CN109517834B

CN109517834B - Method for improving contents of grease and DHA in schizochytrium ATCC20888 through genetic modification

Info

Publication number: CN109517834B
Application number: CN201811423642.7A
Authority: CN
Inventors: 张卫文; 王方忠; 陈磊; 刘璐
Original assignee: Kunming Zaoneng Biotechnology Co ltd
Current assignee: Kunming Zaoneng Biotechnology Co ltd
Priority date: 2018-11-27
Filing date: 2018-11-27
Publication date: 2022-06-07
Anticipated expiration: 2038-11-27
Also published as: CN109517834A

Abstract

The invention discloses a method for obtaining schizochytrium ATCC20888 mutant algae seeds with high grease and DHA content through genetic modification. Comprises the following steps: (1) the malic enzyme from the crypthecodinium cohnii is overexpressed to improve the reducing power of schizochytrium ATCC20888, and mutant algae seeds with high grease yield are obtained; (2) the alga obtained in the step is a starting alga, the elongase from mortierella alpina is overexpressed, the hexadecane is converted into the octadecane, the inhibition effect on acetyl coenzyme A carboxylase is removed, the precursor supply is improved, the oil content is further improved, and meanwhile, the proportion of DHA in the dry cell weight is improved. By utilizing the method to carry out genetic modification on schizochytrium algae seeds, compared with the starting algae seeds, the obtained schizochytrium mutant algae seeds have the advantages that the proportion of grease in the dry cell weight is improved by 48.63 percent, and the content of grease reaches 71.68 percent of the dry cell weight; the DHA accounts for 38.69% of the dry weight of the cells, and the content of the DHA reaches 26.70% of the dry weight of the algae.

Description

Method for improving contents of schizochytrium ATCC20888 grease and DHA through genetic modification

Technical Field

The invention discloses a method for obtaining schizochytrium ATCC20888 mutant algae strains with high grease and DHA content through genetic modification, and particularly relates to a method for obtaining engineering algae strains with high grease and DHA content and application thereof. Belongs to the field of industrial microorganisms.

Background

Docosahexaenoic acid (DHA), an essential fatty acid that cannot be synthesized by the human body itself but is very beneficial to human health, has been a focus of scientific research in recent years. Clinical tests show that DHA is a main component for the growth and maintenance of nervous system cells, is an important constituent of the brain and retina, has a content of up to 20% in the cerebral cortex of a human body, and accounts for about 50% in the retina of eyes, so that DHA plays an important role in the development of the nervous system and the vision of infants, and also has the effects of preventing cardiovascular diseases, resisting inflammation, resisting tumors and the like. The Dutch DSM company is reported to sell at least 2000 tons of DHA annually, with a total dollar of 3.17 billion, and thus has a very broad market application.

The source of DHA is mainly marine fishes, and since the marine fishes accumulate a large amount of heavy metals and organic pollutants in vivo and are extremely unhealthy to human bodies, much work has been done in recent years to find sustainable and high-quality DHA alternative sources. Among them, the heterotrophic fermentation of marine microalgae for producing DHA is considered as a main alternative. Schizochytrium (II)Schizochytrium) Is a microalgae species rich in DHA, and is also the strain which is most widely used in DHA fermentation production at present. The advantages of schizochytrium in terms of DHA production are: the growth speed is high, the final biomass is high, the DHA yield is relatively high, the highest value reported internationally is that the culture is carried out for 90-100 hours, the dry weight of an alga body is 200 g/L, the DHA is 40-45 g/L, and at present, a plurality of domestic units screen and obtain excellent schizochytrium limacinum alga species, so that high-density fermentation and pilot scale experiment are realized, and the rapid development of the whole industry is promoted.

At present, the problem that the content of grease and DHA in schizochytrium produced and applied in the practical schizochytrium fermentation process is low is solved. The characters of the algae are easy to be degenerated in the fermentation process. Therefore, the improvement of the schizochytrium by using an effective technical means to obtain the excellent strain with high yield and stable heredity is very important for promoting the sustainable development of the industry for producing DHA by the schizochytrium.

