CN109504784A - For predicting miRNA molecule mark and its application of body early embryo quality in people's assisted reproductive technology - Google Patents
For predicting miRNA molecule mark and its application of body early embryo quality in people's assisted reproductive technology Download PDFInfo
- Publication number
- CN109504784A CN109504784A CN201811561596.7A CN201811561596A CN109504784A CN 109504784 A CN109504784 A CN 109504784A CN 201811561596 A CN201811561596 A CN 201811561596A CN 109504784 A CN109504784 A CN 109504784A
- Authority
- CN
- China
- Prior art keywords
- mir
- hsa
- embryo
- mirna
- vitro culture
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses for predicting miRNA molecule mark and its application of body early embryo quality in people's assisted reproductive technology.Belong to technical field of molecular biology.Inventors have found that there are the patients that the expression of hsa-miR-26b-5p and hsa-miR-21-5p is significantly lower than Pregnancy failure in patient's embryo in vitro culture solution of successful pregnancy after carrying out IVF/ICSI-ET assisted reproductive therapy.The embryo quality of in vitro culture is assessed by detecting its expression in embryo medium, to pre-select embryo quality, to reduce transplanting embryo number during assisted reproductive therapy and improve Implantation rate, reach the target for reducing patient's multifetation probability and patient being avoided to carry out assisted reproduction cycles treatment again, not only have the advantages that Noninvasive diagnosis, and there is biggish Social benefit and economic benefit.
Description
Technical field
The invention belongs to technical field of molecular biology, it is related to for predicting body early embryo quality in people's assisted reproductive technology
Embryo medium in specific miRNA molecule mark and its application.
Background technique
Infertile is one of the healthy reproduction problem being concerned in global range, and the disease incidence in the couple at child-bearing age is about
It is 15%.In recent years, the rapid development of assisted reproductive technology is that the treatment of infertility brings many conveniences.Supplementary reproduction
Technology (assisted reproductive techniques, ARTs)) it mainly include a series of for Human germ cells (essence
Son and ovum) and body early embryo in vitro operation, such as (in vitro fertilization, IVF) in vitro fertilization, ovarian follicle slurry
Intracytoplasmic sperm injection (intracytoplasmic sperminjection, ICSI) and embryo transfer (embryo transfer,
ET) etc..The main target of ARTs is the pregnancy rate for improving single transplanting and the ratio for reducing multifetation.IVF/ICSI-ET
The pregnancy rate in period is by multifactor impact, and wherein embryo quality is an important factor for influencing implantation.Selection embryo quality is moved
The survival to embryo after transplanting is planted, implantation and life birth are most important.Currently, morphological indexes are prediction gestation knots during ART
The primary reference point of office, the main number according to embryonic blastomeres, whether the spilting of an egg uniform and embryo pieces assess early stage
Embryo quality, however, clinical research shows also to will appear implantation after morphologically normal embryo transfer due to inherent cause exception
Failure or meeting spontaneous abortion, this kind of infertile patients need to carry out assisted reproductive therapy again, this can be caused to most patients
On body, psychological and burden economically.Therefore, a kind of method for establishing new early prediction embryo quality, as form
The supplement for learning assessment has important clinical meaning to the development of assisted reproductive technology.
MiRNAs is small molecule non-coding single stranded RNA, is about 20-22 nucleotide, mainly by with mRNA
The complementary site of 3 ' non-coding regions combines, and regulates and controls the expression of target gene.MiRNA can with stablize be packaged after protein binding into
Enter in membranosomas, is further secreted into extracellular performance biological action.Studies have shown that can be detected in a variety of Human Fluids
The miRNA being stabilized, including serum, saliva, urine, sperm, amniotic fluid, milk, bronchial perfusate, cerebrospinal fluid, ascites, chest
Water and the culture solution of various kinds of cell system.Recently research report, human embryos can also secrete special miRNA to extracellularly
In environment.In addition, also there is research to confirm, miRNA participates in the biological function regulation during early embryonic development.Therefore, biological
MiRNA in body fluid may be as physiology and the significant notation object of pathologic process.
