CN109536500A - The application for the AtR8 long non-coding RNA that rna plymerase iii is transcribed in arabidopsis - Google Patents
The application for the AtR8 long non-coding RNA that rna plymerase iii is transcribed in arabidopsis Download PDFInfo
- Publication number
- CN109536500A CN109536500A CN201811527744.3A CN201811527744A CN109536500A CN 109536500 A CN109536500 A CN 109536500A CN 201811527744 A CN201811527744 A CN 201811527744A CN 109536500 A CN109536500 A CN 109536500A
- Authority
- CN
- China
- Prior art keywords
- arabidopsis
- atr8
- rna
- long non
- seed
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/8267—Seed dormancy, germination or sprouting
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8291—Hormone-influenced development
- C12N15/8293—Abscisic acid [ABA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Endocrinology (AREA)
- Physiology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application for the AtR8 long non-coding RNA that rna plymerase iii is transcribed in arabidopsis, it is related to the application of long non-coding RNA in arabidopsis；The invention aims to the mechanism problems in order to solve also unsharp Seed Germination of Arabidopsis Pumila physiological mechanism, especially AtR8 long non-coding RNA and seed sprouting on molecular level.Present invention discover that during AtR8 lncRNA is Seed Germination of Arabidopsis Pumila, the response ABA of rna plymerase iii transcription stress long non-coding RNA.It demonstrates AtR8 lncRNA and takes part in Seed Germination of Arabidopsis Pumila process under ABA is coerced.Under normal growing conditions, the growth and development of arabidopsis silique, lotus throne leaf, seed are participated in.And analyze AtR8 lncRNA may by influence ABA signal pathway key gene ABI5, EM6 expression arabidopsis normal development and ABA coerce seed sprout in play an important role.The present invention is applied to arabidopsis field.
Description
Technical field
The present invention relates to the applications of long non-coding RNA in arabidopsis.
Background technique
Long non-coding RNA s (lncRNAs, long noncoding RNAs) is that a kind of length is greater than 200 nucleotide, no
The non-coding RNAs of coding protein, they are mainly by the anti-of introne, promoter, intergenic sequence and coding protein gene
Adopted sequence is transcribed through rna plymerase ii and is generated.Mammal result of study shows long non-coding RNA in dosage compensation
(dosage compensation), genomic imprinting (genomic imprinting) and x chromosome inactivation (Xchromosome
) etc. inactivation play a significant role in bioprocess.
Compared with mammal, the research of plant long non-coding RNA is started late, especially function and Mechanism Study achievement
Less.Currently, some functional long non-coding RNAs of rna plymerase ii transcription are advantageously, it has been found that but only several long non-codings
RNA mechanism of action is resolved clear.AtIPS1 inhibits miR399 activity by " target imitation " mechanism, adjusts phosphorus in arabidopsis root
Hydrochlorate intake, influences root growth；COOLAIR inhibits controlling gene FLC expression of blooming with promoter transcription conflicting mode, adjusts quasi-
Southern mustard flowering time；COLDAIR causes the H3K27me3 histone modification of FLC gene loci, keeps FLC gene epigenetic heavy
It is silent, influence arabidopsis flowering time；A base C is mutated into G in LDMAR gene order, causes its promoter region that first occurs
Base causes rice photoperiodic sensitive period；ASCO (alternative splicing competition long non-coding RNA) simultaneously with AtNSRs (core spot RNA
Binding protein) and alternative splicing mRNA interaction, it is cut by intercepting alternative splicing regulatory factor regulation the variable of NSR and ASCO
Mode is connect, the development of arabidopsis lateral root is influenced；HID1 is a factor for promoting photomorphogenesis under the conditions of continuing feux rouges, feux rouges
Under the conditions of it by adjust phytochrome acting factor PIF3 expression, influence arabidopsis hypocotyl growth；Under auxin stressed condition,
Rna plymerase ii and V transcription generate APOLO, and the dual transcription of APOLO changes PID gene nearby, and (Polar Transport of Auxin closes
Key regulatory factor) chromatin topological structure and expression, affect the growth of arabidopsis root.