It is reported that an important source of NADPH in algal bodies is malic enzyme. It is reported that the addition of a malic enzyme inhibitor to a culture medium for crypthecodinium cohnii inhibits the activity of malic enzyme, and the oil yield is significantly reduced, indicating that the malic enzyme derived from crypthecodinium cohnii plays a very important role in oil synthesis.

Disclosure of Invention

The invention aims to provide a method for improving the contents of schizochytrium limacinum grease and DHA. The invention provides a method for quickly obtaining schizochytrium algae species with excellent properties by over-expressing key site enzyme to improve the activity of the key site enzyme.

The invention discloses a method for obtaining schizochytrium ATCC20888 mutant algae seeds with high grease and DHA content through genetic modification, which comprises the following specific steps:

1. malic enzyme gene is amplified from Crypthecodinium cohnii cDNA, CaMV35s promoter and CaMV poly (A) terminator are amplified from p1301 plasmid to form an expression cassette, and then the expression cassette is fused with a neomycin resistance gene expression cassette to form a malic enzyme gene transformation expression cassette.

2. Culturing schizochytrium sp ATCC20888 in an enrichment medium, selecting seeds in exponential phase, grinding thalli by using zirconium oxide, washing cells by using 2% sea salt and 50 mM sucrose respectively, adding 10 muL of malic enzyme gene transformation expression cassette (> 500 ng/muL) into 100 muL of treated cells, delivering DNA into the cells by using electroporation, and electrotransformation conditions: field strength of 2000V and 50 μ F capacitance, electroporation was performed at 200 Ω resistance. The cells after electroporation were added to 0.6mL of the enriched medium and cultured at 25 ℃ and 180rpm for 12 hours.

3. mu.L of cells were plated on a basal medium plate with a neomycin concentration of 100. mu.g/ml and cultured at 25 ℃ for 4 days.

Transformants were selected from the initial medium and transferred again to 600. mu.g/ml neomycin minimal medium plates for 4 days. Relevant transformants were obtained by selection and confirmed by PCR with primer 1 (CCTGCCCATTCGACCACCAAGCGAAACATCGC) and primer 2 (CCTTCAGGAGAGTGCCGTAGTAGACCTCTGGG) and by RT-PCR with primer 3 (GGCTCCCCGCAGCCTTTCTCTTC) and primer 4 (TTTGGACCTCGGCCACTACAGCTGTC).

4. Comparison of growth rate, lipid accumulation and fatty acid composition between schizochytrium mutant and wild strains: and inoculating the obtained schizochytrium limacinum mutant strain and wild strain into an enrichment medium for culturing, and identifying the content change of mutant strain grease and DHA.

5. The method comprises the steps of synthesizing an elongase from mortierella alpina, amplifying a CaMV35s promoter and a Nos terminator from a p1301 plasmid to form an expression cassette, and fusing the expression cassette with a bleomycin resistance gene expression cassette to form an elongase gene conversion expression cassette.

6. The alga seeds obtained in the previous step are starting alga seeds, the alga seeds are cultured in an enrichment medium, exponential phase seeds are selected, thalli are ground by using zirconium oxide, then cells are washed by using 2% sea salt and 50 mM sucrose respectively, 10 mu L of an elongase gene transformation expression cassette (> 500 ng/mu L) is added into 100 mu L of treated cells, DNA is sent into the cells by electroporation, and the electrotransformation conditions are as follows: field strength of 2000V and 50 μ F capacitance, electroporation was performed at 200 Ω resistance. The cells after electroporation were added to 0.6mL of the enriched medium and cultured at 25 ℃ and 180rpm for 12 hours. mu.L of cells were plated on basal medium plates with bleomycin concentration of 50. mu.g/ml and cultured at 25 ℃ for 4 days. Transformants were selected from the initial medium and transferred to plates containing 150. mu.g/ml bleomycin minimal medium for 4 days. Relevant transformants were obtained by selection and confirmed by PCR with primer 5 (CATCATCATCCTCAAGGGCCGCCGCTCGTC) and primer 6 (AGTCCTGCTCCTCGGCCACGAAGTGCACG) and by RT-PCR with primer 7 (CTGCCGGCATCCCCTTCCCTGAGTACTA) and primer 8 (CTGGGCCTTCTTCTGAGCGGCGATG).