Existing research finds that the free miRNA in the circulatory system carries a variety of disease stamp informations, can be used as based on blood
The indicators of disease detection of liquid sample, especially to tumorigenic prediction.Recently, some researchs report, blastula embryo body
MiRNA express spectra and fereilizing style in outer culture solution, chromatin state and pregnancy outcome may be related.However, these are studied
It as a result is from the Real-time quantitative PCR based on chip, the integrality and accuracy for obtaining data remain to be confirmed.High pass
Amount sequencing technologies provide effective strategy for the express spectra of efficient sensitive detection miRNA, meanwhile, digital pcr technology is base
It is a kind of method of absolute quantitation in single-molecule PCR method come the nucleic acid quantification counted, has than relative quantification round pcr
There is more highly sensitive and accuracy.
The body early embryo quality evaluation index of non-damage, high sensitivity and high specific is established, to move in embryo
Before plant, more accurate screening high-quality embryo improves pregnancy rate, this is assisted reproductive technology field urgent problem to be solved,
It is the developing direction of accurate medical treatment.Currently, predicting the in vitro culture embryo of body early embryo quality in people's assisted reproductive technology not yet
The report of miRNA molecule marker in the culture solution of tire.
Summary of the invention
The present invention in view of the above problems, proposes high-quality by high throughput miRNA sequencing technologies screening in vitro culture
Specific expressed miRNA marker in the culture solution of embryo, and further verified by digital pcr technology, it establishes non-
The body early embryo quality evaluation index of damaging, high sensitivity and high specific is used for before embryo transfer, more accurately
Screening high-quality embryo improves pregnancy rate, is the developing direction of accurate medical treatment.
The present invention is achieved by the following technical solutions:
It is used in combination in a first aspect, providing miRNA molecule marker hsa-miR-26b-5p and hsa-miR-21-5p in people
The application in the embryo quality of in vitro culture, the molecular labeling hsa-miR-26b- are detected in supplementary reproduction before embryo transfer
The nucleotide sequence of 5p is as shown in SEQ ID NO:1, and the nucleotide sequence of hsa-miR-21-5p is as shown in SEQ ID NO:2, institute
The 2 miRNA molecule markers stated obvious low expression in the embryo in vitro culture solution of the patient of transplanting embryo successful pregnancy.
Second aspect provides miRNA molecule marker hsa-miR-26b-5p and hsa-miR-21-5p and is used in combination and making
Application in the tool for the embryo quality for detecting in vitro culture before embryo transfer in standby people's supplementary reproduction, the molecular labeling
The nucleotide sequence of hsa-miR-26b-5p is as shown in SEQ ID NO:1, the nucleotide sequence of hsa-miR-21-5p such as SEQ ID
Shown in NO:2, in the embryo in vitro culture solution of subject of the 2 miRNA molecule markers in transplanting embryo successful pregnancy
Obvious low expression.
The third aspect provides miRNA molecule marker hsa-miR-26b-5p and hsa-miR-21-5p and is used in combination and making
Application in the chip for the embryo quality for detecting in vitro culture before embryo transfer in standby people's supplementary reproduction, the chip includes solid phase
Carrier；And it is fixed on the oligonucleotide probe on the solid phase carrier, the oligonucleotide probe specifically respectively corresponds
Hsa-miR-26b-5p and hsa-miR-21-5p described in claim 1.
Fourth aspect provides miRNA molecule marker hsa-miR-26b-5p and hsa-miR-21-5p and is used in combination and making
Application in the kit for the embryo quality for detecting in vitro culture before embryo transfer in standby people's supplementary reproduction, the kit packet
It includes for detecting hsa-miR-26b-5p and hsa-miR-21-5p described in embryo medium outside subject's embryo transfer precursor
Expression reagent；With outside subject's embryo transfer precursor of transplanting embryo successful pregnancy described in embryo medium
The expression of hsa-miR-26b-5p and hsa-miR-21-5p compares, if the outer embryo medium of subject's embryo transfer precursor
The expression of middle hsa-miR-26b-5p and hsa-miR-21-5p significantly increases, then judges the in vitro culture of the subject
Embryo quality is poor, easily leads to transplanting embryo Pregnancy failure.
Preferably, in above-mentioned application, the kit includes being directed to the hsa-miR-26b-5p and hsa-miR-21-
The primer/or probe of 5p.