Seed is the distinctive procreation organ of plant, and seed sprouting is related to plant population procreation and evolves, and is related to farming
Object quality and yield.The external environmental factors such as seed germination process is easily illuminated by the light, temperature, moisture and oxygen influence, and
Coherent signal pathway control accurate is sprouted by ABA signal, GA signal etc..Gibberellin (GA) promotes to sprout, abscisic acid (ABA) induction
Suspend mode.Seed by adjusting internal ABA and GA it is mutual balance (high GA/ABA ratio be conducive to seed sprout, low GA/ABA ratio
Conducive to seed dormancy), through PYR/PYL/RCAR-PP2C-SnRK2 complex phosphorylation downstream transcription factor AREB/ in ABA signal
ABF, influence LEA protein (late embryogenesis abundant protein), Group A class PP2C phosphoprotein phosphatase,
Transcription factor ABI3, ABI5, EM1, EM6 etc. sprout the expression of related gene, adjust seed and sprout.In recent years, with science of heredity, life
The extensive use of the technologies such as object chemistry, sprout ABA signal pathway in WRKY2, WRKY6, WRKY41, WRKY63, PKS5, NFYA1,
The functional transcription factors such as SAG have been found that they are affected by regulation LEA protein and ABI3, ABI5, EM1, EM6 expression
Seed is sprouted.Currently, seed sprouting detailed molecular mechanism is unclear.Recently, several miRNA for participating in Seed Germination of Arabidopsis Pumila
It has been found to.(AUXIN RESPONSE FACTOR10, auxin stress be because 10) by regulation target gene ARF10 by miR160
Expression changes the interaction between the auxin and ABA signal that ARF10- is relied on, and affects seed sprouting.MiR159 passes through
Regulate and control target gene MYB101 and MYB33 transcriptional level, affects seed sprouting.MiR156 is by adjusting target gene SPL13
The expression of (Squamosa-promoter Binding Protein-like13), delays Seed Germination of Arabidopsis Pumila.miR167
By adjusting target gene ARFs Expression modulation Seed Germination of Arabidopsis Pumila.It is worth noting that, several related to seed in nearly 2 years
Long non-coding RNA have found and analyzed.AsDOG1 is the non-volume from arabidopsis DOG1 (sprouting delay 1) antisense strand
Code RNA, asDOG1 inhibits DOG1 to express and promote to sprout in seed maturation.753 long non-volume is identified in corn seed
Code RNA, GO and KEGG analysis shows 7 kinds of novel long non-coding RNAs may development to corn seed and metabolic process generate weight
It is big to influence.Multiple long non-coding RNAs relevant to DNA methylation are had found in the castor seeds of early development, they are being adjusted
Latent effect is played in the development of control castor-oil plant endosperm and embryo.1,575 long non-codings are identified in soya seeds transcript profile
RNA, they, which may develop soya seeds, plays a significant role.22,430 long non-volume is identified in the Paeonia suffruticosa seed of development
Code RNA shows that these are grown non-volume RNA and may participate in Paeonia suffruticosa seed fat wherein 39 lncRNA are tagged to lipid related gene
Acid synthesis and Regulating Lipid Metabolism.Kiegle et al. research has shown that long non-coding RNA s experienced in rice paddy seed maturation
Alternative splicing.Appeal participates in the non-coding RNA that seed is sprouted and all transcribes generation by rna plymerase ii.
Summary of the invention
The purpose of the present invention is to solve Seed Germination of Arabidopsis Pumila physiological mechanisms also unsharp on molecular level, especially
It is the mechanism problem that AtR8 long non-coding RNA and seed are sprouted.The present invention provides rna plymerase iiis in a kind of arabidopsis to turn
The AtR8 long non-coding RNA of record and its application, AtR8 long non-coding RNA (are written as AtR8lncRNA) below, its nucleotides sequence
Column are as shown in sequence table Seq ID No:1.
Present invention discover that sprouting initial stage expression in seed and the length for sprouting the transcription of related rna plymerase iii with seed is non-
Coding RNA is AtR8 long non-coding RNA.
The long non-coding RNA participates in the growth and development of arabidopsis seed under ABA stress conditions；The ABA concentration
For 5~20mmol/L.Its expression quantity under ABA stress conditions increases, and promotes Seed Germination of Arabidopsis Pumila.
The growth and development of the long non-coding RNA participation arabidopsis silique, lotus throne leaf and seed；It prevents arabidopsis silique
Deformity, and prevent lotus throne limb edge serrating.
The present invention include it is following the utility model has the advantages that
The present invention sows arabidopsis seed (Columbia) normal and contain 10 μM of ABA, 100mM NaCl, 200mM
On the 1/2MS culture medium of mannitol, after 4 DEG C of imbibition 48h (dark), extracts RNA and carried out with AtR8 lncRNA specific probe
Northern hybridization finds that 10 μM of ABA processing obviously induction of AtR8 rna expression, show that AtR8 lncRNA is arabidopsis
In Seed Germination, rna plymerase iii transcription response ABA stress long non-coding RNA.Under normal growing conditions, pass through
AtR8 lncRNA missing and overexpression, AtR8 lncRNA missing inhibit arabidopsis silique, lotus throne leaf, the growth of seed and hair
It educates.Prove that the gene participates in the growth and development of arabidopsis silique, lotus throne leaf, seed.AtR8 lncRNA missing and overexpression,
Arabidopsis germination seed is increased to the sensibility of ABA, is disclosed, AtR8 lncRNA takes part in ABA and coerces lower arabidopsis seed
Germination process.And verify AtR8 lncRNA missing and be overexpressed the influence to ABA responsive genes in arabidopsis, show AtR8
LncRNA missing mainly affects key gene ABI5 and EM6 in ABA signal pathway, and (EM6 is in arabidopsis Rape pod development and seed
Play an important role in germination process) expression.The present invention analyzes AtR8 lncRNA and may be closed by influencing ABA signal pathway
The expression of key Gene A BI5, EM6 plays an important role in arabidopsis normal development and ABA stress seed are sprouted.
To have further clarified AtR8 lncRNA a large amount of at germination seed tip of a root end by whole mount in situ hybridization analysis by the present invention
Expression.
The present invention solves also unsharp seed germination mechanism on molecular level, provides theory for molecular breeding
Foundation.
Detailed description of the invention
Fig. 1 is AtR8 lncRNA in Arabidopsis, imbibition seed, germination seed, 7 day age seedling difference growth step
The expression characterization Northern of section analyzes result figure；
Fig. 2 is the whole mount in situ hybridization photo for sprouting AtR8 lncRNA expression characterization in 2 days arabidopsis seeds；Wherein, arrow
Head indicates AtR8 lncRNA signal；
Fig. 3 is the abiotic stress response photo of 2 days AtR8 lncRNA of imbibition；
Fig. 4 is the abiotic stress response photo for sprouting 1 day AtR8 lncRNA；
Fig. 5 is that arabidopsis AtR8 lncRNA deletion mutant identifies that Northern analyzes result figure；
Fig. 6 is the relative expression Northern analysis result figure that arabidopsis AtR8 lncRNA is overexpressed system (1#, 2#)；
Fig. 7 is that the AtR8 lncRNA missing in arabidopsis inhibits siliqua to develop photo；
Fig. 8 is that the AtR8 lncRNA missing in arabidopsis influences lotus throne leaf development photo；
Fig. 9 is that the AtR8 lncRNA missing in arabidopsis influences siliqua development photo；
Figure 10 is that the AtR8 lncRNA missing in arabidopsis influences mature seed shape picture；
Figure 11 is that Wt, AtR8 lncRNA are lacked and overexpression arabidopsis seed grows 7 on the 1/2MS containing 0 μM of ABA
Its germination rate figure；Wherein, A is WT germination rate figure, and B is AtR8 deletion mutant germination rate figure, and C is that AtR8 is overexpressed 1# germination rate
Figure, D are that AtR8 is overexpressed 2# germination rate figure；
Figure 12 is that Wt, AtR8 lncRNA are lacked and overexpression arabidopsis seed grows 7 on the 1/2MS containing 5 μM of ABA
Its germination rate figure；Wherein, A is WT germination rate figure, and B is AtR8 deletion mutant germination rate figure, and C is that AtR8 is overexpressed 1# germination rate
Figure, D are that AtR8 is overexpressed 2# germination rate figure；
Figure 13 is that Wt, AtR8 lncRNA are lacked and overexpression arabidopsis seed is grown on the 1/2MS containing 10 μM of ABA
7 days germination rate figures；Wherein, A is WT germination rate figure, and B is AtR8 deletion mutant germination rate figure, and C is that AtR8 is overexpressed 1# sprouting
Rate figure, D are that AtR8 is overexpressed 2# germination rate figure；
Figure 14 is that Wt, AtR8 lncRNA are lacked and overexpression arabidopsis seed is grown on the 1/2MS containing 15 μM of ABA
7 days germination rate figures；Wherein, A is WT germination rate figure, and B is AtR8 deletion mutant germination rate figure, and C is that AtR8 is overexpressed 1# sprouting
Rate figure, D are that AtR8 is overexpressed 2# germination rate figure；
Figure 15 is that Wt, AtR8 lncRNA are lacked and overexpression arabidopsis seed is grown on the 1/2MS containing 20 μM of ABA
7 days germination rate figures；Wherein, A is WT germination rate figure, and B is AtR8 deletion mutant germination rate figure, and C is that AtR8 is overexpressed 1# sprouting
Rate figure, D are that AtR8 is overexpressed 2# germination rate figure；
Figure 16 is the expression figure that Wt, AtR8 lncRNA lacked and were overexpressed system influence ABA response gene ABI3；Wherein, A
For WT figure, B is AtR8 deletion mutant figure, and C is that AtR8 is overexpressed 1# figure, and D is that AtR8 is overexpressed 2# figure；
Figure 17 is the expression figure that Wt, AtR8 lncRNA lacked and were overexpressed system influence ABA response gene ABI5；Wherein, A
For WT figure, B is AtR8 deletion mutant figure, and C is that AtR8 is overexpressed 1# figure, and D is that AtR8 is overexpressed 2# figure；
Figure 18 is the expression figure that Wt, AtR8 lncRNA lacked and were overexpressed system influence ABA response gene EM1；Wherein, A is
WT figure, B are AtR8 deletion mutant figure, and C is that AtR8 is overexpressed 1# figure, and D is that AtR8 is overexpressed 2# figure；
Figure 19 is the expression figure that Wt, AtR8 lncRNA lacked and were overexpressed system influence ABA response gene EM6；Wherein, A is
WT figure, B are AtR8 deletion mutant figure, and C is that AtR8 is overexpressed 1# figure, and D is that AtR8 is overexpressed 2# figure；
Figure 20 is the AtR8 lncRNA cDNA electrophoresis expanded from arabidopsis thaliana genomic dna using AtR8 special primer
Figure；
Figure 21 is the fragment electrophoretic figure obtained with BamH I and Sac I digested plasmid pBI121-AtR8.
Specific embodiment
The technical solution of the present invention is not limited to the following list, further includes between each specific embodiment
Any combination.
Specific embodiment 1: the AtR8 long non-coding RNA that rna plymerase iii is transcribed in the arabidopsis of present embodiment
Application, which participates in the growth and development of arabidopsis seed under ABA stress conditions；The ABA concentration is
5~20mmol/L；The AtR8 long non-coding RNA nucleotide sequence such as sequence table Seq ID of the rna plymerase iii transcription
Shown in No:1.
Specific embodiment 2: the present embodiment is different from the first embodiment in that, the long non-coding RNA is in ABA
Expression quantity increases under stress conditions, promotes Seed Germination of Arabidopsis Pumila, but its missing inhibits Seed Germination of Arabidopsis Pumila.It is other with it is specific
Embodiment one is identical.
Specific embodiment 3: present embodiment is unlike specific embodiment one to two: the ABA coerces item
Part are as follows: the sowing of arabidopsis seed is handled on the 1/2MS solid medium for being 5~20mmol/LABA containing concentration in 4 DEG C of imbibitions
After 24~72h, cultivated in 22 DEG C, the incubator of 16h illumination and 8h dark.
It is other identical as one of specific embodiment one to two.
Specific embodiment 4: unlike one of present embodiment and specific embodiment one to three: ABA concentration is 10
~20mmol/L.It is other identical as one of specific embodiment one to three.
Specific embodiment 5: unlike one of present embodiment and specific embodiment one to four: the long non-coding
Expression quantity of the RNA at the tip of a root end of arabidopsis germination seed is greater than the other positions of seed.Other and specific embodiment one to four
One of it is identical.
Specific embodiment 6: the AtR8 long non-coding RNA that rna plymerase iii is transcribed in present embodiment and arabidopsis
Application, it is characterised in that the long non-coding RNA participation arabidopsis silique, lotus throne leaf and seed growth and development；Described
The AtR8 long non-coding RNA nucleotide sequence of rna plymerase iii transcription is as shown in sequence table Seq ID No:1.
Specific embodiment 7: present embodiment is unlike specific embodiment six: the long non-coding RNA prevents from intending
Southern mustard silique deformity, and prevent lotus throne limb edge serrating.It is other identical as specific embodiment six.
Beneficial effects of the present invention are verified by following embodiment:
Embodiment 1
The AtR8 lncRNA gene acquisition modes of the present embodiment are as follows:
One, wildtype Arabidopsis thaliana (Arabidopsis thaliana, Wassilewskija) seedling is chosen, using SDS method
It extracts, purifying Arabidopsis thaliana Seedlings genomic DNA saves after UV spectrophotometer measuring DNA concentration in -20 DEG C；
Two, the clone of arabidopsis long-chain non-coding RNA (AtR8) gene
We have BamH I and Sac I restriction enzyme site primer according to the design of AtR8 full length sequence, expand AtR8 lncRNA
Full length sequence:
Primer sequence with BamH I and Sac I restriction enzyme site is as follows:
Upstream primer: (BamH I)GGATCCAGGGGTGTGGGAACCTAGGA
Downstream primer: (Sac I)GAGCTCGGGGGTGGGAGGGTAAGGCG
PCR amplification is carried out using Extaq enzyme, PCR program is as follows: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 30sec, 65 DEG C
Anneal 30sec, 72 DEG C of extension 30sec, after 35 circulations, 72 DEG C of 10min.Amplification is obtained with AtR8 lncRNA full length fragment
PCR product (Figure 20).
Three, the building of over-express vector and sequence determine
PCR product is connected to PMD18-T (Takara company) intermediate vector, toward competent escherichia coli cell
(TOP10) inner to convert, it is that reagent-CW0500 kit extracts plasmid referring to health, by what is obtained after BamH I and Sac I double digestion
Short-movie section and the same PBI121 over-express vector obtain after BamH I and Sac I double digestion are carried out with T4DNA ligase
Connection, the correct PBI121-AtR8 plasmid (Figure 21) of BamH I and Sac I double digestion is sequenced, is had after sequencing
Complete AtR8 lncRNA sequence Seq ID No:1, carries out Agrobacterium after electroporated and infects inflorescence, obtain AtR8 lncRNA mistake
Express plant.
The ABA stress response of the AtR8 lncRNA of the present embodiment is handled
Wildtype Arabidopsis thaliana (Arabidopsis thaliana, Wassilewskija) seed and T-DNA are inserted into AtR8
The complete deletion form arabidopsis of RNA (Arabidopsis thaliana, Wassilewskija) seed source is municipal big in Nagoya
It learns.
Test method:
The extraction of RNA: 0.1g arabidopsis (Columbia) dry seeds or the germination seed grind into powder in liquid nitrogen are weighed
1ml RNA extracting solution (45.5% (v/v) phenol, 9% (v/v) chloroform, 0.45% (w/v) SDS, 41mmol/L are added afterwards
LiCl, 2mmol/L EDTA, 5.9mmol/L beta -mercaptoethanol, 82mmol/L Tris-HCl), it mixes centrifuging and taking supernatant solution and adds
Enter isometric PCI solution (phenol: chloroform: isoamyl alcohol=25:24:1), mix centrifuging and taking upper solution and isometric chlorine is added
Imitative, room temperature is cultivated；1/3 volume 8mol/L LiCl is added in centrifuging and taking upper solution, and an evening is stood in -20 DEG C after mixing；Next day from
The heart takes supernatant solution and 1/4 volume isopropanol is added, in -20 DEG C of standing 30min after mixing；Centrifuging and taking supernatant solution is simultaneously added 3/
5 volume isopropanols, -20 DEG C of standing 30min；75% ethyl alcohol is added in centrifuged deposit, is added in right amount in RNA precipitate after centrifugation
DEPC water is saved in -80 DEG C.
Northern hybridization: 8 μ g RNA are transferred on nylon membrane after 6% polyacrylamide gel is separated by electrophoresis,
In 42 DEG C of hybridization case prehybridization 1h after UV crosslinking is fixed, Dig label AtR8 RNA specific RNA probe is in 42 after denaturation is added
DEG C overnight hybridization；Film after hybridization is cleaned two in 2 × SSC (containing 0.1%SDS) and 0.2 × SSC (containing 0.1%SDS) washing lotion
It is secondary；Room temperature close 1h after with 2000 times of diluted Anti-Digoxigenin-AP antibody response 2h；Malaysia pickling solution washes film three
It is secondary；LAS-4000 chemiluminescence system detects signal after 15min is reacted in the dark place CDP-Star.
Stress response processing and germination rate statistics: through 70% (v/v) alcoholic solution and 5% (v/v) liquor natrii hypochloritis's table
Arabidopsis wild type seeds (Wassilewskija), AtR8 RNA deletion form and overexpression type arabidopsis seed after the disinfection of face
Sowing is in 1/2MS solid medium and contains 5mmol/L, 10mmol/L, 15mmol/L, 20mmol/L ABA stress response culture
On base, cultivated in 22 DEG C of (16h illumination/8h is dark) incubators after 4 DEG C of imbibition processing 72h；With radicle it is prominent break in the seed coat for
Sprouting standard counts 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days seed germination rates respectively, and 3 times experimental result carries out statistical
Analysis.
The present embodiment AtR8 lncRNA correlation function in arabidopsis is verified:
1. AtR8 lncRNA biological characteristics in arabidopsis growth course
In order to determine AtR8 rna expression characteristic in arabidopsis growth and development process, we extract dry kind of arabidopsis respectively
Son imbibition 1 day, imbibition 2 days, imbibition 3 days, sprouts 1 day, sprouts 2 days seeds and AtR8 that the RNA and Dig of two weeks seedling are marked
RNA specific RNA probe carries out Northern hybridization, finds AtR8 RNA great expression (Fig. 1) in germination seed.This table
Bright, AtR8 lncRNA specifically expressing is in the Seed Germination of Arabidopsis Pumila stage.Whole mount in situ hybridization analysis has further clarified AtR8
LncRNA is in germination seed tip of a root end great expression (Fig. 2).
2. AtR8 lncRNA response is a variety of during Seed Germination of Arabidopsis Pumila stress environment
The present embodiment analyzes AtR8 lncRNA expression variation under various stress conditions during Seed Germination of Arabidopsis Pumila.
By arabidopsis seed (Columbia) sowing it is normal and containing 10 μM of ABA, 100mM NaCl, 200mM mannitol 1/
On 2MS culture medium, after 4 DEG C of imbibition 72h (dark), extracts RNA and hybridize with AtR8 RNA specific probe progress Northern, send out
Existing 10 μM of ABA processing is obviously induction of AtR8 rna expression (Fig. 3).Meanwhile arabidopsis seed (Columbia) being sowed just
Often and containing 10 μM of ABA, 100mM NaCl, 200mM mannitol 1/2MS culture medium on, in 22 DEG C after 4 DEG C of sprouting 48h
(16h illumination/8h is dark) culture for 24 hours, is extracted RNA and is hybridized with AtR8 RNA specific probe progress Northern, find 10 μM
ABA processing is obviously induction of AtR8 rna expression (Fig. 4).These results indicate that AtR8 lncRNA is Seed Germination of Arabidopsis Pumila mistake
Cheng Zhong, rna plymerase iii transcription response ABA stress long non-coding RNA.
Fig. 3 is the imbibition stage stress response result photo of AtR8 lncRNA；
Fig. 4 is the sprouting stage stress response result photo of AtR8 lncRNA.
AtR8 lncRNA function of the invention is verified by following tests:
1, AtR8 lncRNA missing affects the normal growth and development of arabidopsis
Have found that several long non-coding RNAs participate in seed and sprout recently, but mechanism of action is not clear.Pass through the above results
Show AtR8 lncRNA in germination seed tip of a root end great expression and respond ABA stress environment.Whether determine AtR8 lncRNA
It plays a role and has very important significance in seed sprouting and in coercing.
We have confirmed that AtR8 deletion mutant (Fig. 5), while AtR8 is made and being overexpressed arabidopsis, T3 generation is homozygous
1#, 2# are selected (Fig. 6), analyze AtR8 lncRNA function in arabidopsis.Under normal growing conditions, AtR8 lncRNA
Missing leads to Rape pod development deformity (Fig. 7, Fig. 9), lotus throne limb edge serrating (Fig. 8), mature seed deformity (Figure 10), germination rate
It reduces (Figure 11).But AtR8, which is overexpressed arabidopsis, does not have above-mentioned various phenotypes.This shows under normal growing conditions, AtR8
LncRNA lacks the growth and development for inhibiting arabidopsis silique, lotus throne leaf, seed.
2, AtR8 lncRNA missing, which affects ABA, stress descend Seed Germination of Arabidopsis Pumila
Front analysis the result shows that, during Seed Germination of Arabidopsis Pumila AtR8 lncRNA respond ABA coerce (Fig. 3 and figure
4), we have investigated ABA and have coerced lower AtR8 missing and overexpression Seed Germination of Arabidopsis Pumila situation thus.Containing 5 μM of concentration ABA
1/2MS on when sprouting, AtR8 lacks seed germination rate and is suppressed；When being sprouted on the 1/2MS containing 10-20 μM of concentration ABA,
AtR8 missing and overexpression seed germination rate are all suppressed (Figure 13, Figure 14, Figure 15).This shows AtR8 lncRNA missing and mistake
Expression both increases arabidopsis germination seed to the sensibility of ABA.
Above-mentioned data disclose, and AtR8 lncRNA takes part in ABA and coerces lower Seed Germination of Arabidopsis Pumila process.
3, under normal sprouting condition, the influence of AtR8 lncRNA missing and overexpression to ABA responsive genes in arabidopsis
It is a discovery of the invention that AtR8 lncRNA stress and increase germination seed in Seed Germination of Arabidopsis Pumila stage response ABA
To the sensibility (Fig. 3, Fig. 4, Figure 13, Figure 14, Figure 15) of ABA.
In order to determine influence of the AtR8 lncRNA to ABA responsive genes, the present invention, which analyzes, normal sprouts 2 days wild
The variation of important gene expression in type and AtR8 missing and the ABA signal pathway being overexpressed in arabidopsis germination seed.RT-PCR
The result shows that AtR8 missing and overexpression all inhibit ABI3 to express (Figure 16) under normal sprouting condition；AtR8 missing obviously lures
ABI5 expression has been led, and has been overexpressed and ABI5 is inhibited to express (Figure 17)；And AtR8 missing is without influencing EM1 expression, but overexpression
EM1 is obviously inhibited to express (Figure 18)；And AtR8 missing is obviously expressed induction of EM6, overexpression obviously inhibits EM6 to express
(Figure 19).Above-mentioned data disclose, and AtR8 lncRNA missing mainly affects key gene ABI5 and EM6 in ABA signal pathway
Expression, result of study have shown that EM6 plays an important role in arabidopsis Rape pod development and Seed Germination, but it is acted on
Mechanism is unclear at present.
Based on it is above-mentioned whole as a result, it is presumed that, AtR8 lncRNA, which may pass through, influences ABA signal pathway key gene
ABI5, EM6 expression play an important role in arabidopsis normal development and ABA stress seed are sprouted.
Sequence table
<110>Northeast Forestry University
<120>application for the AtR8 long non-coding RNA that rna plymerase iii is transcribed in arabidopsis
<160>3
<210> 1
<211> 259
<212> DNA
<213>arabidopsis (Columbia).
aggggtgtgggaacctaggagatgagtctgcttattgattgctaaaccctgaaccctctc 60
atgttaactatgggaattaattactgggggtcttaggccggcgtttcccccgaaaaataa 120
tgaaaaaacgtcgatggctacataagaggctcgtctccaaaaagtagaccaggaggttgg 180
gtttggttcgtaggtggttctgttgaaactagattagtgtctgcggttaaccgtttcctc 240
gccttaccctcccaccccc 259
<210>2
<211>18
<212> DNA
<213>artificial sequence
<220>
<223>upstream primer.
<400>2
GGATCCAGGGGTGTGGGAACCTAGGA26
<210>3
<211>18
<212> DNA
<213>artificial sequence
<220>
<223>downstream primer.
<400>3
GAGCTCGGGGGTGGGAGGGTAAGGCG26
Claims (7)
1. the application for the AtR8 long non-coding RNA that rna plymerase iii is transcribed in arabidopsis, it is characterised in that the long non-coding RNA
The growth and development of arabidopsis seed are participated under ABA stress conditions；The ABA concentration is 5~20mmol/L；Described
The AtR8 long non-coding RNA nucleotide sequence of rna plymerase iii transcription is as shown in sequence table Seq ID No:1.
2. the application for the AtR8 long non-coding RNA that rna plymerase iii is transcribed in arabidopsis according to claim 1, special
Sign is that the long non-coding RNA promotes Seed Germination of Arabidopsis Pumila under ABA stress conditions, which coerces item in ABA
Expression quantity increases under part.
3. the application for the AtR8 long non-coding RNA that rna plymerase iii is transcribed in arabidopsis according to claim 1, special
Sign is the ABA stress conditions are as follows: the sowing of arabidopsis seed is in the 1/2MS solid for being 5~20mmol/L ABA containing concentration
On culture medium, after 4 DEG C of imbibitions handle 24~72h, cultivated in 22 DEG C, the incubator of 16h illumination and 8h dark.
4. the AtR8 long non-coding RNA that rna plymerase iii is transcribed in arabidopsis according to claim 1,2 or 3 is answered
With, it is characterised in that ABA concentration is 10~20mmol/L.
5. the application for the AtR8 long non-coding RNA that rna plymerase iii is transcribed in arabidopsis according to claim 1, special
Sign is that the long non-coding RNA is greater than the other positions of seed in the expression quantity at the tip of a root end of arabidopsis germination seed.
6. the application for the AtR8 long non-coding RNA that rna plymerase iii is transcribed in arabidopsis, it is characterised in that the long non-coding RNA
Participate in the growth and development of arabidopsis silique, lotus throne leaf and seed；The AtR8 long non-coding of the rna plymerase iii transcription
RNA nucleotide sequence is as shown in sequence table Seq ID No:1.
7. the application for the AtR8 long non-coding RNA that rna plymerase iii is transcribed in arabidopsis according to claim 6, special
It is lopsided that sign is that the long non-coding RNA prevents arabidopsis silique, and prevents lotus throne limb edge serrating.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811527744.3A CN109536500B (en) | 2018-12-13 | 2018-12-13 | Application of AtR8 long non-coding RNA transcribed by RNA polymerase III in arabidopsis thaliana |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811527744.3A CN109536500B (en) | 2018-12-13 | 2018-12-13 | Application of AtR8 long non-coding RNA transcribed by RNA polymerase III in arabidopsis thaliana |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109536500A true CN109536500A (en) | 2019-03-29 |
| CN109536500B CN109536500B (en) | 2022-08-02 |
Family
ID=65855308
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811527744.3A Active CN109536500B (en) | 2018-12-13 | 2018-12-13 | Application of AtR8 long non-coding RNA transcribed by RNA polymerase III in arabidopsis thaliana |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109536500B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110577921A (en) * | 2019-05-28 | 2019-12-17 | 浙江工业大学 | recombinant streptomyces tuberculatus for producing amphotericin B and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108486118A (en) * | 2018-05-25 | 2018-09-04 | 东北林业大学 | The BoNR8 long non-coding RNAs and its application that rna plymerase iii is transcribed in cabbage |
-
2018
- 2018-12-13 CN CN201811527744.3A patent/CN109536500B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108486118A (en) * | 2018-05-25 | 2018-09-04 | 东北林业大学 | The BoNR8 long non-coding RNAs and its application that rna plymerase iii is transcribed in cabbage |
Non-Patent Citations (3)
| Title |
|---|
| LI等: "Effect of AtR8 lncRNA partial deletion on Arabidopsis seed germination", 《MOL. SOIL BIOL》 * |
| WU, J等: "A novel hypoxic stress-responsive long non-coding RNA transcribed by RNA polymerase III in Arabidopsis", 《RNA BIOLOGY》 * |
| 刘春晓: "拟南芥中AtR8lncRNA功能及作用机制初探", 《中国优秀硕士学位论文全文数据库 基础科技辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110577921A (en) * | 2019-05-28 | 2019-12-17 | 浙江工业大学 | recombinant streptomyces tuberculatus for producing amphotericin B and application thereof |
| CN110577921B (en) * | 2019-05-28 | 2021-04-02 | 浙江工业大学 | Recombinant streptomyces tuberculatus for producing amphotericin B and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109536500B (en) | 2022-08-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Okamura et al. | Tissue specificity and diurnal change in gene expression of the sucrose phosphate synthase gene family in rice | |
| Han et al. | Altered expression of Ta RSL 4 gene by genome interplay shapes root hair length in allopolyploid wheat | |
| Zhao et al. | DEP1 is involved in regulating the carbon–nitrogen metabolic balance to affect grain yield and quality in rice (Oriza sativa L.) | |
| Zhang et al. | A transposable element insertion within ZmGE2 gene is associated with increase in embryo to endosperm ratio in maize | |
| CN106047893B (en) | The application interim in control Rice Heading of OsCOL16 gene | |
| Leng et al. | Using Heading date 1 preponderant alleles from indica cultivars to breed high‐yield, high‐quality japonica rice varieties for cultivation in south China | |
| Lu et al. | A GmRAV ortholog is involved in photoperiod and sucrose control of flowering time in soybean | |
| CN113430208B (en) | Application of photoperiod gene OsNhd1 | |
| Cui et al. | Mapping QTLs for seedling characteristics under different water supply conditions in rice (Oryza sativa) | |
| Gao et al. | Assessment of DNA methylation changes in tissue culture of Brassica napus | |
| CN108517356B (en) | Method for preventing breeding abortion of transgenic rice | |
| CN110066774A (en) | Corn receptoroid kinase gene ZmRLK7 and its application | |
| Liu et al. | Co-silencing E1 and its homologs in an extremely late-maturing soybean cultivar confers super-early maturity and adaptation to high-latitude short-season regions | |
| Saika et al. | A point mutation of Adh1 gene is involved in the repression of coleoptile elongation under submergence in rice | |
| CN108728449B (en) | Application of cotton gene GhDTX27 in aspects of salt tolerance, drought tolerance and cold stress of plants | |
| CN107828805A (en) | Rice epoxy carotenoid dioxygenase OsNCED3 gene coded sequences and its application | |
| CN106811471A (en) | Application of the paddy rice SPL7 genes in plant type is regulated and controled | |
| CN109536500A (en) | The application for the AtR8 long non-coding RNA that rna plymerase iii is transcribed in arabidopsis | |
| Osadchuk et al. | The integration of leaf-derived signals sets the timing of vegetative phase change in maize, a process coordinated by epigenetic remodeling | |
| Wei et al. | Genome-wide identification of miR156 and SPL family genes and phenotypic analysis of vegetative phase change in pepper (Capsicum annuum L.) | |
| Jiang et al. | Research progress on the divergence and genetic basis of agronomic traits in Xian and Geng rice | |
| CN104168760B (en) | Encode the nucleotide sequence and its application method of FASCIATED EAR3 (FEA3) | |
| CN113416238B (en) | ZmbHLH148 protein and application of coding gene thereof in regulation and control of plant drought resistance | |
| CN105624172B (en) | The genetic engineering application of paddy rice zinc finger protein gene ZFP214 | |
| CN1994063A (en) | Rice breeding method incorporating high photosynthetic efficiency and presenility resistant property |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |