan Park one of raw rhizobium or more slowly slowly slowly slowly
Kind), captan, carboxin, chitosan, clothianidin, copper, cyanogen insect amide, difenoconazole, Grandox fumigant (etidiazole), fluorine
Worm nitrile, fluoxastrobin, Fluquinconazole, solves careless amine, fluxofenim, super quick albumen, imazalil, imidacloprid, kind bacterium azoles, different Huang at fludioxonil
Ketone (isoflavenoids), rouge chitosan oligosaccharide, Mancozeb, manganese, maneb, Metalaxyl-M, metalaxyl, metconazole, nitrile bacterium azoles,
PCNB, penflufen-containing, Penicillium, pyrrole metsulfovax, Permethrin, ZEN 90160, prothioconazoles, pyraclostrobin, chlorantraniliprole, S-
Isopropyl methoxalamine, saponarin, ring benzene pyrrole bacterium amine, TCMTB, Tebuconazole, thiabendazole, Diacloden, thiodicarb, thiram, methyl
Found withered phosphorus, Triadimenol, trichoderma, trifloxystrobin, triticonazole and/or zinc.PCNB seed pelleting refers to EPA number of registration 00293500419,
Containing pentachloronitrobenzene and according to getting profit.TCMTB refers to 2- (thiocyanomethylthio) benzothiazole.
Seed variety and seed with specific transgene traits can be tested to determine which kind of seed treatment option and apply
This veriety and transgene traits can be supplemented with rate to improve yield.For example, having good yield potentiality but there are silk dust-brands
The kind of sick neurological susceptibility, which can be benefited from, provides the use of the seed treatment of protection of anti-head smut, has good yield potentiality
But it can be benefited from there are the kind of cyst nematode neurological susceptibility and the use of the seed treatment of protection of anti-cyst nematode is provided, with this
Analogize.Similarly, the kind for covering the transgene traits of imparting insect-resistant can benefit from seed treatment is assigned second
Binding mode, the kind for covering the transgene traits of conferring herbicide resistance can benefit from seed treatment and enhancing plant to this
Safener of resistance of herbicide, etc..In addition, suitably building up and mentioning using caused good root system by seed treatment
Early emergence may make a kind or multiple kinds when in conjunction with seed treatment comprising specific trait to more efficiently use
Nitrogen resists the ability of arid more preferably and yield potentiality generally increases.
Genetically modified plants agriculture is determined in aforementioned arbitrary method or in any means of other embodiments disclosure herein
Skill character change the step of, if appropriate, may include determine under varying ambient conditions, with do not include recombinant dna construct
Check plant compare, whether genetically modified plants show the variation of at least one economical character.
Determine that transgenic progeny is planted in aforementioned arbitrary method or in any means of other embodiments disclosure herein
Object economical character change the step of, if appropriate, may include determine under varying ambient conditions, with do not include recombinant DNA structure
The check plant for building body is compared, and whether transgenic progeny plant shows the variation of at least one economical character.
It is described to be introduced into institute in step in aforementioned arbitrary method or in any means of other embodiments disclosure herein
Stating renewable plant cell may include healing cell, embryo's healing cell, gametid, meristematic cell or immature embryo
Cell.Renewable plant cell may originate from inbred corn plant.
In any means in aforementioned any means or other embodiments disclosed herein, the regeneration step can be wrapped
Include: (i) cultivates the plant cell of the conversion until growing callus on containing embryo trophic hormone culture medium；(ii) by step
(i) the conversion plant cell described in is transferred on the first culture medium containing organized trophic hormone；(iii) will be described in step (ii)
Conversion plant cell is inoculated on the second culture medium, develops the elongation of its stem, root development or both.
In any means of aforementioned any means or other embodiments disclosed herein, exist recombinant DNA construction
Body imports the alternative of aftergrowth cell, and the recombinant dna construct includes a polynucleotides and can operate with it
At least one regulating and controlling sequence of connection.For example, by regulating and controlling sequence, (such as one or more enhancers can be used as transposable element
A part) it imports in aftergrowth cell, it then screens regulating and controlling sequence and operationally encodes the endogenous of polypeptide with what is disclosed immediately
The transgenic event of gene connection.
The technology appropriate that recombinant DNA construction disclosed herein is imported to plant, include, but are not limited to direct DNA absorb,
Chemical treatment, electroporation, microinjection, cell fusion, transfection, carrier mediated DNA transfer, bombardment or Agrobacterium-medialed transformation.
Plant Transformation and regenerated technology describe in International Patent Publication No. WO 2009/006276, and entire contents are incorporated to as ginseng
It examines.
In addition, also there is the method for modifications and changes host's endogenous gene group DNA, including change host's natural DNA sequence or
The precursors transgenic sequence such as controlling element, coding or non-coding sequence.These methods can be used for for nucleic acid sequence being targeted to
Target identification sequence is transformed in genome.Such as this paper transgenic modification cell or plant use traditional genetic engineering core
Sour enzyme generates (such as WO 2009/114321 as generated the playback endonuclease of modified plant genome；Gao etc. (2010)
Plant Journal 1:176-187).Other site-directed engineerings are the limitations by using Zinc finger domain identification coupling
Property restriction endonuclease restricted feature modify endogenous gene (such as Urnov etc. (2010) Nat Rev Genet.11 (9): 636-46；
Shukla etc. (2009) Nature 459 (7245): 437-41).Activating transcription factor is similar-DNA modification enzyme
(transcription activator-like effector-DNA modifying enzyme, TALE or TALEN) is available
In genetic engineering modified plant genome, see, for example, US20110145940, Cermak etc. (2011) Nucleic Acids
(2009) such as Res.39 (12) and Boch, Science 326 (5959): 1509-12.Plant Genome pointed decoration can also make
With bacterium II type CRISPR (repetitive sequence of the short palindrome at the interval of the rule of cluster, clustered regularly
Interspaced short palindromic repeats)/Cas (CRISPR related protein, CRISPR-associated)
System, see, for example Belhaj etc. (2013), Plant Methods 9:39.CRISPR/Cas system can permit customized
The genomic DNA of small non-coding RNA guidance targets cutting.
Those skilled in the art is familiar with the gene-transformed plant of coding expectation polypeptide and the method for cultivating aftergrowth.
Aftergrowth can generate homozygous transgenic plant, or the agronomy that the pollen of aftergrowth and seed are grown with self-pollination
The pollen of the important plant of important plant hybridization or agronomy hybridizes with regenerated genetically modified plants.Those skilled in the art
The known method for cultivating the genetically modified plants disclosed herein containing desired polypeptide of member.
The stacking of character in genetically modified plants
Genetically modified plants may include one or more insecticidals disclosed herein or anti-insect polynucleotides and can lead
The stacking for the polynucleotides for causing the one or more of generation or the inhibition of multiple polypeptide sequences other, can pass through traditional breeding way
Or the genetically modified plants of the stacking comprising polynucleotide sequence are obtained by genetic engineering method.These methods include but is not limited to
The independent strain for respectively containing polynucleotides of interest is cultivated, turns base comprising gene disclosed herein with subsequent gene conversion
Because of plant, and by gene cotransformation into single plant cell.As used herein, term " stacking " includes having to be present in together
(for example, two kinds of characters mix in Matrix attachment region, a kind of character mixes Matrix attachment region to two or more characters in one plant
In and a kind of character incorporation plastid genome in or two kinds of characters mix in the genome of plastid).It is unrestricted at one
Property example in, " stack character " molecular stacks physically adjacent one another comprising sequence.Character as used herein, which refers to, to be derived from
The phenotype of particular sequence or sequence group.The single conversion carrier comprising multiple genes can be used or be individually carried on multiple loads
Gene on body carries out the cotransformation of gene.If sequence is stacked by genetic transformation plant, polynucleotides of interest
Sequence can be combined in any order at any time.Can with cotransformation scheme by character and polynucleotides of interest simultaneously
It introduces, the polynucleotides are provided by any combination of conversion box.For example, if two sequences will be introduced, can by this two
Sequence is included in (trans-) in individual conversion box or is included in same conversion box (cis-).Can by identical promoters or
Different promoters drive the sequence expression.In some cases, it may be desirable to introduce the table that can inhibit polynucleotides of interest
The conversion box reached.This can inhibit any combination of box or overexpression box to be combined needed for the generation in plant with other
Character combination.It is also recognized that site-specific recombination system can be used to stack polynucleotide sequence in required genomic locations.
See, e.g., WO 1999/25821, WO1999/25854, WO 1999/25840, WO 1999/25855 and WO 1999/
25853, above-mentioned patent is hereby incorporated herein by.
Embodiment
The specific implementation of this paper is further shown in following Examples.In these examples, unless stated otherwise, using taking the photograph
Family name/metric system.In these examples, only with the specific implementation process of illustration.Pass through discussed above and specific example, this field
Professional can find out essential characteristic of the invention, by various changes and modifications apply the present invention to various uses and
Condition, without departing from main body of the present invention and range.Therefore, other than the various modifications that this patent is stated and is discussed, in the art
The modification without departing from present subject matter made of professional will also fall within the scope of the claim of this patent.
The building in 1. rice of embodiment activation tagged mutant library
This research is inserted into binary vector using the T-DNA containing 4X CaMV 35S enhancer, is supported the army using woods and Zhang Qifa
No. 11 rice (Oryza sativa L.) (Lin and Zhang ((2005) Plant is spent in the Agrobacterium-mediated transformation of description
Cell Rep.23:540-547), building rice activates tagged mutant library.In spend No. 11 rice be the Chinese Academy of Agricultural Sciences make
What object research institute cultivated, we obtain first seed from Beijing Wei Mingkaituo agricultural biotechnologies company.It is inserted into using T-DNA
The callus that No. 11 rice embryonal inductions are spent in binary vector conversion, generates transgenic line seedling, the transgenic seed structure of harvest
At mutant library.