Preferably, in above-mentioned application, the core of the primer pair for hsa-miR-26b-5p and hsa-miR-21-5p
Nucleotide sequence is as follows:
Hsa-miR-26b-5p upstream primer: cgcagttcaagtaattcagga, as shown in SEQ ID NO:3；
Hsa-miR-21-5p upstream primer: gcagtagcttatcagactgatg, as shown in SEQ ID NO:4；
Downstream primer sequence is the general downstream of QIAGEN miRNA quantification kit miScript SYBR Green PCR
Primer.
Beneficial effects of the present invention:
Inventor has found in the course of the research, after carrying out IVF/ICSI-ET assisted reproductive therapy, the patient of successful pregnancy
In embryo in vitro culture solution there are the patient of the expression of hsa-miR-26b-5p and hsa-miR-21-5p and Pregnancy failure it
Between have significant difference.The embryo quality of in vitro culture is assessed by detecting its expression in embryo medium,
To pre-selecting embryo quality, to reduce transplanting embryo number during assisted reproductive therapy and improve Implantation rate, reach
To reducing patient's multifetation probability and patient being avoided to carry out the target of assisted reproduction cycles treatment again, not only have non-invasive
The advantages of diagnosis, and there is biggish Social benefit and economic benefit.
Detailed description of the invention
Fig. 1 is the embryo morphology of transplanting embryo successful pregnancy group and ineffective group；
Fig. 2 is that RNA-Seq high-flux sequence screens 18 species diversity expression in different pregnancy outcomes' mixing embryo mediums
The schematic diagram of miRNA；
Fig. 3 is the result that qRT-PCR method verifies that different pregnancy outcomes mix miRNA expression difference in embryo medium
Figure；
Fig. 4 be digital pcr method verify in different single embryo medium drops of pregnancy outcome hsa-miR-26b-5p and
The result figure of hsa-miR-21-5p expression difference；
Specific embodiment
By following detailed description combination attached drawing it will be further appreciated that the features and advantages of the invention.Provided implementation
Example is only the explanation to the method for the present invention, remaining content without limiting the invention in any way announcement.
[embodiment 1] sample collection and grouping
Embryo medium sample comes from Reproductive Medicine Center, Tongji Medical College, Huazhong Science and Technology Univ., the reproduction of Wuhan Concord Hospital
Center and Wuhan hospital, Tongji University reproductive center, research are examined and approved by Ethics Committee and obtain patient's informed consent.Body
Egg mother cell is usually placed in the 30-50ul drop containing 5000-10000 sperm by outer fertilization process implementation, and smart ovum is trained altogether
It supports 18-20 hour, brings it about in vitro fertilization, the normal fetus of double protokaryons is placed in the spilting of an egg by observation pronuclear morphology and quantity
In the dedicated commercialization embryo medium G1-plus of phase embryo cutting (Vitrolife company, Sweden), continuous culture 3 days
Afterwards, the culture solution for IVF-ET operation embryo, -80 DEG C of preservations are collected, and track the Clinical Outcome of transplanting embryo, are used for
Subsequent grouping and detection and analysis.According to the pregnancy outcome that IVF-ET performs the operation, embryo medium sample, which is divided into two big groups: A group, is
The equal successful pregnancy group of transplanting embryo, B group are Pregnancy failure group.Successful pregnancy group refers to that transplanting embryo is survived and clinical life birth；It is pregnant
Ineffective group of being pregnent includes the only non-clinical pregnancy of biochemical pregnancies, spontaneous abortion, the implantation termination of pregnancy caused by reasons such as unsuccessfully.Every component
15 embryo medium sample mixing are not taken to carry out miRNA high-flux sequence, two groups of embryo morphologies are as shown in Fig. 1.
[embodiment 2] extracts total serum IgE and miRNA library construction
Total serum IgE is extracted from the embryo medium sample of A group and B group respectively, (U.S. Thermo is public with Nanodrop instrument
Department) and quality inspection quantitative to extracted total serum IgE, library kit (NEB company, the U.S.) is built using miRNA, and the RNA of acquisition is distinguished
Add 3 ' and 5 ' connectors, expanded by RT-PCR, electrophoresis recycles the purpose band of 145-160bp to get the library miRNA is arrived.