7. Comparison of oil and DHA content between Schizochytrium limacinum mutant strains and original strains: and inoculating the obtained schizochytrium limacinum mutant strain and the original strain into an enrichment medium for culture, and identifying the content accumulation change of the mutant strain grease and DHA.

Step 2, adding water to the enrichment medium in the step 7, wherein the enrichment medium is prepared from 2-80 g of glucose, 0.5-20 g of yeast extract powder, 0.25-10 g of peptone and 1-40 g of sea salt to 1L, and the pH value is 7.0; the optimal is 40g of glucose, 10g of yeast extract powder, 5 g of peptone and 20g of sea salt, and water is added to 1L, and the pH value is 7.0;

the basic culture medium in the step 3 and the step 8 is prepared by adding water to 1L, wherein the pH value of the basic culture medium is 7.0, and the basic culture medium is prepared from 0.45-18 g of glucose, 0.1-4 g of yeast extract powder, 1.25-50 g of sea salt and 1-40 g of agar; optimally 9 g of glucose, 2 g of yeast extract powder, 25 g of sea salt and 20g of agar, and adding water to 1L to obtain the yeast extract, wherein the pH value is 7.0;

in the step 2 and the step 7, the algae culture conditions are that the setting parameters of a shaking table are 20-200 rpm, and the temperature is 25 ℃;

according to the invention, through laboratory research, NADPH and acetyl coenzyme A are important precursors for the mass synthesis of grease and DHA by algae. The first step in lipid synthesis is the conversion of acetyl-coa to propionyl-coa by the action of acetyl-coa carboxylase. acetyl-CoA carboxylase is found in many organisms to be subject to feedback inhibition by downstream end products, and Schizophyta acetyl-CoA carboxylase is subject to feedback inhibition by hexadecane fatty acids or derivatives thereof. Therefore, conversion of the sixteen-carbon fatty acid into the eighteen-carbon fatty acid can release the inhibitory action on acetyl-CoA carboxylase and improve the supply of the precursor substance.

The proportion of the grease in the dry cell weight of the schizochytrium mutant algae strain obtained by the method is improved by 48.63 percent, and the content of the grease reaches 71.68 percent of the dry weight of the algae body; the DHA accounts for 38.69% of the dry weight of the cells, and the content of the DHA reaches 26.70% of the dry weight of the algae.

Compared with the traditional breeding method, the method for modifying schizochytrium by adopting the directional genetic modification provided by the invention has the characteristics of being capable of efficiently and quickly obtaining the algal strains with the improved oil and DHA content, and has an important application prospect in the DHA industrialization field.

Drawings

FIG. 1 expression of the malate gene from Crypthecodinium cohnii ATCC 20888; in the figure: A) malic enzyme gene expression box. 1: 18s upstream; 2, the CaMV35s promoter; neomycin resistance gene; 4 a CaMV poly (A) terminator; 5, CaMV35s promoter; 6 malic enzyme gene; 7 CaMV poly (A) terminator; 8: 18s downstream. B) PCR validation was performed using primer 1 and primer 2. M is 1kb marker; 1, water; 2, wild type; 3, overexpression malic enzyme gene transformant. C) RT-PCR validation was performed using primer 3 and primer 4. M is 1kb marker; 1, water; 2, wild type; 3, overexpression malic enzyme gene transformant.

FIG. 2 analysis of contents of lipids (a) and DHA (b) in wild algal species and algal species overexpressing malic enzyme; wherein, the grease content of the schizochytrium starting algae is increased by 39.26 percent and the DHA content is increased by 16.94 percent by comparing the grease (a) and the DHA content (b) of a transformant which overexpresses the malic enzyme gene; DHA content/dry algal mass (%).

FIG. 3 shows the gene expression cassette of elongase and the verification of transformant, which expresses the elongase gene from Mortierella alpina in the strain of Malassezia; wherein A) an elongase gene expression cassette of mortierella alpina. 1 CaMV35s promoter; 2, an elongase gene; nos terminator; 4: the α tubulin promoter; bleomycin resistance gene; 6 CYC1 terminator. B) PCR verification was performed using primer 5 and primer 6. M is 1kb marker; 1, simultaneously overexpressing malic enzyme gene and elongase gene transformants; 2: transformants overexpressing the malic enzyme gene. C) RT-PCR validation was performed using primer 7 and primer 8. M is 1kb marker; 1, overexpression malic enzyme gene transformant; 2: transformants overexpressing the malic enzyme gene and the elongase gene simultaneously.

Detailed Description

The following examples are intended to provide those skilled in the art with a better understanding of the present invention and are not intended to limit the present invention.

The invention relates to a method for improving schizochytrium limacinum frond by using enzyme with specific function to obtain algal species with high grease and DHA content, wherein the overexpressed enzyme is malic enzyme and elongase. Wherein the malic enzyme is derived from Crypthecodinium cohnii, and the elongase is derived from Mortierella alpina.

And (3) the schizochytrium mutant algae grows, the oil content and the DHA composition characteristic are analyzed, and the obtained schizochytrium mutant is cultured in a basic culture medium. During inoculation, 1 mL of fresh cells with OD660nm of 1 are added into 20 mL of fresh enrichment medium, each group is divided into three groups, and cells for 72 hours are selected for composition analysis of the content of grease and DHA. The grease analysis method comprises the following steps: 3500 radix Aconiti lateralis PreparatagCells were harvested by centrifugation for 10 min and washed with PBS buffer (NaCl 137mmol/L, KCl 2.7mmol/L, Na₂HPO₄ 10mmol/L， KH₂PO₄2mmol/L) of cells were washed once and lyophilized to a dry powder. Extracting 25 mg of algae powder with chloroform/methanol solution (2:1, v/v) containing 0.01% butylated hydroxytoluene for 3 to 4 times in total, washing with 1 mL of 1.0M KCl and distilled water, and vacuum drying to obtainTotal oil content. And (3) DHA content determination: about 25 mg of algal powder was weighed, and 4 mL of a solution (2 mL of methanol +2 mL of chloroform + 0.6mL of sulfuric acid) 98 was added^oC reacting for 2 hours, cooling, adding 2 mL water, 7400gCentrifuge for 10 minutes and collect the lower organic phase. And (3) determining the DHA content by using a GC/MS instrument, wherein the model of the GC/MS instrument is as follows: GC7890-MSD 5975. Column type: a DHA peak was identified using NIST/EPA/NIH mass library on an HP-5MS capillary column (30 m X250 mm id).

The present invention will be described in further detail by way of examples with reference to the accompanying drawings.

Example 1

Overexpression of malic enzyme genes

1. Malic enzyme gene was amplified from crypthecodinium cohnii cDNA, CaMV35s promoter and CaMV poly (a) terminator were amplified from p1301 plasmid to form an expression cassette, which was then fused with neomycin resistance gene expression cassette to form malic enzyme gene transformation expression cassette (fig. 1).

2. Culturing schizochytrium sp ATCC20888 in an enrichment medium, selecting seeds in exponential phase, grinding thalli by using zirconium oxide, washing cells by using 2% sea salt and 50 mM sucrose respectively, adding 10 muL of malic enzyme gene transformation expression cassette (> 500 ng/muL) into 100 muL of treated cells, delivering DNA into the cells by using electroporation, and electrotransformation conditions: electroporation was carried out at a field strength of 2000V and a capacitance of 50. mu.F, and a resistance of 200. omega.. The cells after electroporation were added to 0.6mL of the enriched medium and cultured at 25 ℃ and 180rpm for 12 hours.

3. mu.L of the cells were plated on a basal medium plate having a neomycin concentration of 100. mu.g/ml and cultured at 25 ℃ for 4 days.

4. Comparison of growth rate, lipid accumulation and fatty acid composition between schizochytrium mutant and wild strains: the obtained schizochytrium limacinum mutant strain and wild strain are inoculated into an enrichment medium for culture, and the change of the accumulation of mutant strain grease and DHA is identified (figure 2).

According to the invention, the activity of key metabolic sites is improved by directionally expressing key enzymes, microorganisms with expected characteristics can be rapidly obtained, and the directional modification of algae species is realized, so that the method is the most promising method for improving the performance of industrial microorganisms at present. The targeted modification of key sites belongs to the design range of molecular breeding and has very wide application value.

Example 2

This example is substantially the same as example 1, except that the original algal species used was the mutant algal species obtained in example 1, the expression cassette was an elongase derived from mortierella alpina (FIG. 3), and PCR was verified using primer 5 (CATCATCATCCTCAAGGGCCGCCGCTCGTC) and primer 6 (AGTCCTGCTCCTCGGCCACGAAGTGCACG); RT-PCR was performed using primer 7 (CTGCCGGCATCCCCTTCCCTGAGTACTA) and primer 8 (CTGGGCCTTCTTCTGAGCGGCGATG). And comparing the contents of grease and DHA in the transformant which over-expresses the malic enzyme gene and the elongase gene.

Compared with the starting alga, the schizochytrium limacinum mutant alga obtained by the two embodiments has the advantages that the proportion of grease in dry cell weight is increased by 48.63%, and the content of grease reaches 71.68% of dry weight of alga bodies; the DHA accounts for 38.69% of the dry weight of the cells, and the content of the DHA reaches 26.70% of the dry weight of the algae.

Claims

1. Schizochytrium sp (ATCC 20888) with improved preservation number by genetic modificationSchizochytrium) The method for the contents of the grease and the DHA is characterized by comprising the following steps: the algae species with high oil and fat and DHA content are obtained based on the improvement of intracellular reducing power and the supply of oil and fat synthesis precursors by over-expressing the function of specific enzyme, and the specific operation comprises the following steps:

(1) construction of a protein derived from Crypthecodinium cohnii (A)Crypthecodinium cohnii) An overexpression cassette of the malic enzyme gene of (1);

(2) transforming the malic enzyme gene overexpression box into schizochytrium sp with the preservation number of ATCC20888, and testing the contents of grease and DHA in an enrichment medium;

(3) construction of a microorganism derived from Mortierella alpinaMortierella) An overexpression cassette of the elongase gene of (4);

(4) the algae obtained in the previous step is taken as a starting algae, and an overexpression box containing the elongase gene is transformed into an algae body to obtain a final algae;

(5) detecting the contents of grease and DHA in the final algae in an enrichment medium, and identifying the grease and DHA content of the final algae;

the overexpression of the specific enzyme coding gene is introduced into the schizochytrium limacinum cells with the deposit number of ATCC20888 by an electroporation method.

2. The method according to claim 1, wherein the enrichment medium in step (2) is prepared from glucose 2-80 g, yeast extract 0.5-20 g, peptone 0.25-10 g, sea salt 1-40 g, and water to 1L, and has a pH of 7.0.

3. The method of claim 1, wherein the malic enzyme gene of step (1) is controlled by CaMV35s promoter and CaMV poly (A) terminator.

4. The method of claim 1, wherein the elongase gene of step (3) is controlled by CaMV35s promoter and Nos terminator.