The screening of embodiment 2. is with the enhancing of (Ostrinia furnacalis) resistance of Ostrinia furnacalis under the conditions of identification experiment room
Seedling strain
Ostrinia furnacalis (ACB, Ostrinia furnacalis (Guen é e)) is the important insect pest of Asia corn,
China's Mainland, Australia and Saloman island are widely distributed in, in its North zone, annual moth can generate one and arrive several generations,
It is continuous between tropical area, generation and is overlapped.Caterpillar leads to corn yield by damage seed and feeding fringe, leaf and stem
Loss is serious, and caterpillar is mainly in the survival of the reproductive organs part of plant and growth.Other industrial crops caused harm include capsicum,
Ginger and sorghum.Recently, Ostrinia furnacalis seems to have become the important pests of cotton, and some ruderals also become Asia corn
Host (D.M.Nafusa the and I.H.Schreinera.2012.Review of the biology and control of of snout moth's larva
The Asian corn borer, Ostrinia furnacalis (Lep:Pyralidae) Tropical Pest
Management.37:41-56)。
Ostrinia furnacalis, which be used to identify, can inhibit the rice ATL, ACB of larvae development to raise population from Chinese agriculture section
Population is raised in institute's Plant Protection Institute room, indoors 25~27 DEG C of temperature, relative humidity 60%~80%, photoperiod 16L:
It is more than generation that 10 are raised under the conditions of 8D.Larva manually feed raising (Zhou great Rong, Ye Zhihua, Wang Zhenying, 1995), Adult worms producting eggs
Afterwards, ovum paper is stored in 27 DEG C of incubators and is hatched, using newly hatched larvae as test worm.
In addition to other explanations, T2 is used for insect-resistant for transgenic seed (seed to glow under green fluorescence lamp)
Test.Each activation label strain (ATL) takes 150 seeds, after 32 DEG C of 800ppm carbendazim sterilize 8h, rinses 3~5 times,
Then seed is placed in the culture dish of layer overlay wet gauze (12x12cm).The seed distilled water of germination is cultivated at 28 DEG C
At 10 days, 8~10cm of height of seedling can be used to test.
Screening technique:
Tester is used as with 32 orifice plates (every hole 4cm x 4cm x 2cm, Pitman, N.J.USA-609-582-2392)
1% agar moisturizing is added in material in every hole, and agar amount is about 1/3 pore volume.32- orifice plate is divided into 8 regions, each region 4
The same ATL seedling is inserted into a hole.It is inserted into the agar in each hole after 20 plants of rice seedling removal roots and seed, then makes
6 corn borer newly hatched larvaes are accessed in seedling with writing brush, cover special membrane cover (Pitman, N.J.USA-609-582-
2392).ZH11-TC (ZH11 of tissue cultures) is used as control, and control rice seedlings are randomly placed on the different zones of 32 orifice plates.It will dress
There are 32 orifice plates of rice seedling and Ostrinia furnacalis larvae, is placed in 27 DEG C, is cultivated in the environment of relative humidity 60%, from second
32- orifice plate is rotated by 90 ° by its beginning daily.After 5 days, the developmental condition of visual observations ACB, and calculate resistance value.
After 5 days, every every hole of strain takes 3 maximum larvas, compares with larva in the control hole ZH11-TC, is provided according to table 2
Resistance value.If the normal development of control wells larva, to three ages, larvae development state is normal in the hole ATL, then the resistance value of ATL is
0；If larvae development is to two ages in the hole ATL, larva is smaller than control larvae, then the resistance value of ATL is 1；If the hole ATL
Middle larvae development is to an age, larva very little in the hole ATL, then the resistance value of ATL is 2.
Larva growth inhibition ratio is an index of Ostrinia furnacalis resistant proof, refers to and inhibits number divided by the total borer population of statistics
Percentage, wherein inhibiting number is the summation for being added the observation of 12 test worms in 4 holes；It counts total borer population and refers to and observe
The summation that is added with the quantity of first-instar young of the quantity of all worms.Statistical analysis is carried out using Chi-square test, when P < 0.01
It is positive to be denoted as Ostrinia furnacalis resistance.
The grade scale of 2 corn borer of table test marking
Asia com-borer resistant positive strain can further screen (the second wheel screening and third round sieve in first round screening
Choosing), every wheel one to repeating twice, and screening is considered as Ostrinia furnacalis resistance strain for the ATLs of the positive three times.
The selection result:
1) AH34721 seedling
After Ostrinia furnacalis newly hatched larvae is inoculated into rice seedling 5 days, ZH11-TC seedling is obviously damaged by ACB, and
The damaged lesser extent of AH34721 seedling, and the larva of feeding AH34721 seedling is smaller than the larva of feeding ZH11-TC.Such as table
Shown in 3, in first round screening, 5 hairs are educated to two ages, larva in 6 corn borers of feeding AH34721 strain rice seedling
Growth is suppressed, and all 12 larva whole normal developments of feeding control ZH11-TC are to three ages.AH34721 seedling
Larva growth inhibition ratio be 83.33%；The larva that the larva growth inhibition ratio of ZH11-TC seedling is 0.00%, AH34721 is raw
Long inhibiting rate, which is noticeably greater than, compares ZH11-TC (P < 0.01), these are the result shows that AH34721 seedling inhibits Ostrinia furnacalis
The development of larva.In second wheel screening, the larva growth inhibition ratio of AH34721 seedling is respectively 50.00% and 16.67%, and
The larva growth inhibition ratio of control is 0.00%, therefore the larva growth inhibition ratio of AH34721 is significantly higher than control ZH11-TC children
Seedling.The larva growth inhibition ratio of AH34721 third round screen once repeat in show same trend, it is heavy at another
AH34721 seedling shows slightly higher larva growth inhibition ratio in multiple.In conclusion AH34721 seedling hinders Ostrinia furnacalis
Development of the larva to adult.
Ostrinia furnacalis test of table 3.AH34721 seedling under the conditions of laboratory screening
2) AH31052 seedling
After Ostrinia furnacalis newly hatched larvae is inoculated into rice seedling 5 days, ZH11-TC seedling is obviously damaged by Ostrinia furnacalis
Evil, and the damaged lesser extent of AH31052 seedling, and larva of the larva than feeding ZH11-TC of feeding AH31052 seedling
It is small.Table 4 illustrates the selection result of AH31052 seedling three-wheel test, in first round screening, feeding AH31052 rice seedling
9 corn borers in 6 hairs educate to two ages, and 12 larva normal developments of feeding ZH11-TC seedling are to three ages.
The larva growth inhibition ratio of AH31052 seedling (66.67%) is significantly higher than ZH11-TC seedling (P < 0.01).The result shows that
AH31052 seedling inhibits the development of Ostrinia furnacalis larvae.In second wheel screening, the larva growth inhibition ratio of AH31052 exists
It is respectively 91.67% and 44.44% in repeating twice, is significantly higher than corresponding control ZH11-TC larva growth inhibition ratio.Third round
In test, larva growth inhibition ratio of the AH31052 seedling in repeating twice is all remarkably higher than corresponding control ZH11-TC children
Seedling.The above results understand the consistent development for showing AH31052 seedling and capable of hindering Ostrinia furnacalis larvae, and AH31052 is sub-
Continent com-borer resistant strain.
Ostrinia furnacalis test of table 4.AH31052 seedling under the conditions of laboratory screening
3) AH36183 seedling
After Ostrinia furnacalis newly hatched larvae is inoculated into rice seedling 5 days, ZH11-TC seedling is obviously damaged by Ostrinia furnacalis
Evil, and the damaged lesser extent of AH36183 seedling, and larva of the larva than feeding ZH11-TC of feeding AH36183 seedling
It is small.Table 5 illustrates the selection result of AH36183 seedling three-wheel test, in first round screening, feeding AH36183 rice seedling
6 corn borers in 4 hairs educate to two ages, and 12 larva normal developments of feeding ZH11-TC seedling are to three ages.
The larva growth inhibition ratio of AH36183 seedling (66.67%) is significantly higher than ZH11-TC seedling (P < 0.01).The result shows that
AH36183 seedling inhibits the development of Ostrinia furnacalis larvae.In second wheel screening, the larva for repeating middle AH36183 twice is raw
Long inhibiting rate is respectively 50% and 66.67%, is significantly higher than corresponding control ZH11-TC larva growth inhibition ratio.Third round test
In, the larva growth inhibition ratio of AH36183 seedling is significantly higher than control ZH11-TC seedling.The above results understand consistent show
AH36183 seedling can hinder the development of Ostrinia furnacalis larvae, and AH36183 is Ostrinia furnacalis resistance strain.
Ostrinia furnacalis test of table 5.AH36183 seedling under the conditions of laboratory screening
AH34721, AH31052 and AH36183 seedling can significantly inhibit the growth and development of Ostrinia furnacalis.
According to the above results, the insect resistace base that can be improved in AH34721, AH31052 and AH36183 seedling has been separated
Cause.
The identification of the activation label gene of embodiment 3.
This research uses T- in following standardization program identification insect resistace AH34721, AH31052 and AH36183 rice strain
DNA insertion point flanking gene, (1) plasmid rescue method (Friedrich J.Behringer and June I.Medford.
(1992), Plant Molecular Biology Reporter Vol.10,2:190-198) and (2) inverse PCR method
(M.J.McPherson and Philip Quirke. (1991) PCR:a practical approach, 137-146).For multiple
The strain of miscellaneous and poly T-DNA insertion, plasmid rescue and inverse PCR cannot effectively identify candidate gene, in this case, other
Program such as TAIL PCR (Liu et al. (1995), Plant is J.8:457-463) can identify the time near T-DNA insertion point
Select gene.
Successful sequencing result is that wherein single DNA segment contains T-DNA border sequence and rice flanking genomic sequence,
Once obtain T-DNA insertion point flanking genomic sequence label, can by being compared with disclosed Rice Genome Sequence,
Identify candidate gene.It concretely, is the candidate of activation near CaMV 35S enhancer element/T-DNA RB annotation gene
Gene.
In order to confirm that the gene of identification is strictly neighbouring T-DNA, and a possibility that DNA fragmentation is chimeric pseudo-clone is excluded,
Diagnosis PCR is carried out to genomic DNA with oligonucleotides in a T-DNA and a genomic DNA special oligonucleotide fragment
Analysis.The genomic samples that generation PCR product can be expanded are considered the insertion for having T-DNA.This analysis is it can be identified that same
Situation containing more than one T-DNA insertion point in one strain.For example, plasmid rescue and/or inverse PCR analyze and identify is
It is no to have multiple and different genomic fragments.
Using CTAB method (Murray, M.G. and W.F.Thompson. (1980) Nucleic Acids Res.8:4321-
4326) genomic DNA is extracted from AH34721, AH31052 and AH36183 rice strain blade.
T-DNA insertion point flanking sequence is obtained by molecular engineering.
In AH34721 rice, near No. 8 chromosome 265276bp of T-DNA insertion (MSU7.0http: //
Rice.plantbiology.msu.edu/index.shtml), the nucleotides sequence of the flanking sequence in AH34721 on the right side of T-DNA
Column are as shown in SEQ ID NO:1.
In AH31052 rice, near the 35720473bp of T-DNA No. 1 chromosome of insertion (MSU7.0http: //
Rice.plantbiology.msu.edu/index.shtml), in AH31052 on the left of T-DNA flanking sequence nucleotide sequence
As shown in SEQ ID NO:2.
In AH36183 rice, near the 318723bp of T-DNA No. 12 chromosome of insertion (MSU7.0http: //
Rice.plantbiology.msu.edu/index.shtml), in AH36183 on the right side of T-DNA flanking sequence nucleotide sequence
As shown in SEQ ID NO:3.
For OsDN-ITP3 gene adjacent to the T-DNA insertion point of AH34721 rice strain, OsDN-ITP4 gene is neighbouring
The T-DNA insertion point of AH31052 rice strain, OsDN-ITP5 gene are inserted into position adjacent to the T-DNA of AH36183 rice strain
Point, therefore three genes are cloned, and verify whether its function can improve insect resistace and other economical characters.
The clone of 4. anti insect gene of embodiment and the building for being overexpressed construct
According to the sequence of gene I/D LOC_Os08g01400.1, LOC_Os01g61750.1 and LOC_Os12g01540.1
Information, design primer, and cloning rice anti insect gene.Table 6 illustrates the length of primer sequence and desired amplification gene.
OsDN-ITP3cDNA is cloned as template using the middle library cDNA for spending No. 11 Rice Leafs, stem and root mixing, with ZH11 rice
Genomic DNA is the gDNA that template clones OsDN-ITP4 and OsITP5.PCR reaction mixture and PCR program are as shown in Table 7 and 8.
The primer of the clone's anti insect gene of table 6.
Table 7.PCR reaction mixture
The PCR cycle situation of the clone's anti insect gene of table 8.
Pcr amplification product is recycled after agarose gel electrophoresis separation using pillar kit, and is connected with TA cloning vector
It connects.By the way that the nucleic acid sequence for determining PCR product and the direction in construct is sequenced, then gene cloning to plant binary is carried
In body DP0158 (pCAMBIA1300-DsRed, publication number: WO 2016/0002373).The nucleotide cloned in DP1439 carrier
The coded sequence of sequence and OsDN-ITP3 are as shown in SEQ ID NO:4 and 5, the amino acid sequence of OsDN-ITP3 such as SEQ ID
Shown in NO:6；The coded sequence of the nucleotide sequence and OsDN-ITP4 cloned in the DP1455 carrier such as institute of SEQ ID NO:7 and 8
Show, the amino acid sequence of OsDN-ITP4 is as shown in SEQ ID NO:9；The nucleotide sequence and OsDN- cloned in DP1458 carrier
The coded sequence of ITP5 is as shown in SEQ ID NO:10 and 11, and the amino acid sequence of OsDN-ITP5 is as shown in SEQ ID NO:12.
The conversion of embodiment 5. obtains transgenic paddy rice strain
Over-express vector and empty carrier (DP0158) using woods support the army with Zhang Qifa ((2005) Plant Cell Rep.23:
540-547) describe mediated by agriculture bacillus method be transformed into spend No. 11 rice (Oryza sativa L.).Transformation experiment room
The T0 of acquisition is transplanted to field water Tanaka for transgenic seedlings and is obtained T1 seed, and T1 and T2 are for seed storage in Cool Room 4 DEG C.It crosses
It is transgenosis kind that expression vector, which contains DsRED and HYG gene, T1 and T2 to issue red fluorescence in green fluorescence lamp for seed,
Son, and it is used for following Insect resistance assay.
Gene expression analysis in transgenic rice plant:
Using standard real-time RT-PCR program such as derived from'sReverse transcription reagent box and reality
When RT-PCR (SYBRRPremix Ex TaqTM, precious biology) and the expression of gene in analysis transgenic rice plant.EF1 α base
Show that transgenic paddy rice and the amplification of check plant are similar with applied sample amount because being used as internal reference.EF1 α mRNA level in-site is used for specification gene
Expression quantity.
Relative expression's water of OsDN-ITP3 gene in different DP1439 rice strains blade is measured using real-time PCR analysis
Flat, compared with ZH11-TC, the expression of OsDN-ITP3 gene floats between 754-2598 times, OsDN-ITP3 gene
The primer of real-time RT-PCR measurement is as shown below:
DP1439-F1:CTCATCTCCACCTGCACTC(SEQ ID NO:19)
DP1439-R1:CGGAACTCGTACATCAGGATG(SEQ ID NO:20)
Relative expression's water of OsDN-ITP4 gene in different DP1455 rice strains blade is measured using real-time PCR analysis
It is flat, 1.00 are set by the expression quantity of OsDN-ITP4 in DP1455.01, compared with DP1455.01, OsDN- in other strains
The expression of ITP4 gene floats between 1.97-6.79 times, transgenosis water of the OsDN-ITP4 gene in nearly all test
The primer of overexpression in rice strain, real-time RT-PCR measurement is as shown below:
DP1455-F1:5'-CGGTTGGGTGACAGTATCAG-3'(SEQ ID NO:21)
DP1455-R1:5'-GCCCATTTCGTAGCAAACATC-3'(SEQ ID NO:22)
Relative expression's water of OsDN-ITP5 gene in different DP1458 rice strains blade is measured using real-time PCR analysis
It is flat, 1.00 are set by the expression quantity of OsDN-ITP5 in ZH11-TC, compared with ZH11-TC, OsDN-ITP5 in transgenic line
The expression of gene floats between 180-1236 times, transgenic paddy rice strain of the OsDN-ITP5 gene in nearly all test
Overexpression in system.
DP1458-F1:TGAACATTTTCGTGCAATGGG(SEQ ID NO:23)
DP1458-R1:AGGCAAGTGATACCCTCATTG(SEQ ID NO:24)
The Ostrinia furnacalis test of embodiment 6.OsDN-ITP3 transgenic rice plant in laboratory conditions
The pest-resistant character of AH34721T-DNA insertion mutation body can be reappeared in order to investigate OsDN-ITP3 transgenic paddy rice,
OsDN-ITP3 transgenic paddy rice is initially used for Ostrinia furnacalis test.The method for breeding of corn borer is as described in Example 2.
The T2 that DP1439 carrier generates is used for the test for plant, is tested three times, every time 4 to 6 repetitions, ZH11-
TC and DP0158 seedling is used as control.10 transgenic lines of this verification experimental verification, each strain take 450 seeds, referring to implementation
2 Aquaponic of example 10 days.It reappearing test and uses RANDOMIZED BLOCK DESIGN, the seedling of each strain is inserted into two holes of 32- orifice plate,
ZH11-TC and DP0158 seedling is inserted into six different holes of same plate.
One index of com-borer resistant test is larva growth inhibition ratio, refers to the inhibition number of larva divided by larva statistical number
Percentage, wherein larva inhibits number to refer to that the summation of resistance value in 8 or 12 holes, larva statistical number refer to observed larva number
With the summation of an instar larvae.
This test uses RANDOMIZED BLOCK DESIGN, and 10 transgenic lines of same construct, which tie up in a test unit, to carry out
Verifying considers that carrier, transgenic line and environmental effect evaluate gene function by SAS PROCGLIMMIX.If transgenosis
The larva growth inhibition ratio of rice plant is significantly higher than control (P < 0.05) in carrier levels and transgenic line level, then should
Gene is considered to have Ostrinia furnacalis resistance function.
Ostrinia furnacalis the selection result:
1) result of first time verification test
After Ostrinia furnacalis newly hatched larvae Inoculated Rice seedling 5 days, ZH11-TC and DP0158 rice seedling is obviously by corn
Snout moth's larva is caused harm, and OsDN-ITP3 transgenic seedlings are impaired relatively light, compared with the larva of feeding ZH11-TC and DP0158 control seedling,
The larva of feeding OsDN-ITP3 transgenic line seedling is relatively small.
10 OsDN-ITP3 transgenic lines are placed on a 32- orifice plate, while carrying out six repetitions.OsDN-ITP3
Transgenic Rice Seedlings are vaccinated with 720 corn borer newly hatched larvaes altogether, after co-culturing 5 days, 616 larvas are observed, wherein 7
In an age, 327 were in for two ages；In the hole of ZH11-TC seedling, 200 larvas are observed, wherein 91 were in for two ages
Phase；DP0158 seedling obtains similar as a result, 82 larvas were in for two ages.OsDN-ITP3 transgenic paddy rice, ZH11-TC pairs
It is respectively 57.74%, 45.50% and 42.71% according to the average larva growth inhibition ratio compareed with DP0158.OsDN-ITP3 turns
The larva growth inhibition ratio of trans-genetic hybrid rice is significantly higher than ZH11-TC control (value=0.0182 P) and is significantly higher than DP0158 control
(value=0.0032 P).These are the result shows that overexpression OsDN-ITP3 can significantly improve transgenic paddy rice in carrier levels
Com-borer resistant.
The horizontal further analysis result of transgenic line is shown in table 9.Compared with ZH11-TC and DP0158 is compareed, 7
A transgenic line shows higher larva growth inhibition ratio, and the larva growth inhibition ratio of 4 strains is significantly higher than ZH11-
TC and DP0158 compares seedling.These results further demonstrate that compared with the control, OsDN-ITP3 can be in transgenic line water
It is flat to improve Rice And Maize snout moth's larva resistance.
Table 9.OsDN-ITP3 transgenic paddy rice in laboratory conditions Ostrinia furnacalis test (transgenic line is horizontal, the
Primary test)
2) result of second of verification test
Same 10 OsDN-ITP3 transgenic lines are used in second of verification test, and 5 repetitions are arranged.Just incubate
It after larva inoculation, co-cultures 5 days, in the hole of OsDN-ITP3 transgenic paddy rice, 364 larvas is observed altogether, wherein 7 are in
One age, 184 were in for two ages；In ZH11-TC rice hole, 132 larvas are observed altogether, wherein 2 hairs were educated to an age,
47 hairs were educated to two ages；In DP0158 seedling hole, 2 are in an age, and 47 larvas were in for two ages.OsDN-ITP3 turns
The average larva growth inhibition ratio of trans-genetic hybrid rice, ZH11-TC and DP0158 is respectively 53.37%, 38.06% and 38.64%,
OsDN-ITP3 transgenic paddy rice larva growth inhibition ratio is significantly higher than ZH11-TC (value=0.0037 P) and DP0158 control (P value
=0.0053), these are the result shows that overexpression OsDN-ITP3 can be improved transgenic paddy rice in carrier levels in rice
Com-borer resistant.
The analysis result of transgenic line level shows that in table 10, the larva growth inhibition ratio of 9 transgenic lines is high
It is compareed in ZH11-TC and DP0158 seedling, and wherein the larva growth inhibition ratio of 4 transgenic lines is significantly higher than ZH11-TC
It is compareed with DP0158.The result of this test is identical as the result trend of first time verification test.These results further demonstrate that
Compared with the control, OsDN-ITP3 works in improving Rice And Maize snout moth's larva resistance.
Table 10.OsDN-ITP3 transgenic paddy rice in laboratory conditions Ostrinia furnacalis test (transgenic line is horizontal,
Second of test)
3) result of third time verification test
Third time verification test is arranged four repetitions and co-cultures 5 days, OsDN-ITP3 transgenosis water after newly hatched larvae inoculation
In the hole of rice, 394 larvas are observed altogether, wherein 1 is in an age, 174 were in for two ages；In ZH11-TC rice hole,
13 hairs were educated to two ages；In DP0158 seedling hole, 15 larvae developments to two ages.OsDN-ITP3 transgenic paddy rice,
The average larva growth inhibition ratio of ZH11-TC and DP0158 is respectively 44.56%, 10.40% and 11.54%, and OsDN-ITP3 turns
Trans-genetic hybrid rice larva growth inhibition ratio is significantly higher than ZH11-TC (value=0.0000 P) and DP0158 control (value=0.0000 P),
These are the result shows that can be improved transgenic paddy rice anti-in the corn borer of carrier levels by overexpression OsDN-ITP3 in rice
Property.
The analysis result of transgenic line level shows that in table 11, the larva of 10 transgenic lines of all tests is raw
Long inhibiting rate is significantly higher than the control of ZH11-TC and DP0158 seedling.These results are consistent to be shown compared with the control, OsDN-
ITP3 works in improving Rice And Maize snout moth's larva resistance.
Table 11.OsDN-ITP3 transgenic paddy rice in laboratory conditions Ostrinia furnacalis test (transgenic line is horizontal,
Third time is tested)
The Ostrinia furnacalis test of embodiment 7.OsDN-ITP4 transgenic rice plant in laboratory conditions
The pest-resistant character of AH31052T-DNA insertion mutation body can be reappeared in order to investigate OsDN-ITP4 transgenic paddy rice,
OsDN-ITP4 transgenic paddy rice is tested for Ostrinia furnacalis.Test method is as described in Example 6.
Ostrinia furnacalis the selection result:
1) result of first time verification test
After Ostrinia furnacalis newly hatched larvae Inoculated Rice seedling 5 days, ZH11-TC and DP0158 rice seedling is obviously by corn
Snout moth's larva is caused harm, and OsDN-ITP4 transgenic seedlings are impaired relatively light, compared with the larva of feeding ZH11-TC and DP0158 control seedling,
The larva of feeding OsDN-ITP4 transgenic line seedling is relatively small.
10 OsDN-ITP4 transgenic lines are placed on a 32- orifice plate, while carrying out six repetitions.Newly hatched larvae
After co-culturing 5 days, OsDN-ITP4 Transgenic Rice Seedlings observe 526 corn borer newly hatched larvaes altogether, wherein 19 are in one
Age, 205 were in for two ages；The average larva growth inhibition ratio of OsDN-ITP4 Transgenic Rice Seedlings is 44.59%.
In the hole of ZH11-TC seedling, 185 larvas are observed, wherein 1 is in an age, 65 were in for two ages；DP0158 seedling
Hole in, in 190 larvas observing, 1 is in an age, and 55 were in for two ages, and remaining 134 normal developments are arrived
Three ages.The larva growth inhibition ratio of ZH11-TC control and DP0158 control is respectively 36.02% and 29.84%.OsDN-
The larva growth inhibition ratio of ITP4 transgenic paddy rice is significantly higher than ZH11-TC control (value=0.0418 P) and DP0158 control (P
Value=0.0006).These are the result shows that overexpression OsDN-ITP4 can significantly improve transgenic paddy rice in the jade of carrier levels
Rice snout moth's larva resistance.
The horizontal further analysis result of transgenic line is shown in table 12.The larva growth inhibition of 5 transformation events
Rate is higher than 45%, is significantly higher than DP0158 control seedling, the larva growth inhibition ratio of remaining 5 transformation event is also above ZH11-
TC and DP0158 compares seedling.These the result shows that OsDN-ITP4 transgenic paddy rice inhibit Ostrinia furnacalis larva growth,
OsDN-ITP4 can improve transgenic paddy rice com-borer resistant in carrier levels and transgenic line level.
Table 12.OsDN-ITP4 transgenic paddy rice in laboratory conditions Ostrinia furnacalis test (transgenic line is horizontal,
It tests for the first time)
2) result of second of verification test
Same 10 OsDN-ITP4 transgenic lines are placed on a 32- orifice plate, and 4 repetitions are arranged.Newly hatched larvae
It after inoculation, co-cultures 5 days, in the hole of OsDN-ITP4 transgenic paddy rice, observes 371 larvas altogether, wherein 7 are in an age
Phase, 220 were in for two ages；The average larva growth inhibition ratio of OsDN-ITP4 transgenic paddy rice is 61.90%.ZH11-TC water
In rice hole, 44 hairs were educated to two ages；In DP0158 seedling hole, 49 larvas were in for two ages.ZH11-TC and DP0158 seedling
Average larva growth inhibition ratio be respectively 35.48% and 41.18%, OsDN-ITP4 transgenic paddy rice larva growth inhibition ratio
It is significantly higher than ZH11-TC (value=0.000 P) and DP0158 control (value=0.002 P), these are the result shows that excessive in rice
Expression OsDN-ITP4 can be improved transgenic paddy rice in the com-borer resistant of carrier levels.
The analysis result of transgenic line level shows that in table 13, the larva growth inhibition ratio of 10 transgenic lines is aobvious
The larva growth inhibition ratio write higher than the control of ZH11-TC seedling and 6 transgenic lines is significantly higher than DP0158 control.These
The result shows that OsDN-ITP4 transgenic paddy rice inhibits the growth of the larva of Ostrinia furnacalis, OsDN-ITP4 can be in carrier levels
Transgenic paddy rice com-borer resistant is improved with transgenic line level.
Table 13.OsDN-ITP4 transgenic paddy rice in laboratory conditions Ostrinia furnacalis test (transgenic line is horizontal,
Second of test)
3) result of third time verification test
It in third time test, after newly hatched larvae inoculation, co-cultures 5 days, in the hole of OsDN-ITP4 transgenic paddy rice, sees altogether
345 larvas are measured, wherein 7 are in an age, 107 were in for two ages；The average larva of OsDN-ITP4 transgenic paddy rice
Growth inhibition ratio is 34.38%.In ZH11-TC rice hole, 114 larvas are observed altogether, wherein 24 hairs were educated to two ages；
In DP0158 seedling hole, 113 larvas are observed altogether, wherein 2 hairs were educated to an age, 31 larvas were in for two ages.
The average larva growth inhibition ratio of ZH11-TC and DP0158 seedling is respectively 21.05% and 30.43%, OsDN-
ITP4 transgenic paddy rice larva growth inhibition ratio is significantly higher than ZH11-TC (value=0.0133 P) and and is higher than DP0158 control (P
Value=0.4791), these are the result shows that overexpression OsDN-ITP4 can be improved transgenic paddy rice in carrier levels in rice
Com-borer resistant.
The analysis result of transgenic line level shows that in table 14, the larva growth inhibition ratio of 4 transgenic lines is big
In 40%, and it is significantly higher than the control of ZH11-TC seedling.These are the result shows that OsDN-ITP4 transgenic paddy rice inhibits Asia corn
The growth of the larva of snout moth's larva, it is anti-that OsDN-ITP4 can improve transgenic paddy rice corn borer in carrier levels and transgenic line level
Property.
Table 14.OsDN-ITP4 transgenic paddy rice in laboratory conditions Ostrinia furnacalis test (transgenic line is horizontal,
Third time is tested)
The Ostrinia furnacalis test of embodiment 8.OsDN-ITP5 transgenic rice plant in laboratory conditions
The pest-resistant character of AH36183T-DNA insertion mutation body can be reappeared in order to investigate OsDN-ITP5 transgenic paddy rice,
OsDN-ITP5 transgenic paddy rice is tested for Ostrinia furnacalis.Test method is as described in Example 6.
Ostrinia furnacalis the selection result:
1) result of first time verification test
After Ostrinia furnacalis newly hatched larvae Inoculated Rice seedling 5 days, ZH11-TC and DP0158 rice seedling is obviously by corn
Snout moth's larva is caused harm, and OsDN-ITP5 transgenic seedlings are caused harm relatively gently, and the larva phase of seedling is compareed with feeding ZH11-TC and DP0158
Than the larva of feeding OsDN-ITP5 transgenic line seedling is relatively small.
10 OsDN-ITP5 transgenic lines are placed on a 32- orifice plate, while carrying out six repetitions.OsDN-ITP5
Transgenic Rice Seedlings are vaccinated with 720 corn borer newly hatched larvaes altogether, after co-culturing 5 days, 475 larvas are observed, wherein 2
In an age, 276 were in for two ages；In the hole of ZH11-TC seedling, 71 were in for two ages；DP0158 seedling obtains class
As a result, 56 be in two ages.What OsDN-ITP5 Transgenic Rice Seedlings, ZH11-TC control and DP0158 were compareed is averaged
Larva growth inhibition ratio is respectively 58.70%, 41.04% and 32.37%.The larva of OsDN-ITP5 transgenic paddy rice grows suppression
Rate processed is significantly higher than ZH11-TC control (value=0.0002 P) and DP0158 control (value=0.0000 P).These are the result shows that mistake
Amount expression OsDN-ITP5 can significantly improve transgenic paddy rice in the com-borer resistant of carrier levels.
The horizontal further analysis result of transgenic line is shown in table 15.The larva of the transgenic event of all tests
Growth inhibition ratio be higher than ZH11-TC and DP0158, the larva growth inhibition ratio of 5 transgenic events be significantly higher than ZH11-TC and
DP0158 compares seedling.These are the result shows that OsDN-ITP5 gene can improve transgenic paddy rice jade in transgenic line level
Rice snout moth's larva resistance plays a role.
Table 15.OsDN-ITP5 transgenic paddy rice in laboratory conditions Ostrinia furnacalis test (transgenic line is horizontal,
It tests for the first time)
2) result of second of verification test
Same 10 OsDN-ITP5 transgenic lines are used in second of verification test, and 3 repetitions are arranged.Just incubate
It after larva inoculation, co-cultures 5 days, in the hole of OsDN-ITP5 transgenic paddy rice, 305 larvas is observed altogether, wherein 3 are in
One age, 100 were in for two ages；In ZH11-TC rice hole, 98 larvas are observed altogether, wherein 12 hairs were educated to two ages；
In DP0158 seedling hole, 78 larvas are observed altogether, wherein 15 larvas were in for two ages.OsDN-ITP5 transgenic paddy rice,
The average larva growth inhibition ratio of ZH11-TC and DP0158 is respectively 34.42%, 12.24% and 19.23%, and OsDN-ITP5 turns
Trans-genetic hybrid rice larva growth inhibition ratio is significantly higher than ZH11-TC (value=0.0003 P) and DP0158 control (value=0.0247 P),
These are the result shows that can be improved transgenic paddy rice anti-in the corn borer of carrier levels by overexpression OsDN-ITP5 in rice
Property.
The analysis result of transgenic line level shows that in table 16, the larva growth inhibition ratio of 8 transgenic lines is aobvious
It writes and is higher than the control of ZH11-TC seedling, the larva growth inhibition ratio of 3 transgenic lines is significantly higher than DP0158 control.This examination
The result tested is identical as the result trend of first time verification test.These results further demonstrate that compared with the control, OsDN-ITP5
Gene works in improving Rice And Maize snout moth's larva resistance.
Table 16.OsDN-ITP5 transgenic paddy rice in laboratory conditions Ostrinia furnacalis test (transgenic line is horizontal,
Second of test)
Sequence table
<110>Wei Ming biological husbantry Group Co., Ltd
Pioneer overseas corporation
<120>plant of pest-resistant performance enhancement and it is related to the construct and method of insect-resistance gene
<130> RTS22593F
<160> 24
<170> SIPOSequenceListing 1.0
<210> 1
<211> 436
<212> DNA
<213>rice ()
<400> 1
atatatatat atatatatat atatatatat atatatatat atatattata tgcatgcaca 60
tacatggagt agtatacgac gaagatcgac catggtgatg agagcaggta caatagcagg 120
ctataagcca gctataacat attttaaaga gataaaggaa gagagagaag agcagcaggc 180
tacagatctg tagccagcta cagcacggac tctaaaacgt aacgtgtgta tgacaggttg 240
gactaggtgt taattatacg taagcaacta ttgtatgtat tagctattac attggttata 300
gatgatttga agctagtact gggctatact attaaacttg ctctgatgaa atgttccgcg 360
atgctaggag aaaaaggctg ccgatcattg catctactgt tactgattgt acatataaac 420
aagctgtgtg atcgat 436
<210> 2
<211> 619
<212> DNA
<213>rice ()
<400> 2
cgttttacaa tgtaagtcat tctagcattt cccacattca tattgatgtt agtgaatcca 60
gacatatata tctatctaga ttcattaaca acaacatgaa cgtgggaaat attagaatga 120
cttacattgt gaaacggagg aagtatctac aaatatctcg ccataaaaca gaggcgaaaa 180
ccatcaaatt tcgggactat aggatacaaa gttacaaact taatcaccac aaatcgccag 240
gcccatacaa catcgacaaa gatcattggt gtgggttggt ttctcattag gagtcttaga 300
taaatgaatc agtacttata aaaagtatac caaagttacg ctacaattac atcataattt 360
tattcaaagt tacatgaaag gtgttaaatg atcacactga attctaaaca ctacggcgac 420
tgcattgttg cccagcgccg tagtgggcat ggtgcacatc aaaacaactt cagccagcac 480
aaatctagat gaatatcaaa agtttaaata tcgaatgtaa tcgggcgaaa attatatcgc 540
tggaagtata gtatgtccgt cttatatata atatagtgag ggagtagcaa atccgataaa 600
acaatcacaa cactgagca 619
<210> 3
<211> 706
<212> DNA
<213>rice ()
<400> 3
cctctgcaat gaagatatcg agcacgaggt ggtcccagat aaggaacaat atgggctcgt 60
tctatgtgat gttagaatgc ccgcataggt tgtcgttgtc gtcgccgcta ccgccgctgc 120
cgaaccacaa cgaggagatg tggagaagcc agtcgacatc ctttgaggac ggtgtcgagc 180
atcaccaggg tgcgggagag agatggagag aaaaaaagag gaggaggagg aaggagagga 240
gagggagaga agggaggaga gaattatatg tggggctgta ttttgttttt gccatgcaag 300
tgtctagtca gcgtaagtgg accgagtcaa tttatcacgt caacggagcc aatccataca 360
tactgcggtt tttgcaagac caaagatgct atatttgggt ttattgttaa gggatgtatt 420
ttaaactcaa cgataagatg agatgagaga cgtgaagtgg acttttttcc aagactcctc 480
ttgtgtcttt cgagatggtt ccatggccgg ctgtgtttag tttctaaaat tggggagaag 540
ttagggaaac gttggtaatt ttgaaaaaaa attgaaaatt tatgtgtgta gaaaagtttt 600
ggatgtgatg tgatacgatg aaaagttgag agttgagaga agtttggtgt gaacaaaaaa 660
ggccggagtt gatgtgcaaa tagagagaag catatgctca tggcgc 706
<210> 4
<211> 973
<212> DNA
<213>rice ()
<400> 4
gctaaggatg atgaagaggt tctactcgtc gatcgggcag ggggtggagg cgctgcaccg 60
gagtctggcg gtcggcgaag tggggttcat gtcggcggcg ttcgtgcagc aggctgcggc 120
gctggtgcgg tcggtgcacg cgcagctgct ggaggtggtg gggaggctgc acctgccggc 180
gggggagagg tggctggacg agtacatgga cgagacctcc cgcctgtggg acgcctgcct 240
cctcgtccgc gccggcgcct ccgccctcca cgcctactcc gccgccgccg cccacgccat 300
ccaccacctc tacgaccatg acgacgacta catccacgcc gcccgcgcca tcaacgcccc 360
tcgccgccac gccgccggcc tcctccagga caaccgcgcc ctcctccacg acaacatcct 420
cgacccggcc tccctcctcc tcctcgacca ccgctccccg agggacctca acctcaacgc 480
cttcaacggc ttccgcgccc tcctctacgc cctccgcaac gccacctcct tcctcctcgc 540
catcctcctc tctgccaccg tctcctcctg cctccccgac cacctcatct ccacctgcac 600
tccccttccc ctgcccaccg cacccggcta cgcctcctcc atggctcgcc tccgccaccg 660
cgtcgcccag gagatgcgcg ccctcgccgc ccccgccgcc gacggcatcc tgatgtacga 720
gttccgccag gccagggccg ccatcgacag cctcaaggcc gacctcgaca gggtcgtcgc 780
caccggcacc ggctacgccc accgggagga catggccgag agggcccacc tcgtcaaagg 840
ctgcctcgcc atgctcagct ccggcgccga ggccgtcatc gccgagctcg acgacttgtt 900
cgatgacatt gtcgagggca ggaagatgct ctccgacctc tgcagccacc gctgatccaa 960
agtctaatcc aga 973
<210> 5
<211> 948
<212> DNA
<213>rice ()
<400> 5
atgatgaaga ggttctactc gtcgatcggg cagggggtgg aggcgctgca ccggagtctg 60
gcggtcggcg aagtggggtt catgtcggcg gcgttcgtgc agcaggctgc ggcgctggtg 120
cggtcggtgc acgcgcagct gctggaggtg gtggggaggc tgcacctgcc ggcgggggag 180
aggtggctgg acgagtacat ggacgagacc tcccgcctgt gggacgcctg cctcctcgtc 240
cgcgccggcg cctccgccct ccacgcctac tccgccgccg ccgcccacgc catccaccac 300
ctctacgacc atgacgacga ctacatccac gccgcccgcg ccatcaacgc ccctcgccgc 360
cacgccgccg gcctcctcca ggacaaccgc gccctcctcc acgacaacat cctcgacccg 420
gcctccctcc tcctcctcga ccaccgctcc ccgagggacc tcaacctcaa cgccttcaac 480
ggcttccgcg ccctcctcta cgccctccgc aacgccacct ccttcctcct cgccatcctc 540
ctctctgcca ccgtctcctc ctgcctcccc gaccacctca tctccacctg cactcccctt 600
cccctgccca ccgcacccgg ctacgcctcc tccatggctc gcctccgcca ccgcgtcgcc 660
caggagatgc gcgccctcgc cgcccccgcc gccgacggca tcctgatgta cgagttccgc 720
caggccaggg ccgccatcga cagcctcaag gccgacctcg acagggtcgt cgccaccggc 780
accggctacg cccaccggga ggacatggcc gagagggccc acctcgtcaa aggctgcctc 840
gccatgctca gctccggcgc cgaggccgtc atcgccgagc tcgacgactt gttcgatgac 900
attgtcgagg gcaggaagat gctctccgac ctctgcagcc atcgctga 948
<210> 6
<211> 315
<212> PRT
<213>rice ()
<400> 6
Met Met Lys Arg Phe Tyr Ser Ser Ile Gly Gln Gly Val Glu Ala Leu
1 5 10 15
His Arg Ser Leu Ala Val Gly Glu Val Gly Phe Met Ser Ala Ala Phe
20 25 30
Val Gln Gln Ala Ala Ala Leu Val Arg Ser Val His Ala Gln Leu Leu
35 40 45
Glu Val Val Gly Arg Leu His Leu Pro Ala Gly Glu Arg Trp Leu Asp
50 55 60
Glu Tyr Met Asp Glu Thr Ser Arg Leu Trp Asp Ala Cys Leu Leu Val
65 70 75 80
Arg Ala Gly Ala Ser Ala Leu His Ala Tyr Ser Ala Ala Ala Ala His
85 90 95
Ala Ile His His Leu Tyr Asp His Asp Asp Asp Tyr Ile His Ala Ala
100 105 110
Arg Ala Ile Asn Ala Pro Arg Arg His Ala Ala Gly Leu Leu Gln Asp
115 120 125
Asn Arg Ala Leu Leu His Asp Asn Ile Leu Asp Pro Ala Ser Leu Leu
130 135 140
Leu Leu Asp His Arg Ser Pro Arg Asp Leu Asn Leu Asn Ala Phe Asn
145 150 155 160
Gly Phe Arg Ala Leu Leu Tyr Ala Leu Arg Asn Ala Thr Ser Phe Leu
165 170 175
Leu Ala Ile Leu Leu Ser Ala Thr Val Ser Ser Cys Leu Pro Asp His
180 185 190
Leu Ile Ser Thr Cys Thr Pro Leu Pro Leu Pro Thr Ala Pro Gly Tyr
195 200 205
Ala Ser Ser Met Ala Arg Leu Arg His Arg Val Ala Gln Glu Met Arg
210 215 220
Ala Leu Ala Ala Pro Ala Ala Asp Gly Ile Leu Met Tyr Glu Phe Arg
225 230 235 240
Gln Ala Arg Ala Ala Ile Asp Ser Leu Lys Ala Asp Leu Asp Arg Val
245 250 255
Val Ala Thr Gly Thr Gly Tyr Ala His Arg Glu Asp Met Ala Glu Arg
260 265 270
Ala His Leu Val Lys Gly Cys Leu Ala Met Leu Ser Ser Gly Ala Glu
275 280 285
Ala Val Ile Ala Glu Leu Asp Asp Leu Phe Asp Asp Ile Val Glu Gly
290 295 300
Arg Lys Met Leu Ser Asp Leu Cys Ser His Arg
305 310 315
<210> 7
<211> 389
<212> DNA
<213>rice ()
<400> 7
tgtgatttga tacgatcatg gggatgggcc gcgcgcctgg atccgcatgg ataatgctgc 60
cgcctgacag gatggatgct gatgtggtac gtgggggggc cagtgcagag cgcatcgcat 120
cgccatcgcc acgccaatgc atggccagca tatgggttct tcttcttccc ttctgctgct 180
gttgcaactt gcaggttgca aggcggttgg gtgacagtat caggcccgta gtatggtttg 240
tgctttacca cggtctaaac tcttcgtttg tttcatctgg gatcctgacg aaaaaggctg 300
gtgatgtttg ctacgaaatg ggctggccca agacagaaaa gggcccagga ctgagaaatg 360
ggccgaaatg tttgaatcac gccgattga 389
<210> 8
<211> 264
<212> DNA
<213>rice ()
<400> 8
atggggatgg gccgcgcgcc gggatccgca tggataatgc tgccgcctga caggatggat 60
gctgatgtgg ttgcaaggcg gttgggtgac agtatcaggc ccgtagtatg gtttgtgctt 120
taccacggtc taaactcttc gtttgtttca tctgggatcc tgacgaaaaa ggctggtgat 180
gtttgctacg aaatgggctg gcccaagaca gaaaagggcc caggactgag aaatgggccg 240
aaatgtttga atcacgccga ttga 264
<210> 9
<211> 87
<212> PRT
<213>rice ()
<400> 9
Met Gly Met Gly Arg Ala Pro Gly Ser Ala Trp Ile Met Leu Pro Pro
1 5 10 15
Asp Arg Met Asp Ala Asp Val Val Ala Arg Arg Leu Gly Asp Ser Ile
20 25 30
Arg Pro Val Val Trp Phe Val Leu Tyr His Gly Leu Asn Ser Ser Phe
35 40 45
Val Ser Ser Gly Ile Leu Thr Lys Lys Ala Gly Asp Val Cys Tyr Glu
50 55 60
Met Gly Trp Pro Lys Thr Glu Lys Gly Pro Gly Leu Arg Asn Gly Pro
65 70 75 80
Lys Cys Leu Asn His Ala Asp
85
<210> 10
<211> 3593
<212> DNA
<213>rice ()
<400> 10
ccaatccaat tccatccatt ctctgggaat cgccgtcgcc gtcgccttcg ccttcgcctt 60
cgtcgagcag agagggaggc aagccatggc cgccgccgcc ggggatgggg acgagcacct 120
cctctccctc ttcgcctccg ccctctccca ccgcaggtaa ccacacaccc ttcttcctct 180
acgatccacc aacttggatt tcagtcttct acaaccgctc cattctgatt ctcctcgcgc 240
tgctcaggtt tggggaccag gagctccgcc tactcgacgc cgcgctttcc gccggcgccg 300
acgtcccctc gctgctccac actcgctcat ccgcccgctg tctgctgcgc aaggccgccg 360
cccaggcatt ctcctccgtc cccgatttgg gtaccaccct ctccacggcc gacttcttcg 420
cgcgcgcctt cgccctcgcc ggagatgtcg aggtcctcac tcaccgatga cttgcctcag 480
cgcctgtggc caggattgtg gggccattaa tcatgtgcac atatccacta gttttgtttg 540
ctcttcattc tacacctaac tgggtttcga ttgcgatgca catcgggtgc tccagttctg 600
tatgttcaat ccaattcgca tcatatgtcg atgcccttat aattattcat tctcctcgtg 660
caaatacaca ttctgcacat gctaccgtac cgtactaaac tagcggtgtt gcaacttttt 720
tttttctgcc actacttcac taattctgct aatttctgtc attcactaga gttgccttgc 780
tatgagatat gaagctctgc tcctgagaca agccgaatac tccgatgacc ttcatttgca 840
agtatccaat gaagaatggc taacttttgc aaaggactct cttgataatg gtttttacac 900
cattgcttcc aaggtacttt cctttcagtt ctgctgtacc tccacttaat tcttttatta 960
gtcagcattg aaacagaact gatgacacct cctagctaat actaattcta tgttgccttg 1020
ggtcacatgt tacttttgta ccagaattta gactaatgac cttttcaagt ggaaaggcat 1080
cgccatttgg aaatatgttc tgaacaatgt gatggatgat gtttgataac tgcctgctgt 1140
tcatactggt agtattgtct gaacaaacat agcacaaata aacatagatc actatgtaga 1200
acaacactct cacgctggag ggcattgttt tgtctgcctc ctttagcagt tatgattagg 1260
tcataaccat gccaatgtgt caatctaatc atctgtctgt aattcatttt gttgaatgac 1320
tgcatcatag tgcttcaaca ttatttatgt gcaaaccact gattctaggg tttaaaacca 1380
tgtggccatg tttctttcta cttatatatg tatttacctt ttaggctttt gcaaatgctc 1440
ttgtgcgtat tgatcccaac cacccagaat acttggactc aaccaattct attctgaaga 1500
aagataagat caatgatata agtggactcc aaaacttggc caagtcatta tccgcactgc 1560
gttctggtga gttttgtgat accataaaat gatgtaaatt acatgctgcg ttgactggtt 1620
aaaagaacac tttagatgct actcttgtgc tctaactgcc tcctttattg tctctctggg 1680
gacttctgta agaccttgct atgttcttac gttaagtgat ggaatcggca taaaaactca 1740
aactacatct cgggaaactg cagtcttact ttaaattgac tattaaacaa gatgtttaga 1800
gtagataagt gtatttcaat ggaaaatcat gatctttcta tgtagaaaaa ggattagcat 1860
aacctgagta taggctgtac aactatgtct ttattttcat tttaattgaa ggaacatctg 1920
ggcatctggt taattatttt gttaaacatc atctataaga tactcgaggt tattaggtat 1980
gactatgttt tttttatcat attgtgttca ttattctgtt ggattgatgt agcattccct 2040
gaacatagat caagtcaagg cactaaatct tctattagat ttttcaaaat tcggtgctta 2100
tttccttttg tttcaaataa atttccaata cagctacttg tactatgaca gttcaggcac 2160
aatcagctga atacatgaaa aggaaagctt caggggttga tgaaaagtgt aatttgcact 2220
tgaaaaaaac aaagctacct ggaagttcaa tgtttaggct aggtatcaaa acaaggaaca 2280
tacagaaact acgttgcagc cgggagagta atctgtaaga tgtttgaagc aatatcggtg 2340
tgacatcttc caataggctg ataagagtgg tatgatcttt cacacaatct gttgttgatg 2400
taacaaaagg tgaatctcat gccttggggt ttactcattt gtttactgag aacttctcag 2460
tttattattt tggtaactag tggaacatct gcagctgcac atatgtccag tatagatttt 2520
atcaatctct tacggtttct ttgctgacta cctctttgtt agctcaacat atttccatcc 2580
tgctatccac tcattttctt ccttaaatac atccatactg ccgtatgtac acgtctcctt 2640
atcagattgc tatgattaat gttctttgat cggaacagaa taggaccact ttgaacttcc 2700
tctttgtaag atagcaatgt aggttatgta gaatttatat gtgagggttg tgttggtaca 2760
tggcagcatg tgcacttttg actcgttctc attttctttg gtaagtatca tcgtgcatgt 2820
gttgtaccat gtaaaactct taccatttgt cactttcaag gagtactttc aattagtttc 2880
attagtatta tctgtatgac caagccaggc ccaacttctc actcctttaa aataacacta 2940
caacatcttc tctttcttgc ttactttcag agcactggtg gaaatgagag cactgagtag 3000
aatagcacac ctcacttcag cacagaagtt taactataca tttatcatat tgaaacagga 3060
tacttgtatc tgctcatata gttacattgc atcacattat tgcgtaggaa ttcatgttgt 3120
ttattcactt ggaatgattg tcgatcccat tattaattac atatcattct gatataccac 3180
tgcgcatttt ggtctgtcca atgtggctat gtacattaat acttaatatg cttcaacgta 3240
atgagtttgc ttctgttttt tcattcaatt aggtgaacat tttcgtgcaa tgggaatttt 3300
gatcctgatg tcgtggatgg gtatttggga tcctgagaca atgagggtat cacttgcctc 3360
ttctactgct gtttcactgg gaacgtaagc tgctttttta aatactcctg aatattatga 3420
cttgtgatgt actaaacaat atgctatatt tttgctatgc ttacgcatct gtattaggat 3480
cataaggatt aaaatccagt gctgaagtat tttatttacc ttttgagatg atatagtgaa 3540
gaacttcatg ttgttcattc gtggacaggt ttattatgca cggcaccaaa tga 3593
<210> 11
<211> 699
<212> DNA
<213>rice ()
<400> 11
atggccgccg ccgccgggga tggggacgag cacctcctct ccctcttcgc ctccgccctc 60
tcccaccgca ggtttgggga ccaggagctc cgcctactcg acgccgcgct ttccgccggc 120
gccgacgtcc cctcgctgct ccacactcgc tcatccgccc gctgtctgct gcgcaaggcc 180
gccgcccagg cattctcctc cgtccccgat ttgggtacca ccctctccac ggccgacttc 240
ttcgcgcgcg ccttcgccct cgccggagat gtcgagagtt gccttgctat gagatatgaa 300
gctctgctcc tgagacaagc cgaatactcc gatgaccttc atttgcaagt atccaatgaa 360
gaatggctaa cttttgcaaa ggactctctt gataatggtt tttacaccat tgcttccaag 420
gcttttgcaa atgctcttgt gcgtattgat cccaaccacc cagaatactt ggactcaacc 480
aattctattc tgaagaaaga taagatcaat gatataagtg gactccaaaa cttggccaag 540
tcattatccg cactgcgttc tggtgaacat tttcgtgcaa tgggaatttt gatcctgatg 600
tcgtggatgg gtatttggga tcctgagaca atgagggtat cacttgcctc ttctactgct 660
gtttcactgg gaacgtttat tatgcacggc accaaatga 699
<210> 12
<211> 232
<212> PRT
<213>rice ()
<400> 12
Met Ala Ala Ala Ala Gly Asp Gly Asp Glu His Leu Leu Ser Leu Phe
1 5 10 15
Ala Ser Ala Leu Ser His Arg Arg Phe Gly Asp Gln Glu Leu Arg Leu
20 25 30
Leu Asp Ala Ala Leu Ser Ala Gly Ala Asp Val Pro Ser Leu Leu His
35 40 45
Thr Arg Ser Ser Ala Arg Cys Leu Leu Arg Lys Ala Ala Ala Gln Ala
50 55 60
Phe Ser Ser Val Pro Asp Leu Gly Thr Thr Leu Ser Thr Ala Asp Phe
65 70 75 80
Phe Ala Arg Ala Phe Ala Leu Ala Gly Asp Val Glu Ser Cys Leu Ala
85 90 95
Met Arg Tyr Glu Ala Leu Leu Leu Arg Gln Ala Glu Tyr Ser Asp Asp
100 105 110
Leu His Leu Gln Val Ser Asn Glu Glu Trp Leu Thr Phe Ala Lys Asp
115 120 125
Ser Leu Asp Asn Gly Phe Tyr Thr Ile Ala Ser Lys Ala Phe Ala Asn
130 135 140
Ala Leu Val Arg Ile Asp Pro Asn His Pro Glu Tyr Leu Asp Ser Thr
145 150 155 160
Asn Ser Ile Leu Lys Lys Asp Lys Ile Asn Asp Ile Ser Gly Leu Gln
165 170 175
Asn Leu Ala Lys Ser Leu Ser Ala Leu Arg Ser Gly Glu His Phe Arg
180 185 190
Ala Met Gly Ile Leu Ile Leu Met Ser Trp Met Gly Ile Trp Asp Pro
195 200 205
Glu Thr Met Arg Val Ser Leu Ala Ser Ser Thr Ala Val Ser Leu Gly
210 215 220
Thr Phe Ile Met His Gly Thr Lys
225 230
<210> 13
<211> 27
<212> DNA
<213>composition sequence ()
<220>
<223>forward primer of OsDN-ITP3 gene cDNA is cloned
<400> 13
gctaaggatg atgaagaggt tctactc 27
<210> 14
<211> 24
<212> DNA
<213>composition sequence ()
<220>
<223>reverse primer of OsDN-ITP3 gene cDNA is cloned
<400> 14
tctggattag actttggatc agcg 24
<210> 15
<211> 26
<212> DNA
<213>composition sequence ()
<220>
<223>forward primer of OsDN-ITP4 gene gDNA is cloned
<400> 15
tgtgatttga tacgatcatg gggatg 26
<210> 16
<211> 23
<212> DNA
<213>composition sequence ()
<220>
<223>reverse primer of OsDN-ITP4 gene gDNA is cloned
<400> 16
caccatgtat gtgtaggtag ttc 23
<210> 17
<211> 25
<212> DNA
<213>composition sequence ()
<220>
<223>forward primer of OsDN-ITP5 gene gDNA is cloned
<400> 17
ccaatccaat tccatccatt ctctg 25
<210> 18
<211> 25
<212> DNA
<213>composition sequence ()
<220>
<223>reverse primer of OsDN-ITP5 gene gDNA is synthesized
<400> 18
tcatttggtg ccgtgcataa taaac 25
<210> 19
<211> 19
<212> DNA
<213>composition sequence ()
<220>
<223>forward primer of OsDN-ITP3 gene real-time PCR analysis
<400> 19
ctcatctcca cctgcactc 19
<210> 20
<211> 21
<212> DNA
<213>composition sequence ()
<220>
<223>reverse primer of OsDN-ITP3 gene real-time PCR analysis
<400> 20
cggaactcgt acatcaggat g 21
<210> 21
<211> 20
<212> DNA
<213>composition sequence ()
<220>
<223>forward primer of OsDN-ITP4 gene real-time PCR analysis
<400> 21
cggttgggtg acagtatcag 20
<210> 22
<211> 21
<212> DNA
<213>composition sequence ()
<220>
<223>reverse primer of OsDN-ITP4 gene real-time PCR analysis
<400> 22
gcccatttcg tagcaaacat c 21
<210> 23
<211> 21
<212> DNA
<213>composition sequence ()
<220>
<223>forward primer of OsDN-ITP5 gene real-time PCR analysis
<400> 23
tgaacatttt cgtgcaatgg g 21
<210> 24
<211> 21
<212> DNA
<213>composition sequence ()
<220>
<223>reverse primer of OsDN-ITP5 gene real-time PCR analysis
<400> 24
aggcaagtga taccctcatt g 21
Claims (19)
1. a kind of isolated polynucleotides, the polynucleotides include: a kind of (a) polynucleotides, nucleotide sequence and SEQ
The sequence identity of ID NO:4,7 or 10 is at least 85%；(b) a kind of polynucleotides, nucleotide sequence and SEQ ID NO:
5,8 or 11 sequence identity is at least 85%；(c) a kind of polynucleotides, the amino acid sequence and SEQ of the polypeptide of coding
The sequence identity of ID NO:6,9 and 12 is at least 90%；Or (d) nucleotide sequence (a), (b) or overall length complementation sequence (c)
Column, wherein polynucleotides described in overexpression improve plants against pests.
2. the polynucleotides separated as described in claim 1, the polynucleotides include SEQ ID NO:4, SEQ ID NO:
5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10 or SEQ ID NO:11.
3. the polynucleotides separated as described in claim 1, the isolated polynucleotide encoding polypeptide, the ammonia of the polypeptide
Base acid sequence includes SEQ ID NO:6, SEQ ID NO:9 or SEQ ID NO:12.
4. the polynucleotides separated as described in claim 1, the pest is lepidoptera.
5. the polynucleotides separated as claimed in claim 4, the pest is Ostrinia furnacalis (Ostrinia
furnacalis)。
6. a kind of recombinant dna construct, it is operatively connected it includes the polynucleotides of 1-3 any claim separation and with it
At least one heterologous regulatory sequence.
7. a kind of recombinant dna construct, it includes encoding D N-ITP3, DN-ITP4 or the isolated multicore glycosides of DN-ITP5 polypeptide
Acid and at least one heterologous regulatory sequence being operatively connected with it.
8. a kind of genetically modified plants, plant cell or seed, it includes a recombinant dna construct, wherein the recombinant DNA structure
Build the polynucleotides and at least one heterologous regulatory sequence being attached thereto that body includes any one of claim 1-3.
9. a kind of genetically modified plants or plant cell include in its genome recombinant dna construct, wherein the recombinant DNA
At least one heterologous regulatory element construct polynucleotide comprising any one of claim 1-3 and be attached thereto；When
Compared with check plant, the genetically modified plants show the increase of pest resistance energy.
10. genetically modified plants as claimed in claim 9 or plant cell, wherein the pest is lepidopterous insects.
11. genetically modified plants as claimed in claim 10 or plant cell, wherein the pest is Ostrinia furnacalis
(Ostrinia furnacalis)。
12. such as the described in any item plants of claim 8-11, wherein the plant be selected from rice, corn and soybean, sunflower,
Sorghum, rape, wheat, clover, cotton, barley, grain, sugarcane and switchgrass.
13. it is a kind of improve plants against pests method comprising in plant overexpression encoding D N-ITP3, DN-ITP4 or
At least one polynucleotide of DN-ITP5 polypeptide.
14. method as claimed in claim 13, wherein the polynucleotides include: a kind of (a) polynucleotide, nucleotide
The consistency of sequence and the sequence of SEQ ID NO:4,7 or 10 is at least 85%；(b) a kind of polynucleotide, nucleotide sequence
It is at least 85% with the sequence identity of SEQ ID NO:5,8 or 11；(c) a kind of polynucleotide, the polypeptide amino of coding
The sequence identity of acid sequence and SEQ ID NO:6,9 or 12 are at least 90%.
15. method according to claim 13 or 14, wherein the plant includes the DNA construct of claim 7.
16. a kind of method for enhancing plants against pests, comprising: recombinant dna construct is transferred to renewable plant cell by (a),
The recombinant dna construct includes the polynucleotides being operatively connected at least one regulating and controlling sequence, wherein the polynucleotides
The amino acid sequence of the polypeptide of coding sequence identity compared with SEQ ID NO:6,9 or 12 is at least 80%；(b) by step
(a) the regenerable cell regenerating plants after, wherein genetically modified plants include recombinant dna construct in its genome；
(c) progeny plant is obtained by the genetically modified plants of step (b), wherein the progeny plant includes recombination in its genome
DNA construct；Compared with the check plant without containing recombinant dna construct, the pest resistance of the progeny plant display enhancing
Energy.
17. the method described in claim 16, wherein the pest is Lepidoptera.
18. method as claimed in claim 17, wherein the pest is Ostrinia furnacalis (Ostrinia furnacalis).
19. a kind of method for assessing plant resistance to insect, comprising: recombinant dna construct is transferred to renewable plant cell by (a), institute
Stating recombinant dna construct includes the polynucleotides being operatively connected at least one regulating and controlling sequence, wherein the polynucleotides sequence
The amino acid sequence of column coding polypeptide has at least 80% sequence identity compared with SEQ ID NO:6,9 or 12；(b) by step
Suddenly the renewable plant cell regenerating plants after (a), wherein genetically modified plants include recombinant DNA structure in its genome
Build body；(c) progeny plant is obtained by genetically modified plants, wherein progeny plant includes recombinant dna construct in its genome；With
(d) compared with the check plant for not including recombinant dna construct, the pest resistance energy of progeny transgenic plant is assessed.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710863154.7A CN109536508A (en) | 2017-09-21 | 2017-09-21 | The plant of pest-resistant performance enhancement and it is related to the construct and method of pest resistance genes |
| PCT/CN2018/106348 WO2019057044A1 (en) | 2017-09-21 | 2018-09-19 | Plants having enhanced tolerance to insect pests and related constructs and methods involving insect tolerance genes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710863154.7A CN109536508A (en) | 2017-09-21 | 2017-09-21 | The plant of pest-resistant performance enhancement and it is related to the construct and method of pest resistance genes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109536508A true CN109536508A (en) | 2019-03-29 |
Family
ID=65810080
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710863154.7A Pending CN109536508A (en) | 2017-09-21 | 2017-09-21 | The plant of pest-resistant performance enhancement and it is related to the construct and method of pest resistance genes |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN109536508A (en) |
| WO (1) | WO2019057044A1 (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010143138A2 (en) * | 2009-06-10 | 2010-12-16 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency, yield, growth rate, vigor, biomass, oil content, and/or abiotic stress tolerance |
| CN105624177A (en) * | 2016-02-04 | 2016-06-01 | 浙江大学 | Insect-fusion-resistant gene, coding protein, carrier and application thereof |
| CN107075520A (en) * | 2014-07-03 | 2017-08-18 | 先锋海外公司 | The enhanced plant of pest-resistant performance and the construct and method for being related to insect-resistance gene |
-
2017
- 2017-09-21 CN CN201710863154.7A patent/CN109536508A/en active Pending
-
2018
- 2018-09-19 WO PCT/CN2018/106348 patent/WO2019057044A1/en active Application Filing
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010143138A2 (en) * | 2009-06-10 | 2010-12-16 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency, yield, growth rate, vigor, biomass, oil content, and/or abiotic stress tolerance |
| CN107075520A (en) * | 2014-07-03 | 2017-08-18 | 先锋海外公司 | The enhanced plant of pest-resistant performance and the construct and method for being related to insect-resistance gene |
| CN105624177A (en) * | 2016-02-04 | 2016-06-01 | 浙江大学 | Insect-fusion-resistant gene, coding protein, carrier and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| BUELL,C.R.等: ""Oryza sativa (japonica cultivar-group) chromosome 12，complete，ACCESSION NUMBER：DP000011.2"", 《GENBANK》 * |
| GENBANK: ""PREDICTED：Oryza sativa Japonica Group uncharacterized LOC4344441(LOC4344441)，mRNA，ACCESSION NUMBER：XM_015794606.1"", 《GENBANK》 * |
| THE RICE CHROMOSOMES 11 AND 12 SEQUENCING CONSORTIA: ""The sequence of rice chromosomes 11 and 12, rich in disease resistance genes and recent gene duplications"", 《BMC BIOLOGY》 * |
| YU,J.等: ""Oryza sativa Japonica Group chromosome 1，whole genome shotgun，ACCESSION NUMBER：CM000138.1"", 《GENBANK》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2019057044A1 (en) | 2019-03-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220002821A1 (en) | Maize event dp-004114-3 and methods for detection thereof | |
| US20110154526A1 (en) | Maize event DP-043A47-3 and methods for detection thereof | |
| US20110154525A1 (en) | Maize event DP-040416-8 and methods for detection thereof | |
| US20110154524A1 (en) | Maize event DP-032316-8 and methods for detection thereof | |
| US20200032290A1 (en) | Plants having enhanced tolerance to insect pests and related constructs and methods involving insect tolerance genes | |
| US20200385749A1 (en) | Maize event dp-004114-3 and methods for detection thereof | |
| US20190040412A1 (en) | Plants having enhanced tolerance to insect pests and related constructs and methods involving insect tolerance genes | |
| US11447795B2 (en) | Plants having enhanced tolerance to insect pests and related constructs and methods involving insect tolerance genes | |
| WO2021000219A1 (en) | Biotic stress tolerant plants and methods | |
| CN109536508A (en) | The plant of pest-resistant performance enhancement and it is related to the construct and method of pest resistance genes | |
| BR112017000055B1 (en) | METHOD TO INCREASE TOLERANCE, METHOD TO EVALUATE TOLERANCE | |
| CN103502457A (en) | Bacterial mrna screen strategy for novel pesticide-encoding nucleic acid molecule discovery |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190329 |
|
| WD01 | Invention patent application deemed withdrawn after publication |