[embodiment 3] RNA-Seq high-flux sequence screens difference miRNA
Qubit (invitrogen company, the U.S.) quantifies the library miRNA, carries out fasciation at so with Start cBot instrument
Sequencing is carried out with Hiseq2500 (illumnia company, the U.S.) afterwards and obtains initial data, and carries out miRNA expression quantity calculating.Benefit
Differential expression analysis is carried out to two groups of samples with DESeq software, calculation expression amount, organizes interior mean value and group difference expresses multiple,
And log2 (fold differences) value is further calculated, value≤0.05 P and when log2 (fold differences) >=1 between meeting two groups is recognized
It is expressed between two groups for the miRNA variant.By carrying out above-mentioned Differential expression analysis to sequencing data, and combine miRNA target
The GO clustering of the specific biological function of gene filters out biological function 18 differential expressions relevant to embryonic development regulation
MiRNA is as follows: hsa-miR-372-3p, hsa-miR-373-3p, hsa-miR-155-5p, hsa-miR-423-5p, hsa-
miR-92b-3p,hsa-miR-3168,hsa-miR-193-5p,hsa-miR-371a-5p,hsa-miR-4488,hsa-miR-
21-5p,hsa-miR-26b-5p,hsa-miR-10a-5p,hsa-miR-27a-3p,hsa-miR-451a,hsa-miR-200b-
3p, hsa-miR-200c-3p, hsa-miR-26a-5p, hsa-miR-27b-3p (P value is ≤0.05), as shown in Fig. 2.
[embodiment 4] qRT-PCR method verifies miRNA expression difference in different pregnancy outcome's mixing embryo mediums
The miRNA screened for above 18, with tailing PCR method, design primer (table 1) respectively mixes A group and B group
The quantitative qRT-PCR detection that culture solution carries out miRNA is closed, with C.elegans miR-39miRNA as outer ginseng (U.S. QIAGEN
Company, the miRNA are that external source is added in extractive process, are defined in A and two groups of B differential expression does not occur), it verifies to be selected
The specifically expressing of miRNA marker.
1) total serum IgE is extracted, reverse transcription is at cDNA；
2) take cDNA carry out RT-qPCR reaction, upstream primer is as shown in table 1, with C.elegans miR-39miRNA as
Outer ginseng, outer reference object come from the micro extraction agent box of miRNA (QIAGEN, miRNeasy Serum/Plasma Kit, Cat
No.217184).Every miRNA is all made of specific forward primer and QIAGEN miRNA quantitative reagent by being directed to the miRNA
The primer pair that box (miScript SYBR Green PCR) general reverse primer is constituted is expanded.
3) statistically analyze: every group of experiment is repeated 3 times above, and data are indicated with means standard deviation, utilize SPSS17.O
T inspection is carried out to two groups of sample averages, value≤0.05 P is with statistical difference.
The upstream primer sequence of 1,18 miRNA of table
| Primer | Primer sequence |
| hsa-miR-373-3p-F | ggaagtgcttcgattttgg |
| hsa-miR-372-3p-F | agtgctgcgacatttgag |
| hsa-miR-92b-3p-F | cgcagtattgcactcgtc |
| hsa-miR-3168-F | cgcaggagttctacagtca |
| hsa-miR-371a-5p-F | cgcagactcaaactgtg |
| hsa-miR-193b-5p-F | gcagcggggttttgag |
| hsa-miR-423-5p-F | gggcagagagcgagac |
| hsa-miR-4488-F | gggggcgggctc |
| hsa-miR-155-5p-F | cgcagttaatgctaatcgtgatag |
| hsa-miR-21-5p-F | gcagtagcttatcagactgatg |
| hsa-miR-26b-5p-F | cgcagttcaagtaattcagga |
| hsa-miR-10a-5p-F | gcagtaccctgtagatccga |
| hsa-miR-27b-3p-F | cagttcacagtggctaagttc |
| hsa-miR-26a-5p-F | gcagttcaagtaatccaggatag |
| hsa-miR-27a-3p-F | cagttcacagtggctaagttc |
| hsa-miR-451a-F | cagaaaccgttaccattactga |
| hsa-miR-200c-3p-F | agtaatactgccgggtaatga |
| hsa-miR-200b-3p-F | cgcagtaatactgcctggt |
4) result is as shown in Fig. 3, and it is extremely significant that RT-qPCR detects that 8 miRNA have between Pregnancy Success and ineffective group altogether
Difference, respectively hsa-miR-372-3p, hsa-miR-373-3p, hsa-miR-451a, hsa-miR-200c-3p, hsa-
MiR-27a-3p, hsa-miR-26b-5p, hsa-miR-21-5p and hsa-miR-10a-5p.
5) conclusion: the expression of this visible 8 miRNA can be as the alternate labels object of prediction body early embryo quality.
[embodiment 5] digital pcr method verifies above-mentioned 8 miRNA tables in the different single embryo medium drops of pregnancy outcome
Up to amount difference
1) sample is collected: will track early period the embryo medium sample of Clinical Outcome according to Pregnancy failure with successfully
It is divided into the transplanting embryo culture solution that two groups: P group is successful pregnancy, F group is the transplanting embryo culture solution of Pregnancy failure, and every group takes
50 samples.
2) total serum IgE in single embryo medium drop is extracted using micro RNA extracts kit (U.S. QIAGEN), with
C.elegans miR-39miRNA is as outer ginseng.
3) cDNA synthesizes (U.S. life), including poly (A) tailings reactions, the reaction of adjunction head, reverse transcription reaction；
4) the pre- amplified reaction (U.S. life) of miRNA.
5) real-time quantitative PCR reaction is carried out to 8 alternative miRNA using digital pcr instrument (U.S. Bio-Rad), used
The dedicated specific probe of U.S.'s life company trade.
6) it statisticallys analyze: two groups of sample China and foreign countries ginseng C.elegans miR-39miRNA sample being not detected is considered
Invalid sample is rejected, and two groups of sample standard deviations are indicated with median and quartile, using SPSS17.0 software, is had to two groups
It imitates data and carries out Mann-Whitney rank sum test, value≤0.05 P is with statistical difference.
7) result: as shown in attached drawing 4A, 4B, 2 kinds of miRNA express obvious low in the embryo medium drop of Pregnancy Success
In the embryo medium drop of Pregnancy failure, respectively hsa-miR-26b-5p (P=0.0019) and hsa-miR-21-5p (P=
0.014), sequence is as shown in table 2；
8) conclusion: hsa-miR-26b-5p and hsa-miR-21-5p can be used as the mark for predicting body early embryo quality
Remember object.
The nucleotide sequence of 2,2 miRNA of table
| MiRNA title | MiRNA sequence |
| hsa-miR-21-5p | uagcuuaucagacugauguuga |
| hsa-miR-26b-5p | uucaaguaauucaggauaggu |
[embodiment 6] digital pcr method detects hsa-miR-26b-5p and hsa-miR-21-5p table in Single Embryo culture solution
It is all from life company, the U.S. up to horizontal agents useful for same, instrument and equipment comes from U.S. Bio-Rad company:
1) total serum IgE in Single Embryo culture solution is extracted；
2) it after reverse transcription is cDNA, is expanded in advance, cDNA is then subjected to 1:10 dilution；
3) it is anti-to prepare probe standard measure for digital pcr method detection hsa-miR-26b-5p and hsa-miR-21-5p expression
Answer system:
10μl TaqMan Fast Advanced Master Mix
1 μ l TaqMan hsa-miR-26b-5p or hsa-miR-21-5p probe
4 μ l RNase-free water
CDNA after 5 μ l dilution
Total 20 μ l systems, concussion mix, and are centrifuged bubble removing；
4) reaction solution is transferred among DG8cartridge in 8 holes of a row, is added in 8 holes of a bottom row
70ul droplet generates oil, is put in droplet and generates in instrument, starts to prepare droplet；
5) droplet is created in one round of the top DG8cartridge, is drawn 40ul into 96 hole PCR reaction plates, is sealed
Real-time quantitative PCR reaction is carried out after film；
6) it after PCR amplification, is read using droplet reading instrument and analyzes result.
Sequence table
<110>Reproductive Medicine Center, Tongji Medical College, Huazhong Science and Technology Univ. (reproductive medicine section hospital, Wuhan Tongji University)
<120>for predicting miRNA molecule mark and its application of body early embryo quality in people's assisted reproductive technology
<160> 20
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> RNA
<213>artificial sequence (Artificial Sequence)
<400> 1
uucaaguaau ucaggauagg u 21
<210> 2
<211> 22
<212> RNA
<213>artificial sequence (Artificial Sequence)
<400> 2
uagcuuauca gacugauguu ga 22
<210> 3
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
cgcagttcaa gtaattcagg a 21
<210> 4
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
gcagtagctt atcagactga tg 22
<210> 5
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
ggaagtgctt cgattttgg 19
<210> 6
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
agtgctgcga catttgag 18
<210> 7
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
cgcagtattg cactcgtc 18
<210> 8
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
cgcaggagtt ctacagtca 19
<210> 9
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
cgcagactca aactgtg 17
<210> 10
<211> 16
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
gcagcggggt tttgag 16
<210> 11
<211> 16
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
gggcagagag cgagac 16
<210> 12
<211> 12
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
gggggcgggc tc 12
<210> 13
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
cgcagttaat gctaatcgtg atag 24
<210> 14
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 14
cagttcacag tggctaagtt c 21
<210> 15
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 15
gcagttcaag taatccagga tag 23
<210> 16
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 16
cagttcacag tggctaagtt c 21
<210> 17
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 17
cagaaaccgt taccattact ga 22
<210> 18
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 18
agtaatactg ccgggtaatg a 21
<210> 19
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 19
cgcagtaata ctgcctggt 19
<210> 20
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 20
gcagtaccct gtagatccga 20
Claims (6)
- The embryo in people's supplementary reproduction is used in combination in 1.miRNA molecular marked compound hsa-miR-26b-5p and hsa-miR-21-5p Application before transplanting in the embryo quality of detection in vitro culture, which is characterized in that the molecular labeling hsa-miR-26b-5p Nucleotide sequence as shown in SEQ ID NO:1, the nucleotide sequence of hsa-miR-21-5p is described as shown in SEQ ID NO:2 2 miRNA molecule markers in the embryo in vitro culture solution of the subject of transplanting embryo successful pregnancy obvious low expression.
- 2.miRNA molecular marked compound hsa-miR-26b-5p and hsa-miR-21-5p are used in combination in preparation people's supplementary reproduction The application in the tool of the embryo quality of in vitro culture is detected before embryo transfer, which is characterized in that the molecular labeling hsa- The nucleotide sequence of miR-26b-5p is as shown in SEQ ID NO:1, the nucleotide sequence of hsa-miR-21-5p such as SEQ ID NO: It is bright in the embryo in vitro culture solution of subject of the 2 miRNA molecule markers in transplanting embryo successful pregnancy shown in 2 Aobvious low expression.
- 3.miRNA molecular marked compound hsa-miR-26b-5p and hsa-miR-21-5p are used in combination in preparation people's supplementary reproduction The application in the chip of the embryo quality of in vitro culture is detected before embryo transfer, which is characterized in that the chip includes that solid phase carries Body；And it is fixed on the oligonucleotide probe on the solid phase carrier, the oligonucleotide probe is specifically corresponding respectively to be weighed Benefit require 1 described in hsa-miR-26b-5p and hsa-miR-21-5p.
- 4.miRNA molecular marked compound hsa-miR-26b-5p and hsa-miR-21-5p are used in combination in preparation people's supplementary reproduction The application in the kit of the embryo quality of in vitro culture is detected before embryo transfer, which is characterized in that the kit includes For detecting outside subject's embryo transfer precursor hsa-miR-26b-5p and hsa- described in claim 1 in embryo medium The reagent of the expression of miR-21-5p；With embryo medium outside subject's embryo transfer precursor of transplanting embryo successful pregnancy In the expression of hsa-miR-26b-5p and hsa-miR-21-5p described in claim 1 compare, if subject's embryo transfer The expression of hsa-miR-26b-5p and hsa-miR-21-5p significantly increases in the outer embryo medium of precursor, then judgement should be by The embryo quality of the in vitro culture of examination person is poor, easily leads to transplanting embryo Pregnancy failure.
- 5. application according to claim 4, which is characterized in that the kit includes being directed to the hsa-miR-26b-5p With the primer/or probe of hsa-miR-21-5p.
- 6. application according to claim 5, which is characterized in that described to be directed to hsa-miR-26b-5p and hsa-miR-21- The nucleotide sequence of the primer pair of 5p is as follows:Hsa-miR-26b-5p upstream primer: cgcagttcaagtaattcagga, as shown in SEQ ID NO:3；Hsa-miR-21-5p upstream primer: gcagtagcttatcagactgatg, as shown in SEQ ID NO:4；Downstream primer sequence is that the general downstream of QIAGEN miRNA quantification kit miScript SYBR Green PCR is drawn Object.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811561596.7A CN109504784B (en) | 2018-12-20 | 2018-12-20 | MiRNA molecular marker for predicting early embryo quality in human assisted reproduction technology and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811561596.7A CN109504784B (en) | 2018-12-20 | 2018-12-20 | MiRNA molecular marker for predicting early embryo quality in human assisted reproduction technology and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109504784A true CN109504784A (en) | 2019-03-22 |
| CN109504784B CN109504784B (en) | 2022-03-15 |
Family
ID=65753863
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811561596.7A Active CN109504784B (en) | 2018-12-20 | 2018-12-20 | MiRNA molecular marker for predicting early embryo quality in human assisted reproduction technology and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109504784B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110804659A (en) * | 2019-10-23 | 2020-02-18 | 华南农业大学 | Application of serum exosome ssc-miR-92b-3p as molecular marker for early pregnancy diagnosis of sow |
| CN111560443A (en) * | 2020-06-19 | 2020-08-21 | 湖南人文科技学院 | Group of biomolecular markers for screening high-quality porcine oocytes and application thereof |
| CN112029849A (en) * | 2020-09-15 | 2020-12-04 | 南京鼓楼医院 | Use of biomarkers in pregnancy assessment |
| CN112501272A (en) * | 2020-12-15 | 2021-03-16 | 山东第一医科大学(山东省医学科学院) | Application of miRNA (micro ribonucleic acid) as biomarker in prediction of IVF-ET (IVF-ET) outcome |
| WO2021177904A1 (en) * | 2020-03-02 | 2021-09-10 | Univerzita Pavla Jozefa Šafárika V Košiciach | Non-invasive successfulness test of in vitro fertilization process |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012069613A1 (en) * | 2010-11-24 | 2012-05-31 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for selecting competent oocytes and competent embryos with high potential for pregnancy outcome |
| WO2013056002A1 (en) * | 2011-10-12 | 2013-04-18 | University Of Iowa Research Foundation | Use of microrna for assessing embryos grown in vitro and improving culture media |
| CN103305551A (en) * | 2013-06-09 | 2013-09-18 | 西北农林科技大学 | Method for screening donor cell line based on blastocyst gene expression level |
| CN104080911A (en) * | 2011-11-30 | 2014-10-01 | 不来梅大学 | Expression of miRNAs in placental tissue |
| CN104789684A (en) * | 2015-05-04 | 2015-07-22 | 四川大学华西第二医院 | Kit applied to embryonic development quality evaluation and use method |
| CN108642175A (en) * | 2018-08-17 | 2018-10-12 | 广西医科大学第附属医院 | Body early embryo stops educating the detection method of chorionic villi miRNAs biomarkers and its expression quantity |
-
2018
- 2018-12-20 CN CN201811561596.7A patent/CN109504784B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012069613A1 (en) * | 2010-11-24 | 2012-05-31 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for selecting competent oocytes and competent embryos with high potential for pregnancy outcome |
| WO2013056002A1 (en) * | 2011-10-12 | 2013-04-18 | University Of Iowa Research Foundation | Use of microrna for assessing embryos grown in vitro and improving culture media |
| CN104080911A (en) * | 2011-11-30 | 2014-10-01 | 不来梅大学 | Expression of miRNAs in placental tissue |
| CN103305551A (en) * | 2013-06-09 | 2013-09-18 | 西北农林科技大学 | Method for screening donor cell line based on blastocyst gene expression level |
| CN104789684A (en) * | 2015-05-04 | 2015-07-22 | 四川大学华西第二医院 | Kit applied to embryonic development quality evaluation and use method |
| CN108642175A (en) * | 2018-08-17 | 2018-10-12 | 广西医科大学第附属医院 | Body early embryo stops educating the detection method of chorionic villi miRNAs biomarkers and its expression quantity |
Non-Patent Citations (3)
| Title |
|---|
| ANTONIO CAPALBO ET AL.: ""MicroRNAs in spent blastocyst culture medium are derived from trophectoderm cells and can be explored for human embryo reproductive competence assessment"", 《FERTILITY AND STERILITY》 * |
| CHAO ZHANG ET AL.: ""The Anti-Apoptotic Role of Berberine in Preimplantation Embryo In Vitro Development through Regulation of miRNA-21"", 《PLOS ONE》 * |
| EVAN M. ROSENBLUTH ET AL.: ""Human embryos secrete microRNAs into culture media—a potential biomarker for implantation"", 《FERTILITY AND STERILITY》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110804659A (en) * | 2019-10-23 | 2020-02-18 | 华南农业大学 | Application of serum exosome ssc-miR-92b-3p as molecular marker for early pregnancy diagnosis of sow |
| CN110804659B (en) * | 2019-10-23 | 2023-02-03 | 华南农业大学 | Application of serum exosome ssc-miR-92b-3p as molecular marker for early pregnancy diagnosis of sows |
| WO2021177904A1 (en) * | 2020-03-02 | 2021-09-10 | Univerzita Pavla Jozefa Šafárika V Košiciach | Non-invasive successfulness test of in vitro fertilization process |
| CN111560443A (en) * | 2020-06-19 | 2020-08-21 | 湖南人文科技学院 | Group of biomolecular markers for screening high-quality porcine oocytes and application thereof |
| CN112029849A (en) * | 2020-09-15 | 2020-12-04 | 南京鼓楼医院 | Use of biomarkers in pregnancy assessment |
| CN112501272A (en) * | 2020-12-15 | 2021-03-16 | 山东第一医科大学(山东省医学科学院) | Application of miRNA (micro ribonucleic acid) as biomarker in prediction of IVF-ET (IVF-ET) outcome |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109504784B (en) | 2022-03-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109504784A (en) | For predicting miRNA molecule mark and its application of body early embryo quality in people's assisted reproductive technology | |
| CN102459635B (en) | For pregnancy outcome, there is the competence ovocyte of high potential and the method for competence embryo for selecting | |
| De Bem et al. | Low levels of exosomal-miRNAs in maternal blood are associated with early pregnancy loss in cloned cattle | |
| CN111778326B (en) | Gene marker combination for endometrial receptivity assessment and application thereof | |
| CN105420405B (en) | The cow's serum microRNA molecule of milk cow Fatty Liver Disease and cow in perinatal period related metabolic diseases label | |
| KR20150070308A (en) | Systems and methods for determining the probability of a pregnancy at a selected point in time | |
| CN109112209B (en) | Reference product for noninvasive prenatal detection of fetal aneuploid chromosomes | |
| Kussano et al. | Molecular markers for oocyte competence in bovine cumulus cells | |
| US20150031030A1 (en) | Method for analysing foetal nucleic acids | |
| US9090938B2 (en) | Methods for selecting competent oocytes and competent embryos with high potential for pregnancy outcome | |
| CN105039530A (en) | Mitochondria-related seminal plasma miRNAs taken as mankind severe asthenospermia markers, and applications thereof | |
| Kehler et al. | Elevated hsa-miR-99a levels in maternal plasma may indicate congenital heart defects | |
| CN106701977A (en) | Quantitative PCR (Polymerase Chain Reaction) detection kit for detecting quality of human oocytes | |
| Nix et al. | Cleavage kinetics is a better indicator of embryonic developmental competency than brilliant cresyl blue staining of oocytes | |
| CN108796065A (en) | Applications of the FAM127A in disease of pregnancy | |
| RU2474823C1 (en) | Method for prediction of embryo quality in extracorporeal fertilisation programme | |
| CN115482935B (en) | Lung adenocarcinoma patient prognosis model for predicting small cell transformation and establishment method thereof | |
| CN105483246A (en) | Application of differential expression of gene in oral cancer diagnosis | |
| Sarwalia et al. | Establishment of repertoire of placentome-associated micrornas and their appearance in blood plasma could identify early establishment of pregnancy in buffalo (Bubalus bubalis) | |
| Pandey et al. | Comparative analysis of developmental and molecular correlates of developmental competence of buffalo oocytes derived from small and large follicles | |
| CN108624678A (en) | A kind of biomarker for preeclampsia diagnosis and treatment | |
| Sprícigo et al. | Using Cumulus Cell Biopsy as a Non-Invasive Tool to Access the Quality of Bovine Oocytes: How Informative Are They? | |
| CN108728531A (en) | Applications of the biomarker CBX8 in preeclampsia diagnosis and treatment | |
| CN109929918B (en) | Method for evaluating quality of eggs and embryos based on granular cell gene expression condition | |
| CN114941025B (en) | miRNA for diagnosing preeclampsia and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |