CN109486916B - Method for detecting allele differential expression - Google Patents

Abstract

The invention provides a method for detecting allele differential expression. Specifically, the invention is based on the fluorescent group marking primer strategy for the first timeSlightly amplifying the gene to be detected, carrying out quantification by using a restriction enzyme digestion method, and measuring the number M of the detectable markers of the second amplification product LA _LA The number M of detectable labels bound to the second amplification product LG _LG Thereby detecting differential expression of the allele.

Description

Method for detecting allele differential expression

Technical Field

The invention relates to the technical field of biology, in particular to a method for detecting allele differential expression.

Background

The first study on the differential expression of alleles revealed that human beings had the phenomenon of genetic imprinting and X-chromosome inactivation, and later, it was gradually confirmed that the phenomenon of differential expression of alleles was widely present in various organisms. The main reason for the phenomenon of allelic differential expression is the presence of polymorphisms between alleles, which play a very important role in regulating gene expression and may ultimately be linked to the phenotypic polymorphism of the organism. Nowadays, with the rapid development of sequencing technology, a large amount of nucleotide sequence information is decoded, and by analyzing these base sequences, it is found that even within the same species, there are large differences in the nucleotide sequences of alleles thereof. The same allele can be differentially expressed in different individuals and tissues, and the differential expression type can be different.

As early as 90 s in the 20 th century, allelic gene differential expression analysis methods have been gradually developed, and with the continuous progress of molecular biology techniques, the allelic gene differential expression has been intensively studied, so that methods for verifying differentially expressed genes have been promoted to be enriched and improved, advantages have been shown in the aspects of mining new functional genes and revealing new functions of genes, and the search for differentially expressed genes has become more convenient. However, due to the complicated control mechanism of allele differential expression and the imperfect detection technology, there is still no effective technology for solving the problem. Thus, the role played by the differential expression of alleles in various organisms remains to be explored.

The current methods for detecting allelic gene differential expression mainly include Subtractive Hybridization (SH), mRNA differential display reverse transcription PCR (DDRT-PCR), expression series tags (SAGE), cDNA restriction fragment length polymorphism analysis (cDNA-AFLP), gene chip (DNA Chips) technology, semi-quantitative RT-PCR, real-time fluorescence quantitative PCR technology, transcriptome sequencing (RNA-seq) technology and the like. The above techniques can detect allele differential expression, but all have certain disadvantages, such as tedious operation, time and labor consuming, high price, low sensitivity, poor repeatability, high false positive and the like. These methods limit the study of allele differential expression in some way, and also hinder the study of the action and mechanism of allele differential expression in organisms.

The existing research shows that the copy number variation exists in the genome of organisms in large quantity, forms an important component of the genome structure variation, belongs to an important biogenetic variation resource of organisms, is related to the diversity of phenotypes, and plays an important role in the evolution and development of species. The copy number variation in genome is various, such as duplication, deletion, multiple duplication of a single fragment, multiple duplication of multiple fragments, etc. The detection method mainly comprises two methods, one is to detect the variation of unknown copy number in the whole genome range, and comprises a chip technology and a sequencing technology, the method has higher cost and is less used at present; the other is site-directed detection or validation of known copy number variation, where real-time quantitative PCR is the most commonly used but less accurate.

Therefore, there is an urgent need in the art to develop a new method capable of rapidly detecting allele differential expression and gene copy number.

Disclosure of Invention

The invention aims to provide a novel method for rapidly detecting allele differential expression and gene copy number, in particular to a novel method for detecting allele differential expression and gene relative copy number, and can make up the defects of the existing detection method. So as to discover new functional genes with differential expression and reveal new functions of the genes. In the invention, a very simple method for detecting allele differential expression and gene copy number is provided, alleles with differential expression are successfully detected by applying the method, and the copy number difference among different individuals is accurately detected.

In a first aspect of the invention, there is provided a method for detecting differential expression of alleles, comprising the steps of:

(a) Providing a sample to be detected, wherein the sample is an allele cDNA sample;

(b) Performing PCR amplification on the allele sequence of the sample to be detected by using the cDNA sample as a template and a first primer pair so as to obtain a first amplification product;

(c) Performing PCR amplification on the first amplification product obtained in step (b) with a second primer pair carrying a detectable label using the first amplification product as a template, thereby obtaining a second amplification product, wherein the second amplification product carries the detectable label;

(d) Digesting the second amplification product obtained in the step (c) under the action of a restriction enzyme, wherein when the second amplification product does not contain a cleavage site of the restriction enzyme, a second amplification product LA which is not digested and has the detectable label is formed; forming a second amplification product LG that is cleaved by an enzyme and carries the detectable label when the second amplification product contains a cleavage site for the restriction enzyme, wherein the length L1 of the second amplification product LA is different from the length L2 of the second amplification product LG;

(e) Separating the second amplification product LA and the second amplification product LG; and

(f) Determining the amount M of detectable label of the second amplification product LA _LA The number M of detectable labels bound to the second amplification product LG _LG Thereby detecting differential expression of the allele.

In another preferred example, in the step (c), the number of reaction cycles of PCR amplification is 1.

In another preferred embodiment, the detectable label is selected from the group consisting of: a fluorophore, a chemiluminescent group, a chromophore, or a combination thereof.

In another preferred embodiment, the detectable label is a fluorophore.

In another preferred example, in step (f), the fluorescence intensity of the second amplification product LA and the second amplification product LG are measured and compared to determine the differential expression of the alleles.

In another preferred embodiment, the alleles include wild type (or first subtype) alleles and mutant (or second subtype) alleles.

In another preferred embodiment, amplification products corresponding to the wild-type allele contain the enzyme cleavage site, while amplification products corresponding to the mutant allele do not contain the enzyme cleavage site.

In another preferred embodiment, amplification products corresponding to the wild-type allele do not contain the enzyme cleavage site, while amplification products corresponding to the mutant allele do contain the enzyme cleavage site.

In another preferred embodiment, the first primer pair is a perfect match to the sample.

In another preferred embodiment, the first primer pair does not completely match the sample.

In another preferred embodiment, at least one primer of the first primer pair carries an enzyme cleavage site.

In another preferred embodiment, the second primer pair carries one, two or more fluorophores.

In another preferred embodiment, the fluorescent group labeled by the second primer pair is completely matched or incompletely matched with the template.

In another preferred embodiment, the second primer pair comprises a single primer fluorophore label or a two primer fluorophore label.

In another preferred embodiment, the end point of the PCR reaction is quantified.

In another preferred embodiment, the electrophoresis of the PCR amplification product comprises agarose gel electrophoresis or polyacrylamide gel electrophoresis.

In another preferred embodiment, two PCR reactions are performed for quantification. The first step PCR amplification primer is a first primer pair; the second PCR amplification primer is a second primer pair.

In another preferred embodiment, the fluorescent label is selected from the group consisting of: fluorescein Isothiocyanate (FITC), hydroxyfluorescein (FAM), tetrachlorofluorescein (TET), methyldichlorocarboxfluorescein (JOE), hexachloromethylfluorescein (HEX), CY3, CY5, carboxytetramethylrhodamine (TAMRA), ROX, texas Red, LC RED640, LC RED705, or combinations thereof.

In another preferred embodiment, the upstream primer and/or the downstream primer of the second primer pair carry one or more fluorescent labeling groups at their 5' ends.

In another preferred embodiment, the upstream primer and/or the downstream primer of the second primer pair carry more than 2 fluorescent labels.

In another preferred embodiment, the primer contains a plurality of fluorescent labels, wherein at least one fluorescent label is at the 5' end.

In another preferred embodiment, when a primer contains more than 2 fluorescent labels, the difference in distance between any of the fluorescent labels is 2-40bp, preferably 3-20bp, more preferably 4-15bp.

In another preferred embodiment, the sequences of the first primer pair and the second primer pair may be the same or different.

In another preferred embodiment, the concentration of the first primer pair is 0.5 to 25. Mu.M, preferably 1 to 20. Mu.M, more preferably 2 to 10. Mu.M.

In another preferred embodiment, the concentration of the second primer pair is 0.5-25. Mu.M, preferably 1-20. Mu.M, more preferably 2-10. Mu.M.

In another preferred embodiment, in step (e), when the fluorescence intensity Y of LA is higher than that of LA _La Fluorescence intensity Y with LG _LG There is a significant difference (e.g., the ratio of the maximum fluorescence intensity to the minimum fluorescence intensity in the two (i.e., max (Y)) _La ，Y _LG )/Min(Y _La ，Y _LG ) Equal to or greater than 1.2, preferably equal to or greater than 1.3, most preferably equal to or greater than 1.4), then significant differential expression of the allele can be detected.

In another preferred embodiment, the ratio of the detected expression difference between alleles in the test sample is 64:1 to 1:1 to 1:32, more preferably 16:1 to 1:16.

in another preferred example, the sample to be tested is from an animal, a plant, a bacterium, a virus, or any species.

In another preferred embodiment, the sample to be tested is from an animal (e.g., a human or non-human mammal), or a plant (e.g., a crop, a floral plant, a forestry plant).

In another preferred embodiment, the non-human mammal includes a rodent (e.g., mouse, rat, rabbit), cow, pig, sheep, horse, dog, cat, non-human primate (e.g., monkey).

In another preferred embodiment, the allele comprises a structural gene, a regulatory gene, or a combination thereof.

In another preferred embodiment, the allele comprises a protein-encoding gene, a miRNA gene, or a combination thereof.

In another preferred embodiment, the allele is selected from the group consisting of: KIT, PLAG1, RRM2B, CPE, IGF1R, PAPPA2, or a combination thereof.

In another preferred embodiment, the allele is selected from the group consisting of: KIT, PLAG1, or a combination thereof.

In a second aspect, the present invention provides a kit for detecting allelic differential expression, comprising:

(i) A first primer pair for amplifying a cDNA to be tested corresponding to an allele, thereby obtaining a first amplification product;

(ii) A second primer pair detectably labeled for amplifying the first amplification product to obtain a second amplification product; and

(iii) A restriction enzyme;

wherein said alleles comprise wild type (or first subtype) alleles and mutant type (or second subtype) alleles;

and the amplification product corresponding to the wild-type allele contains a cleavage site corresponding to the restriction enzyme, and the amplification product corresponding to the mutant allele does not contain the cleavage site; or the amplification product corresponding to the wild-type allele does not contain a cleavage site corresponding to the restriction enzyme and the amplification product corresponding to the mutant allele contains the cleavage site.

In another preferred embodiment, the components are located in different containers.

In a third aspect the invention provides a method of detecting the relative copy number of an allele of an individual, the method comprising the steps of:

(a) Providing a test sample, wherein the test sample is a genomic DNA sample and the sample contains an exogenously added reference allele corresponding to the wild-type allele, and the reference allele contains a base mutation compared with the nucleotide sequence of the wild-type allele;

(b) Performing PCR amplification on the allele sequence of the sample to be detected by using the sample as a template and a first primer pair so as to obtain a first amplification product;

(c) Performing PCR amplification on the first amplification product obtained in step (b) with a second primer pair carrying a detectable label using the first amplification product as a template, thereby obtaining a second amplification product, wherein the second amplification product carries the detectable label;

(d) Digesting the second amplification product obtained in the step (c) under the action of a restriction enzyme, wherein when the second amplification product does not contain a cleavage site of the restriction enzyme, a second amplification product LA which is not digested and has the detectable label is formed; forming a second amplification product LG that is cleaved by an enzyme and carries the detectable label when the second amplification product contains a cleavage site for the restriction enzyme, wherein the length L1 of the second amplification product LA is different from the length L2 of the second amplification product LG;

(e) Separating the second amplification product LA and the second amplification product LG; and

(f) Determining the amount M of detectable label of the second amplification product LA _LA The number M of detectable labels bound to the second amplification product LG _LG Thereby detecting the relative copy number of the allele of the individual.

In another preferred embodiment, the base mutation is a mutation of 1-8 bases or 1-6 bases or 1-4 bases.

In another preferred embodiment, said exogenously added reference allele corresponding to said wild type allele is located on a plasmid.

In another preferred embodiment, said reference allele forms a cleavage site for said restriction enzyme at said base mutation.

In another preferred example, in the step (c), the number of reaction cycles of PCR amplification is 1.

In another preferred embodiment, the detectable label comprises a fluorophore, a chemiluminescent gene, a chromophore, or a combination thereof.

In another preferred embodiment, the detectable label is a fluorophore.

In another preferred example, in step (f), the fluorescence intensity of the second amplification product LA and the second amplification product LG are measured and compared to determine the relative copy number of the alleles of an individual.

In another preferred embodiment, the amplification product corresponding to the wild-type allele does not contain a cleavage site corresponding to the restriction enzyme, whereas the amplification product corresponding to the reference-type allele contains the cleavage site.

In another preferred embodiment, the enzyme cleavage site contained in the amplification product of the reference allele is artificially introduced.

In another preferred embodiment, the second primer pair carries one, two or more fluorophores.

In another preferred embodiment, the fluorescent group labeled by the second primer pair is completely matched or incompletely matched with the template.

In another preferred embodiment, the second primer pair comprises a single primer fluorophore label or a double primer fluorophore label.

In another preferred embodiment, the end point of the PCR reaction is quantified.

In another preferred embodiment, the electrophoresis of the PCR amplification product comprises agarose gel electrophoresis or polyacrylamide gel electrophoresis.

In another preferred embodiment, two PCR reactions are performed for quantification. The first step PCR amplification primer is a first primer pair; the second PCR amplification primer is a second primer pair.

In another preferred embodiment, the fluorescent label is selected from the group consisting of: fluorescein Isothiocyanate (FITC), hydroxyfluorescein (FAM), tetrachlorofluorescein (TET), methyldichlorocarboxfluorescein (JOE), hexachloromethylfluorescein (HEX), CY3, CY5, carboxytetramethylrhodamine (TAMRA), ROX, texas Red, LC RED640, LC RED705, or combinations thereof.

In another preferred embodiment, the upstream primer and/or the downstream primer of the second primer pair carry one or more fluorescent labeling groups at their 5' ends.

In another preferred embodiment, the concentration of the first primer pair is 0.5 to 25. Mu.M, preferably 1 to 20. Mu.M, more preferably 2 to 10. Mu.M.

In another preferred embodiment, the concentration of the second primer pair is 0.5-25. Mu.M, preferably 1-20. Mu.M, more preferably 2-10. Mu.M.

In another preferred embodiment, the allele comprises a structural gene, a regulatory gene, or a combination thereof.

In a fourth aspect, the invention provides a kit for detecting the relative copy number of an allele, comprising:

(i) A first primer pair for amplifying a cDNA to be tested corresponding to an allele, thereby obtaining a first amplification product;

(ii) A second primer pair detectably labeled for amplifying the first amplification product to obtain a second amplification product;

(iii) A restriction enzyme; and

(iv) A construct comprising a reference type allele corresponding to said wild type allele;

wherein said allele is a wild-type allele and said reference allele comprises a base mutation compared to the nucleotide sequence of said wild-type allele;

and the amplification product corresponding to the wild-type allele does not contain a cleavage site corresponding to the restriction enzyme, while the amplification product corresponding to the reference-type allele contains the cleavage site.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 is a schematic diagram of the method;

FIG. 2 shows the limit values of the fluorescence signals of FAM detected in the present method. Panel A is a FAM primer electrophoretogram; b is a linear relationship diagram of 1xFAM primers; FIG. C is a 2xFAM primer linearity diagram; d is a logarithmic value with the base of 2 for the FAM primer concentration and the corresponding fluorescence signal intensity respectively;

FIG. 3 is a schematic diagram of 8 different types of FAM fluorophore-labeled primers in the present method;

FIG. 4 is a schematic representation of a mock allele vector constructed in the present method;

FIG. 5 shows fluorescence signal values of 8 different types of primers detected in the method;

FIG. 6 shows the result of using FP2.2 primer to detect the allele ratio of 14 monoclonal colonies in the present method;

FIG. 7 is a schematic diagram of PMD19-T: PAPPA2 (A) and PMD19-T: PAPPA2 (G) vectors constructed in the present method;

FIG. 8 is a linear range for detecting allelic differential expression in the present method. Panel A shows the results of electrophoresis; b is the linear relationship result; the C picture is a logarithmic statistic result of taking 2 as a base for different ratios of the plasmids PAPA 2- (A) and PAPA 2- (G) and corresponding fluorescence signal intensity values respectively;

FIG. 9 shows the results of genomic DNA detection in the present method;

FIG. 10 shows the result of the PAPA 2-DNA enzyme digestion typing in the present method;

FIG. 11 is an electrophoretic image of the allele tissue expression profile detected in the present method;

FIG. 12 shows the results of enzyme-cutting electrophoresis and FAM fluorescence intensity statistics of the alleles KIT, PLAG1, PAPPA2, IGF1R, CPE and RRM2B detected in the present method, and P2 represents complete enzyme-cutting;

FIG. 13 shows the statistical results of uncut electrophoresis and FAM fluorescence of KIT and PLAG1 genomic DNA detected in the present method, P2 represents complete enzyme digestion;

FIG. 14 shows the sensitivity and accuracy of the relative copy number of genes detected using plasmids in the present method. Panel A is a schematic diagram of a PMD19-T GAPDH (mt) -SRY (mt) vector; b is the result of enzyme digestion electrophoresis; panels C and D are fluorescence intensity and relative copy number results; e is a linear relationship;

FIG. 15 shows the relative copy numbers of the X chromosome AR gene of female and male large white pig individuals tested in this method. A is a schematic diagram of a PMD19-T GAPDH (mt) -AR (mt) vector; b is the result of enzyme digestion electrophoresis; panel C is the fluorescence intensity and relative copy number results.

Detailed Description

The present inventors have, through extensive and intensive studies, for the first time developed a novel method capable of rapidly detecting allele differential expression and gene copy number. The invention amplifies the gene to be detected based on the fluorescent group labeled primer strategy for the first time, quantifies by using the restriction enzyme digestion method, and detects the number M of the detectable labels of the second amplification product LA _LA The number M of detectable labels bound to the second amplification product LG _LG Thereby detecting the differential expression of the alleles and having very high sensitivity and accuracy. On this basis, the present inventors have completed the present invention.

Restriction enzyme

In the present invention, the restriction enzyme is not particularly limited, and the corresponding restriction enzyme can be selected for the target sequence based on the sequence difference of alleles. Alternatively, a restriction enzyme engineered to recognize the target sequence may be selected based on sequence differences between alleles.

Internal reference gene

In the present invention, the reference gene is not particularly limited, and may be a reference gene whose expression is relatively stable or a reference gene whose expression is different (even greatly different). Representative examples include (but are not limited to): GAPDH, actin, etc. A significant advantage of the method of the present invention is that genes with expression differences (even expression differences are large) can be selected as reference genes, and even if the expression differences of the reference genes are large or expression fluctuations exist, the detection results are not substantially interfered.

Method for detecting allelic differential expression

The invention provides a method for detecting allele differential expression, which comprises the following steps:

(a) Providing a sample to be detected, wherein the sample is an allele cDNA sample;

(b) Performing PCR amplification on the allele sequence of the sample to be detected by using the cDNA sample as a template and a first primer pair so as to obtain a first amplification product;

(c) Performing PCR amplification on the first amplification product obtained in step (b) with a second primer pair carrying a detectable label using the first amplification product as a template, thereby obtaining a second amplification product, wherein the second amplification product carries the detectable label;

(d) Digesting the second amplification product obtained in the step (c) under the action of a restriction enzyme, wherein when the second amplification product does not contain a cleavage site of the restriction enzyme, a second amplification product LA which is not digested and has the detectable label is formed; forming a second amplification product LG that is cleaved by an enzyme and carries the detectable label when the second amplification product contains a cleavage site for the restriction enzyme, wherein the length L1 of the second amplification product LA is different from the length L2 of the second amplification product LG; and

(e) Separating the second amplification product LA and the second amplification product LG; and

(f) Determining the amount M of detectable label of the second amplification product LA _LA The number M of detectable labels bound to the second amplification product LG _LG Thereby detecting differential expression of the allele.

Specifically, in a preferred embodiment, the method comprises the steps of:

(1) Detection of FAM fluorescence signal limit

Synthesizing two FAM fluorescence labeling primers, wherein one primer is used as a 5' end FAM fluorescence label and is defined as a 1xFAM primer; the other one is used for carrying out fluorescence labeling on a 5' end and a middle FAM and is defined as a 2xFAM primer; diluting the two primers to a final concentration of 10uM, carrying out sample loading electrophoresis detection according to the amount of 1xFAM (1/320-16) ul x10uM and 2xFAM (1/640-16) x10uM, and reading the gray value of each band for linear analysis. The result shows that the range of the primer corresponding to the limit value of the 1XFAM fluorescence signal is (1/320-16) times; the primer ranges corresponding to the 2xFAM fluorescence signal limit values are (1/640-16) times, the primer ranges have better linear relation, and the maximum fluorescence intensity value is not detected.

(2) Detecting the fluorescent signal intensity of different types of FAM fluorophore-labeled primers

Constructing PMD19-T: GAPDH (wt) -GAPDH (mt) vector, so that GAPDH (wt) and GAPDH (mt) have the same molecular number. Designing and synthesizing different types of FAM fluorescent labeled primers, amplifying PMD19-T (GAPDH (wt) -GAPDH (mt) vectors by PCR, detecting the fluorescence intensity of GAPDH (wt) and GAPDH (mt) by enzyme digestion and electrophoresis, and finally selecting the FAM fluorescent labeled primer with the strongest signal. The result shows that the fluorescence intensity of the primers FP2.1, FP2.2 and FP2.5 is stronger, and the primer FP2.1 with the strongest signal is preferred.

(3) Detection of allele differential expression Linear Range

Vectors PMD19-T: PAPPA2 (a) and PMD19-T: PAPPA2 (G) were constructed, and mixed according to (a) = 32. The result shows that the method can accurately detect that the allele differential expression fold is (A) = 32.

(4) Allele genomic DNA detection

And amplifying the genomic DNA by using FAM fluorescence labeled primers, and detecting the fluorescence intensity ratio of alleles PAPA 2 (A/G) and miR-155 (T/C). The results show that the allele fluorescence intensity ratio of the PAPPA2 and the miR-155 is close to 1, and the expression is non-difference and is consistent with a theoretical value.

Application of the invention to detection of allele differential expression

The method for detecting allele differential expression of the present invention can be applied to the following two aspects:

(1) Verification of allele differential expression

The method comprises the steps of carrying out transcriptome sequencing on tissues such as muscle, fat, spleen, liver, brain and the like of adult pigs (white pigs multiplied by Enshi black pigs) and 95-day embryos (white pigs multiplied by Meishan pigs), screening out some possibly differentially expressed alleles based on RNA-seq data, respectively designing respective FAM fluorescent marker primers, and carrying out PCR amplification, enzyme digestion and electrophoresis to detect the fluorescence intensity ratios of the respective alleles. Finally, the method successfully detects that the expression of alleles KIT, PLAG1, RRM2B, CPE and IGF1R has difference.

(2) Detection of relative copy number of genes

Selecting an X chromosome gene AR as a gene to be detected, taking an autosomal gene GAPDH as an internal reference gene, and detecting the copy number of the AR gene in a large white pig female individual relative to a male individual. Constructing PMD19-T GAPDH (mt) -AR (mt) vector, designing FAM fluorescence labeling primers of genes AR and GAPDH, and detecting fluorescence intensity through PCR amplification, enzyme digestion and electrophoresis. Finally, the copy number of the AR gene on the X chromosome in the female individual is successfully detected to be 2 times of that of the AR gene on the X chromosome in the male individual, and the copy number is consistent with a theoretical value.

Kit for detecting allele differential expression

In the present invention, there is also provided a kit for detecting allelic differential expression, comprising:

(i) A first primer pair for amplifying a cDNA to be tested corresponding to an allele, thereby obtaining a first amplification product;

(ii) A second primer pair detectably labeled for amplifying the first amplification product to obtain a second amplification product; and

(iii) A restriction enzyme;

wherein said alleles comprise wild type (or first subtype) alleles and mutant type (or second subtype) alleles;

and the amplification product corresponding to the wild-type allele contains a cleavage site corresponding to the restriction enzyme, and the amplification product corresponding to the mutant allele does not contain the cleavage site; or the amplification product corresponding to the wild-type allele does not contain a cleavage site corresponding to the restriction enzyme and the amplification product corresponding to the mutant allele contains the cleavage site.

Method for detecting relative copy number of alleles of individual

The present invention also provides a method of detecting the relative copy number of an allele of an individual, the method comprising the steps of:

(a) Providing a test sample, wherein the test sample is a genomic DNA sample and the sample contains an exogenously added reference allele corresponding to the wild-type allele, and the reference allele contains a base mutation compared with the nucleotide sequence of the wild-type allele;

(b) Performing PCR amplification on the allele sequence of the sample to be detected by using the sample as a template and a first primer pair so as to obtain a first amplification product;

(c) Performing PCR amplification on the first amplification product obtained in step (b) with a second primer pair carrying a detectable label using the first amplification product as a template, thereby obtaining a second amplification product, wherein the second amplification product carries the detectable label;

(d) Digesting the second amplification product obtained in the step (c) under the action of a restriction enzyme, wherein when the second amplification product does not contain a cleavage site of the restriction enzyme, a second amplification product LA which is not digested and has the detectable label is formed; forming a second amplification product LG that is cleaved by an enzyme and carries the detectable label when the second amplification product contains a cleavage site for the restriction enzyme, wherein the length L1 of the second amplification product LA is different from the length L2 of the second amplification product LG;

(e) Separating the second amplification product LA and the second amplification product LG; and

(f) Determining the amount M of detectable label of the second amplification product LA _LA The number M of detectable labels bound to the second amplification product LG _LG Thereby detecting the relative copy number of the allele of the individual.

Kit for detecting allele relative copy number

The invention also provides a kit for detecting the relative copy number of the allele, which comprises:

(i) A first primer pair for amplifying a cDNA to be tested corresponding to an allele, thereby obtaining a first amplification product;

(ii) A second primer pair detectably labeled for amplifying the first amplification product to obtain a second amplification product;

(iii) A restriction enzyme; and

(iv) A construct comprising a reference allele corresponding to the wild-type allele;

wherein said allele is a wild-type allele and said reference allele comprises a base mutation compared to the nucleotide sequence of said wild-type allele;

and the amplification product corresponding to the wild-type allele contains a cleavage site corresponding to the restriction enzyme, and the amplification product corresponding to the reference-type allele does not contain the cleavage site; or the amplification product corresponding to the wild-type allele does not contain a cleavage site corresponding to the restriction enzyme, while the amplification product corresponding to the reference-type allele contains the cleavage site.

The main advantages of the invention include:

(1) The invention discloses a novel method for rapidly detecting allele differential expression and relative gene copy number for the first time, the method mainly comprises three steps of PCR, enzyme digestion and electrophoresis, and the operation is very simple.

(2) The fluorescent group used by the novel method provided by the invention is wide in selection, and the plasticity is high by selecting a proper fluorescent group modified primer according to experimental requirements.

(3) The invention discloses a plurality of methods for designing fluorophore-labeled primers with stronger fluorescence signal intensity, which have high practicability.

(4) The invention provides the method that when the primer is marked by FAM fluorescent group, the maximum expression multiple of the detected allele difference is 32 times, and the accuracy is higher.

(5) The FAM fluorescence labeling primer used in the new method provided by the invention has the advantages that the primer amount per tube can meet the requirement of detecting the number of samples of a small population, and the cost is relatively low.

(6) The main experimental technical means of the novel method disclosed by the invention is based on PCR amplification, so that the method has no species limitation, only provides an RNA sample, and can detect any species and any tissue.

(7) The method is used for amplifying the gene to be detected for the first time based on a fluorescent group labeled primer strategy, quantification is carried out by utilizing a restriction enzyme digestion method, and the differential expression of the allele is detected by comparing the fluorescence intensity ratio of the second amplification sequence LA which is not digested and the second amplification sequence LG which is digested.

The invention is further described below with reference to specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specifying the detailed conditions in the following examples, generally followed by conventional conditions such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are by weight.

The materials used in the examples are all commercially available products unless otherwise specified.

Example 1 flow chart for designing a novel method for detecting allelic differential expression

For a more detailed presentation of the principles of the present invention, a simplified flowchart is designed and depicted for reference and understanding. Mainly comprises four steps: firstly, carrying out PCR amplification by using a gene specific primer, wherein the amplification cycle number is set according to the level of gene expression; secondly, labeling a primer by using FAM fluorescent group to amplify the PCR product in the first step, wherein the amplification cycle number is set as 1; thirdly, using corresponding restriction enzyme to enzyme-cut the PCR product of the second step; and fourthly, agarose gel electrophoresis detection and gray value analysis. The flow chart is shown in fig. 1.

Example 2 detection of FAM fluorescence Signal Limit value

In order to examine the sensitivity of the method, the maximum and minimum values of the FAM fluorescence signal intensity are detected and stored between the maximum and minimum valuesIn a better linear relationship. Therefore, two FAM fluorescence-labeled primers were designed and sent to Invitrogen for synthesis. One primer is only subjected to FAM fluorescent labeling at the 5' end and is defined as a 1xFAM primer; the other one is a 2xFAM primer which is used for carrying out fluorescence labeling on a 5' end and a middle FAM, and the primer sequences are respectively 1xFAM _FAM CTCGTCCTTCTTTCCCAGGTGT(SEQ ID NO.:1),2xFAM:A _FAM TCTAGT _FAM ACACTCGTCCTTCTTTCCCAGGTGT (SEQ ID No.: 2); the primers were diluted to a final concentration of 10uM, according to

1x FAM:(1/320，1/160，1/80，1/40，1/20，1/10，1/5，1，2，4，8，16)ul x10uM,

2x FAM (1/640,1/320,1/160,1/80,1/40,1/20,1/10,1/5,1,2,4,8, 16) ul x10uM, the loading buffer 6xloading buffer (Takara, 9156) does not need to add any fluorescent dye, and the electrophoresis buffer 1xTAE needs to be replaced in time and kept clean. The electrophoretic bands were then examined with a fluorescence image scanner (FUJIFILM, FLA-5100) at a voltage of 500v, and finally the grey values of each band were read with image processing software MultiGauge software for linear analysis. The results show that the primer amount range corresponding to the fluorescence signal limit value of 1XFAM is (1/320-16) times, the primer amount range corresponding to the fluorescence signal limit value of 2XFAM is (1/640-16) times, and the primer amount ranges have better linear relation, and the maximum fluorescence signal value is not detected. As shown in fig. 2.

Example 3 detection of fluorescence Signal intensity of different types of FAM fluorophore-labeled primers

1) 8 different types of FAM fluorescently labeled primers were designed and sent to Invitrogen for synthesis. The 8 types of primers were named FP1.1, FP1.2, FP2.1, FP2.2, FP2.3, FP2.4, FP2.5, FP2.6, respectively, as shown in FIG. 3.

a.FP1.1(G _FAM GAGCCTTCCTCTTCACCTGCCGCAGATACACAGC (SEQ ID NO: 3)) which is only marked with 5' FAM fluorescence and the primer sequence is completely complementary and matched with the target gene sequence;

b.FP1.2(A _FAM TCTAGTACGGAGCCTTCCTCTTCACCTGCCGCAGATACACAGC (SEQ ID NO.: 4)): the primer sequence is added with a free sequence at the 5' end in addition to complete complementary match with the target gene,making FAM fluorescent label at 5' end of the free sequence;

c.FP2.1(G _FAM GAGCCT _FAM TCCTCTTCACCTGCCGCAGATACACAGC (SEQ ID NO: 5)): making 5' end and middle FAM fluorescent labels, the bases of the two FAM fluorescent labels are separated by 5 nucleotides, and the primer sequence is completely complementary and paired with the target gene sequence;

d.FP2.2(A _FAM TCTAGT _FAM ACGGAGCCTTCCTCTTCACCTGCCGCAGATACACAGC (SEQ ID NO.: 4)) by adding a free sequence at 5 'end except for complete complementary match with target gene, and making fluorescent labels at 5' end and middle FAM on the free sequence, wherein the bases of two FAM fluorescent labels are separated by 5 nucleotides;

e.FP2.3(G _FAM GAGCCT _FAM GTTCCTCTTCACCTGCCGCAGATACACAGC (SEQ ID No.: 6)) making 5' end and middle FAM fluorescent label, the bases of two FAM fluorescent labels are separated by 5 nucleotides, wherein the middle FAM modified base and the adjacent base are inserted separately and do not complementary match with the target gene sequence, so that the middle FAM modified base forms a bulge shape when the primer anneals, and the rest primer sequences are completely complementary match with the target gene sequence;

f.FP2.4(G _FAM GAGCCTTCCTCT _FAM TCACCTGCCGCAGATACACAGC (SEQ ID NO: 7)): 5' end and middle FAM fluorescent markers are made, the bases of the two FAM fluorescent markers are separated by 11 nucleotides, and the primer sequences are completely complementary and paired with the target gene sequences;

g.FP2.5(A _FAM TCTAGCTACATT _FAM ACGGAGCCTTCCTCTTCACCTGCCGCAGATACACAGC (SEQ ID NO: 8)): except for complete complementary match with target gene, a free sequence is added at 5 'end, 5' end and middle FAM fluorescent labels are made on the free sequence, and the bases of the two FAM fluorescent labels are separated by 11 nucleotides;

h.FP2.6(G _FAM GAGCCTTCCTGT _FAM GCTTCACCTGCCGCAGATACACAGC (SEQ ID NO.: 9)) making 5' end and intermediate FAM fluorescent label, the two FAM fluorescent label bases are separated by 11 nucleotides, the intermediate FAM modified base and two adjacent bases are inserted separately, and do not pair with target gene sequence complementarily, making the intermediate FAM modified base in the target gene sequenceThe primers form a bulge when annealed, and the rest primer sequences are completely complementary and paired with the target gene sequence.

2) The PMD19-T GAPDH (wt) -GAPDH (mt) vectors were constructed so that the alleles were concatenated on the same vector, i.e., with the same copy number, as shown in FIG. 4. And performing PCR amplification, enzyme digestion and electrophoresis by using the different types of FAM fluorescence labeled primers, and finally detecting the fluorescence intensity and the ratio of GAPDH (wt) and GAPDH (mt). The method mainly comprises the following steps:

a. construction of PMD19-T GAPDH (wt) vector. Designing GAPDH gene specific amplification primers, and sending the primers to Wuhan Odoku Dingsheng Biotech limited company for synthesis, wherein the primer sequence is as follows: GAPDH-DNA-2139-F CCACAAGGGTTCGAGGACTG (SEQ ID No.: 10),

GAPDH-DNA-2139-R:TGATGGCGACAATGTCCACT(SEQ ID NO.:11)。

the genomic DNA of the pig is used as a template for PCR amplification. The specific system and reaction conditions are as follows:

the PCR reaction (total volume) was 50. Mu.L:

and (3) PCR reaction conditions:

5min at 95 ℃; (95 ℃ 30s,65 ℃ 30s,72 ℃ 2 min) 35 cycles; 5min at 72 ℃;15 ℃ for 2min.

A2% agarose gel electrophoresis was prepared, and then the objective fragment was purified using a DNA gel recovery kit (Takara, 9762), and finally ligated to a PMD19-T vector in the following system:

then transforming, plating and selecting the monoclonal colony for amplification culture, and finally carrying out PCR and sequencing identification.

b. Construction of PMD19-T GAPDH (wt) -GAPDH (mt) vector GAPDH point mutation primer is designed to introduce an enzyme cutting site KpnI, and the primer sequence is as follows:

GAPDH-Fusion-5’-F:GTGAATTCGAGCTCGCCACAAGGGTTCGAGGAC(SEQ ID NO.:12),

GAPDH-Fusion-5’-R:GGAAAATTTCTAGGTACCCATGACTCAGCTCC(SEQ ID NO.:13),

GAPDH-Fusion-3’-F:ACCTAGAAATTTTCCACAAAATGGCTCCCGGAGC(SEQ ID NO.:14),

GAPDH-Fusion-3’-R:GATCTCTAGAGGATCTGATGGCGACAATGTCCAC(SEQ ID NO.:15)；

PMD19-T: GAPDH (WT) -GAPDH (mt) vector was prepared by In-Fusion cloning (Takara, 638909) by amplifying PMD19-T: GAPDH (WT) with a point mutation primer to prepare a GAPDH (mt) sequence containing an introduced cleavage site KpnI. The specific system and reaction conditions are as follows:

the PCR reaction system (total volume) was 100. Mu.L:

10×LA PCR Buffer II(Mg 2+ Plus)	10ul	10×LA PCR Buffer II(Mg 2+ Plus)	10ul
				dNTP mix (2.5 mM each)	8ul	dNTP mix (2.5 mM each)	8ul
GAPDH-Fusion-5’-F(10μM)	2ul	GAPDH-Fusion-3’-F(10μM)	2ul
				GAPDH-Fusion-5’-R(10μM)	2ul	GAPDH-Fusion-3’-R(10μM)	2ul
LATaq enzyme (5U/. Mu.L)	1ul	LATaq enzyme (5U/. Mu.L)	1ul
				PMD19-T GAPDH (wt) plasmid	10ng	PMD19-T GAPDH (wt) plasmid	10ng
Supplementing water to 100ul		Adding water to 100ul

And (3) PCR reaction conditions:

5min at 95 ℃; (95 ℃ 30s,60 ℃ 30s,72 ℃ 1 min) 35 cycles; 5min at 72 ℃;15 ℃ for 2min.

A2% agarose gel electrophoresis was prepared, and then the objective fragment was purified using a DNA gel recovery kit (Takara, 9762). Cloning by In-Fusion to linearized PMD19-T: GAPDH (wt). The system is as follows:

after reacting for 15min at 50 ℃, all the 10ul products are used for transformation, plate coating and monoclonal colony amplification culture, and finally PCR identification is carried out.

3) The signal intensity of different FAM fluorescence labeled primers and the ratio of the fluorescence intensity of GAPDH (wt) to GAPDH (mt) were measured. The PMD19-T GAPDH (wt) -GAPDH (mt) plasmids were amplified using 8 different types of FAM fluorescence-labeled primers synthesized above, and then subjected to enzyme digestion and electrophoresis to detect the fluorescence intensities of GAPDH (wt) and GAPDH (mt). The method comprises the following steps:

a. design and Synthesis of non-Fluorescently labeled primers for amplification of PMD19-T GAPDH (wt) -GAPDH (mt) vector

GAPDH-plasmid-t-769-F:tGGAGCCTTCCTCTTCACCTG(SEQ ID NO.:16),

GAPDH-plasmid-769-R:GCCTTTAGGGTGGGGTCAAC(SEQ ID NO.:17),

GAPDH-plasmid-732-R:GGAAGCAGCTTCAAGGAGCACTG(SEQ ID NO.:18)，

The first PCR amplification step was performed. The specific system and reaction conditions are as follows:

the PCR reaction (total volume) was 50. Mu.L (8 replicates):

and (3) PCR reaction conditions:

5min at 95 ℃; (95 ℃ 30s,60 ℃ 30s,72 ℃ 40 s) 35 cycles; 5min at 72 ℃;15 ℃ for 2min.

b. 8 different FAM fluorescent labeled primers are used for carrying out the second-step PCR amplification, and the template is a mixture of 8 repeated PCR amplification products in the first step. The specific system and reaction conditions are as follows:

the PCR reaction system (total volume) was 50 μ L (protected from light):

2xPremix Taq 50ul

2ul of 8 different FAM modified primers (10. Mu.M)

First step PCR amplification product 23ul

And (3) PCR reaction conditions:

5min at 95 ℃; (95 ℃ 30s,60 ℃ 30s,72 ℃ 40 s) 1 cycle; 5min at 72 ℃;15 ℃ for 2min.

c. And performing enzyme digestion on the PCR amplification product of the second step. The system is as follows:

the enzyme digestion system (total volume) was 30ul:

preparing 2% common agarose gel, replacing fresh 1xTAE electrophoresis buffer, adding 7ul of 6xloading buffer without nucleic acid dye into each enzyme digestion system, the total volume is 37ul, and carrying out electrophoresis on all samples. The electrophoretic bands were detected with a fluorescence image scanning analyzer (FUJIFILM, FLA-5100), the voltage was set to 500v, and the gray value of each band was read with image processing software MultiGauge for linear analysis. The results show that the fluorescence signal intensity of primers FP2.1, FP2.2 and FP2.5 is relatively strong, and the fluorescence intensity ratio of GAPDH (wt) and GAPDH (mt) is nearly 1, which is consistent with the theoretical value. Finally, the primer FP2.2 is selected for subsequent experiments. As shown in fig. 5.

Then, the downstream specific amplification primer GAPDH-plasmid-769-R is replaced by GAPDH-plasmid-732-R, FAM fluorescence labeling primer is not changed, the above experimental steps are repeated, and the same experimental result is obtained, namely FP2.1, FP2.2 and FP2.5 are relatively strong in fluorescence signal intensity, and the ratio of GAPDH (wt) to GAPDH (mt) gray values is nearly 1. As shown in fig. 5.

4) The PMD19-T SRY (wt) -SRY (mt) vector was constructed similarly to the PMD19-T GAPDH (wt) -GAPDH (mt) vector using gene-specific amplification primers SRY-DNA-1610-F CTATAACATCCGCCGCCTGG (SEQ ID No.: 19), SRY-DNA-1610-R CATGCTCCCCAGCACTACA (SEQ ID No.: 20). The point mutation primer is

SRY-Fusion-5’-F:GTGAATTCGAGCTCGCTATAACATCCGCCGCCT(SEQ ID NO.:21),

SRY-Fusion-5’-R:TTCCACTTGGATCCCAGCCACTTGCTGATCTCTG(SEQ ID NO.:22)；

SRY-Fusion-3’-F:GGGATCCAAGTGGAAAATGCTTACAGAAGCCGAA(SEQ ID NO.:23),

SRY-Fusion-3’-R:GATCTCTAGAGGATCCATGCTCCCCAGCACTAC(SEQ ID NO.:24)，

The non-fluorescence labeled primer for amplifying PMD19-T SRY (wt) -SRY (mt) carrier is

SRY-plasmid-t-691-F:AGCAGAGCCTTCAGCAACTC(SEQ ID NO.:25)

SRY-plasmid-691-R: CTTGCGACGAGGTCGGTATT (SEQ ID NO: 26), the introduced cleavage site is BamHI. Alleles were also simulated in vitro to have the same copy number, in a manner consistent with the construction of the PMD19-T GAPDH (wt) -GAPDH (mt) vector. The two alleles GAPDH (wt)/(mt) and SRY (wt)/(mt) were picked up for 7 monoclonal colonies, amplified, plasmid (Takara, 9760) was extracted, and FAM fluorescence-labeled primer GAPDH-FP2.2-F: A _FAM TCTAGT _FAM ACGGAGCCTTCCTCTTCACCTGCCGCAGATACACAGC (SEQ ID NO.: 4) and SRY-FP2.2-F: A _FAM TCT _FAM AGTACAGCAGAGCCTTCAGCAACTCGGATTA(SEQ ID NO.:27)

GACCTAG is respectively subjected to PCR amplification, and the ratio of the allele fluorescence intensity is detected. The results show that the allele fluorescence intensity ratio of 14 amplified monoclonal colonies is nearly 1 and is consistent with the theoretical value. As shown in fig. 6.

Example 4 detection of allele differential expression Linear Range

To examine the maximum fold differential expression of the alleles detectable by the present invention, we ligated the alleles PAPPA2 (a) and PAPPA2 (G) to the PMD19-T vector, respectively, as shown in fig. 7. The plasmids were extracted and mixed according to (a) =32, 1, 8. The method comprises the following specific steps:

1) Non-fluorescence labeling primers for amplifying the PAPA 2 gene are designed and synthesized, and the sequences are PAPA 2-cDNA-t-654-F: tGACAGAACAGCCCAGCCATC (SEQ ID NO.: 28) and PAPA 2-cDNA-654-R: CCCGTTGTACTGGGAGATCA (SEQ ID NO.: 29).

PCR amplification is carried out by taking pig cDNA as a template, and then gel cutting, purification, connection and transformation are carried out to finally obtain plasmids of PMD19-T: PAPPA2 (A) and PMD19-T: PAPPA2 (G).

2) Synthesis of FAM fluorescent-labeled primers

The sequence of the FAM fluorescence labeling primer is PAPPA2-FP2.2-F _FAM TCTAGT _FAM ACGACAGAACAGCCCAGCCATCATTGCAGGTGTGTT (SEQ ID No.: 30). The plasmids PMD19-T: PAPPA2 (a) and PMD19-T: PAPPA2 (G) were diluted to a concentration of 1ng/ul, mixed according to (a) =1, 8. The result shows that the maximum fold of allele differential expression which can be accurately detected by the invention is 32 folds, and the (A) and (G) have better linear relation in the range of (32 ² =0.9961. As shown in fig. 8.

Example 5 allele genomic DNA detection

In order to examine whether the ratio of the fluorescence intensities of the alleles was theoretical 1 or not when the genomic DNA of the allele was detected in the present invention. Alleles PAPPA2 and miR-155 were selected for validation. The method comprises the following specific steps:

1) Designing and synthesizing a non-fluorescence labeled primer, wherein the sequence of the primer is

PAPPA2-DNA-t-622-F:tACTCGTCCTTCTTTCCCAGG(SEQ ID NO.:31),PAPPA2-DNA-622-R:CCACATTGTCACAAGCCGTT(SEQ ID NO.:32)；Mir-155-DNA-t-478-F:tGGTCTCCCCTCTGCGTTTTA(SEQ ID NO.:33),

Mir-155-DNA-478-R:ATGTAGGAGTCAGACGGAGGT(SEQ ID NO.:34)。

And respectively amplifying genome DNA of the F1 colony of the hybridization offspring of the large and white enrofled pigs, and carrying out enzyme digestion to detect heterozygote individuals.

2) The heterozygote individuals detected as above were amplified using FAM fluorescence-labeled primers in the same manner as in example 3. The sequences are respectively PAPPA2-FP2.2-F: A _FAM TCTAGT _FAM ACACTCGTCCTTCTTTCCCA(SEQ ID NO.:35)

GGTGT；Mir-FP-F:A _FAM TCTAGT _FAM ACGGTCTCCCCTCTGCGTTTTAGCATTTGG (SEQ ID NO: 36). The results show that the allele gray value ratio of both PAPPA2 and miR-155 is close to 1, i.e. when the allele genomic DNA is amplified, it appears to be not different and is consistent with the theoretical value. As shown in fig. 9.

3) In order to further confirm the reliability of the result in the step 2), the PAPPA2 heterozygous individual cDNA is re-amplified for PCR, the same step as the FAM fluorescent-labeled primer amplification PCR step, and the FAM fluorescent-labeled primer is replaced by the non-fluorescent-labeled primer in the second step of PCR. Then purifying and recovering, connecting PMD19-T, transforming, coating a plate, finally selecting 96 monoclonal colonies for amplification culture, then carrying out PCR detection and enzyme digestion typing, and counting the number of allele clones. Statistics show that 39 clones exist in the AA genotype, 37 clones exist in the GG genotype, and the genotypes of the rest clones cannot be determined, wherein AA: GG =1.05. As shown in fig. 10.

4) Similar results were obtained by replacing the PAPA 2-DNA-622-R with PAPA 2-DNA-629-R, and repeating steps 2) and 3) under otherwise unchanged conditions, which were the primers for specific amplification of the PAPA 2 gene. As shown in fig. 10.

Example 6 verification of allele differential expression

Transcriptome sequencing is carried out on muscle tissues and fat tissues of adult pigs (En Shi Hei pig x white pig), some alleles which can be differentially expressed are screened out based on RNA-seq data, such as PLAG1, KIT, RRM2B, CPE and IGF1R, PAPPA, and respective FAM fluorescence labeling primers are respectively designed, and the fluorescence intensity ratio of the respective alleles is detected. The gene non-fluorescence labeling primer, the restriction endonuclease and the annealing temperature are as follows:

PLAG1(HpyCH4V):60℃

PLAG1-466-2F:AGCGCATTCTTCCGTGTCTC(SEQ ID NO.:37)

PLAG1-466-t-2R:tAAGGAAGCTGAACACCGACT(SEQ ID NO.:38)

KIT(TaiI):58℃

KIT-396-t-F:tGGAGAAAGCAGAGGCCATGA(SEQ ID NO.:39)

KIT-396-R:ACAGCCACAACAGGTACAGC(SEQ ID NO.:40)

RRM2B(AflII):60℃

RRM2B-794-F:TCCTAGTTCGAGGTGGCTTG(SEQ ID NO.:58)

RRM2B-794-t-R:tCCAGGTACTGAAACATGAGGCA(SEQ ID NO.:59)

CPE(NlaIII):60℃

CPE-207-F:CTGCCGCAAGAACGACGAT(SEQ ID NO.:60)

CPE-207-t-R:tCTGCCTCATTTTAATGGATGAGC(SEQ ID NO.:61)

IGF1R(AluI):60℃

IGF1R-189-F:GCCTGGCATTCTACTGCATGGGCTGAAGCCCTGGACACAGTAAGC(SEQ ID NO.:62)

IGF1R-189-t-R:tTGAGAAGAGGAGTTTGATGCTGAGA(SEQ ID NO.:63)

PAPPA2(MscI):60℃

PAPPA2-227-F:CTTCGTGAGCCCCCTTTTGCCAGTGGCTGGCC(SEQ ID NO.:64)

PAPPA2-227-t-R:tCCATCATCACACTCTTCTCCAAGGC(SEQ ID NO.:65)

the fluorescence labeling primer is as follows:

PLAG1-FP2.2-R:A _FAM TCTAGT _FAM ACAAGGAAGCTGAACACCGACTCTGTAAGACT(SEQ ID NO.:41)

KIT-FP2.2-F:A _FAM TCTAGT _FAM ACGGAGAAAGCAGAGGCCATGAATACAGG(SEQ ID NO.:42)

IGF1R-FP2.2-R:A _FAM TCTAGT _FAM ACTGAGAAGAGGAGTTTGATGCTGAGAGGACATCCAGG(SEQ ID NO.:66)

PAPPA2-FP2.2-R:A _FAM TCTAGT _FAM ACCCATCATCACACTCTTCTCCAAGGCTCCTTGCAACC(SEQ ID NO.:67)

RRM2B-FP2.2-R:A _FAM TCTAGT _FAM ACCCAGGTACTGAAACATGAGGCAAGCAAAGTCACAG(SEQ ID NO.:68)

CPE-FP2.2-F:A _FAM TCTAGT _FAM ACCTGCCTCATTTTAATGGATGAGCTATAGGTTCAGAC(SEQ ID NO.:69)

the specific process is as follows:

1) And (4) extracting RNA. The Trizol lysis method is used for extracting the RNA of the tissues of adult pigs (Enshi black pig x large white pig), including 10 tissues of heart, liver, spleen, lung, kidney, muscle, fat, brain, hypothalamus and pituitary. The extraction method is described in TransZolUp (TransGen, ET 111).

2) And (5) reverse transcription. The RNA extracted above was purified according to PrimeScript ^TM RT reagent Kit with gDNA Eraser (Takara, RR 047A) Kit for reverse transcription, and GAPDH primers were used to detect cDNA quality.

3) Organizing expression spectrum, enzyme cutting and typing. The gene non-fluorescence labeling primer and the restriction endonuclease are used for carrying out tissue expression profile verification and enzyme digestion typing. The results are shown in FIG. 11.

4) FAM fluorescence labeled primers detect allele differential expression. The specific procedure was in accordance with example 3. The detection result shows that KIT, PLAG1, RRM2B, IGF R, CPE and PAPPA2 alleles have differential expression phenomena. This is consistent with the RNA-seq results, indicating that the present invention has some accuracy. As shown in fig. 12.

5) Amplifying the genome DNA, and detecting whether the ratio of the fluorescence intensity of KIT and the fluorescence intensity of the PLAG1 allele is 1.

6) Designing and synthesizing a non-fluorescence labeled primer with the sequence:

KIT-DNA-746-F:TCGTCGACCCTCCCTTGTAT(SEQ ID NO.:43)

KIT-DNA-746-t-R:tTGCTGCGTGAATAACGAGGT；(SEQ ID NO.:44)

PLAG1-DNA-466-2F:AGCGCATTCTTCCGTGTCTC(SEQ ID NO.:37)

PLAG1-DNA-466-t-2R:tAAGGAAGCTGAACACCGACT；(SEQ ID NO.:38)

and (3) carrying out PCR amplification and enzyme digestion typing by taking DNA as a template, and selecting heterozygous individuals. Then using FAM fluorescence to label the primer

KIT-DNA-FP2.2-R:A _FAM TCTAGT _FAM ACTGCTGCGTGAATAACGAGGTTCACTGTCAGCTGGT；(SEQ ID NO.:45)

PLAG1-FP2.2-R:A _FAM TCTAGT _FAM ACAAGGAAGCTGAACACCGACTCTGTAAGACT (SEQ ID NO: 46) amplified the enzyme-cleaved heterozygote individuals, and the specific steps were the same as in example 3. The results show that the ratio of the two alleles is close to 1, so that the phenomenon of allelic differential expression of KIT and PLAG1 detected by the method is not caused by genomic DNA variation. As shown in fig. 13.

Example 7 Gene relative copy number detection

In order to verify whether the method is suitable for detecting the relative copy number of the gene, the X chromosome gene AR is selected as the gene to be detected, the autosomal gene GAPDH is selected as the reference gene, and the relative copy number of the female individual and the male individual of the large white pig is detected.

1) Sensitivity and accuracy of detecting relative copy number of gene by plasmid verification

PMD19-T: GAPDH (mt) -SRY (mt), PMD19-T: GAPDH (wt) and PMD19-T: SRY (wt) vectors were prepared, and in order to simulate alleles in vitro to detect relative copy numbers, the three vectors were mixed in different ratios to form an equal ratio system.

a. And (5) constructing a vector. Wherein the PMD19-T: GAPDH (wt) and PMD19-T: SRY (wt) vector constructions are shown in example 3.

Only the PMD19-T GAPDH (mt) -SRY (mt) vector needs to be constructed. The PMD19-T: SRY (mt) vector was double-digested with restriction enzymes KpnI (Takara, 1618) and BamHI (Takara, 1605) as follows:

and (3) carrying out water bath at 37 ℃ for 3h, and carrying out electrophoresis gel cutting to purify a target band.

With primer GAPDH (mt) -KpnI-F: ATGGGTACCGGAGCCTTCCTCTTCACCT, (SEQ ID NO: 47)

GAPDH(mt)-BamHI-R:ATGGGATCCTGATGGCGACAATGTCCACT，(SEQ ID NO.:48)

Amplifying PMD19-T GAPDH (mt) plasmid to obtain a GAPDH (mt) fragment. After purification and recovery, the double digestion is carried out by using restriction enzymes KpnI and BamHI, and the system is as follows:

water bath is carried out for 3h at 37 ℃, and the target band is recovered by electrophoresis and gel cutting. Finally, connecting the two purified and recovered enzyme digestion fragments, wherein the system is as follows:

connecting for 2h at 16 ℃, transforming, coating a plate, selecting clone, PCR verifying, sequencing and determining to finally obtain a PMD19-T: GAPDH (mt) -SRY (mt) vector. As shown in fig. 14.

b. PMD19-T GAPDH (mt) -SRY (mt) carrier (G (mt) -S (mt) for short), PMD19-T GAPDH (wt)

Both the support (abbreviated G (wt)) and PMD19-T SRY (wt) support (abbreviated S (wt)) were diluted to 1ng/ul and mixed in two ways, one being G (wt): S (mt) =1, 2; and the other is G (wt): S (wt) = G (mt) =2:1 (1,2,4,8,16), 4:1 (1,2,4,8,16), 8:1 (1,2,4,8,16), 16. The above mixed system was amplified with the primers GAPDH-plasmid-t-769-F/769-R and SRY-plasmid-t-691-F/691-R of example 3, respectively, to perform the first PCR amplification, then the first PCR product was amplified with the FAM fluorescence labeling primers GAPDH-FP2.2-F and SRY-FP2.2-F of example 3, respectively, to obtain FAM fluorescence labeling products, then each allele was cut with restriction enzymes KpnI and BamHI, respectively, to detect the fluorescence intensity ratio by electrophoresis, and finally the system with the allele ratio close to 1 was selected for the calculation of the relative copy number. As shown in fig. 15. The results show that G (wt): S (wt) is 1,2,4,8,16, 32 (G/S, 2G/S,4G/S,8G/S,16G/S, 32G/S), and the corresponding values are 1.19,2.22,5.50, 11.06, 23.01, 46.10, respectively. After the numerical values are standardized, the logarithm taking the base 2 as the base is respectively taken for linear analysis, the analysis result presents a better linear relation, and R ² =0.9989 as shown in fig. 14. The invention can accurately detect the relative copy number of the gene and has higher sensitivity and accuracy.

2) The relative copy number of the X chromosome AR gene of the female individual and the male individual of the large white pig is detected, and the autosomal GAPDH gene is used as an internal reference.

a. Constructing a PMD19-T AR (mt) -GAPDH (mt) vector. The PMD19-T GAPDH (mt) vector was double-digested with restriction enzymes EcoRI and BamHI as follows:

water bath is carried out for 3h at 37 ℃, and the target band is recovered by electrophoresis and gel cutting. Amplifying the genome DNA of the large white pig by using primers AR-2247-F AGCAGGTATGTGTGTGTGGAG (SEQ ID NO.: 49) and AR-2247-R TGCACGATCAGTTTGGGCTA (SEQ ID NO.: 50) to obtain an AR gene fragment, cloning the AR gene fragment on a PMD19-T vector to obtain a PMD19-T: AR (wt) vector, wherein the length of an insert fragment is 2247bp. An AR point mutation primer was designed to introduce the restriction site MluI (Takra, 1619), and the primer sequence was:

AR-Fusion-5’-F:AAAACGACGGCCAGTGAATTAGCAGGTATGTGTGTGTGGAGG(SEQ ID NO.:51)

AR-Fusion-5’-R:TAGACAGTGCCAACGCGTAATGAGCTCACC(SEQ ID NO.:52)

AR-Fusion-3’-F:TTACGCGTTGGCACTGTCTATTATAGTTCACAGAT(SEQ ID NO.:53)

AR-Fusion-3’-F:TTGTGGATCTCTAGAGGATCCCATTCTCTGCCCAATCTTGC(SEQ ID NO.:54)

the PMD19-T: GAPDH (mt) -AR (mt) vector was prepared by In-Fusion cloning (Takara, 638909) by amplifying the PMD19-T: AR (wt) using an AR point mutation primer to prepare an AR (mt) sequence containing an introduced enzyme cleavage site MluI. The specific system and reaction conditions were the same as in example 3.

b. Selecting 4 male and female individuals of the big white pig respectively, extracting genome DNA, measuring the concentration, and diluting the DNA concentration of each individual to be about 50 ng/ul. The concentration of the PMD19-T: AR (mt) -GAPDH (mt) plasmid is diluted to 1ng/ul, and then gradually diluted to (10) ^-2 ,10 ^-3 ,10 ^-4 ) x1ng/ul, and respectively and uniformly mixing with the DNA of the female individual (50 ng/ul) in equal volume to serve as a PCR amplification template. The primers used in the first PCR amplification step were non-fluorescently labeled primers GAPDH-plasmid-t-769-F/769-R (see example 3) and AR-562-t-F: GCCATGAGATCCTGCTGTG (SEQ ID NO: 55),

AR-562-R:CGATCCCTGATCCC(SEQ ID NO.:56)

TATTGC; the second PCR primer is GAPDH-FP2.2-F and AR-FP2.2-F _FAM TCTAGT _FAM ACGCCATGAGATCCTGCTGTGTAGCACTGAG (SEQ ID NO: 57). The specific operation process is consistent with the foregoing. The detection result shows that the copy numbers of the AR genes in female individuals relative to male individuals are 1.86,2.10,1.80,2.02 respectively, and the four groups of numerical values are very close to a theoretical value of 2, so that the method can successfully detect the relative copy numbers among the genes of the individuals. As shown in fig. 15Shown in the figure.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> university of agriculture in Huazhong

<120> a method for detecting allele differential expression

<130> P2017-1403

<160> 69

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 1

actcgtcctt ctttcccagg tgt 23

<210> 2

<211> 32

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 2

atctagtaca ctcgtccttc tttcccaggt gt 32

<210> 3

<211> 35

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 3

ggagccttcc tcttcacctg ccgcagatac acagc 35

<210> 4

<211> 44

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 4

atctagtacg gagccttcct cttcacctgc cgcagataca cagc 44

<210> 5

<211> 35

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 5

ggagccttcc tcttcacctg ccgcagatac acagc 35

<210> 6

<211> 37

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 6

ggagcctgtt cctcttcacc tgccgcagat acacagc 37

<210> 7

<211> 35

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 7

ggagccttcc tcttcacctg ccgcagatac acagc 35

<210> 8

<211> 50

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 8

atctagctac attacggagc cttcctcttc acctgccgca gatacacagc 50

<210> 9

<211> 38

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 9

ggagccttcc tgtgcttcac ctgccgcaga tacacagc 38

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 10

ccacaagggt tcgaggactg 20

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 11

tgatggcgac aatgtccact 20

<210> 12

<211> 33

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 12

gtgaattcga gctcgccaca agggttcgag gac 33

<210> 13

<211> 32

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 13

ggaaaatttc taggtaccca tgactcagct cc 32

<210> 14

<211> 34

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 14

acctagaaat tttccacaaa atggctcccg gagc 34

<210> 15

<211> 34

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 15

gatctctaga ggatctgatg gcgacaatgt ccac 34

<210> 16

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 16

tggagccttc ctcttcacct g 21

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 17

gcctttaggg tggggtcaac 20

<210> 18

<211> 23

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 18

ggaagcagct tcaaggagca ctg 23

<210> 19

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 19

ctataacatc cgccgcctgg 20

<210> 20

<211> 19

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 20

catgctcccc agcactaca 19

<210> 21

<211> 33

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 21

gtgaattcga gctcgctata acatccgccg cct 33

<210> 22

<211> 34

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 22

ttccacttgg atcccagcca cttgctgatc tctg 34

<210> 23

<211> 34

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 23

gggatccaag tggaaaatgc ttacagaagc cgaa 34

<210> 24

<211> 33

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 24

gatctctaga ggatccatgc tccccagcac tac 33

<210> 25

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 25

agcagagcct tcagcaactc 20

<210> 26

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 26

cttgcgacga ggtcggtatt 20

<210> 27

<211> 35

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 27

atctagtaca gcagagcctt cagcaactcg gatta 35

<210> 28

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 28

tgacagaaca gcccagccat c 21

<210> 29

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 29

cccgttgtac tgggagatca 20

<210> 30

<211> 43

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 30

atctagtacg acagaacagc ccagccatca ttgcaggtgt gtt 43

<210> 31

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 31

tactcgtcct tctttcccag g 21

<210> 32

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 32

ccacattgtc acaagccgtt 20

<210> 33

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 33

tggtctcccc tctgcgtttt a 21

<210> 34

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 34

atgtaggagt cagacggagg t 21

<210> 35

<211> 27

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 35

atctagtaca ctcgtccttc tttccca 27

<210> 36

<211> 37

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 36

atctagtacg gtctcccctc tgcgttttag catttgg 37

<210> 37

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 37

agcgcattct tccgtgtctc 20

<210> 38

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 38

taaggaagct gaacaccgac t 21

<210> 39

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 39

tggagaaagc agaggccatg a 21

<210> 40

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 40

acagccacaa caggtacagc 20

<210> 41

<211> 39

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 41

atctagtaca aggaagctga acaccgactc tgtaagact 39

<210> 42

<211> 36

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 42

atctagtacg gagaaagcag aggccatgaa tacagg 36

<210> 43

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 43

tcgtcgaccc tcccttgtat 20

<210> 44

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 44

ttgctgcgtg aataacgagg t 21

<210> 45

<211> 44

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 45

atctagtact gctgcgtgaa taacgaggtt cactgtcagc tggt 44

<210> 46

<211> 39

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 46

atctagtaca aggaagctga acaccgactc tgtaagact 39

<210> 47

<211> 28

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 47

atgggtaccg gagccttcct cttcacct 28

<210> 48

<211> 29

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 48

atgggatcct gatggcgaca atgtccact 29

<210> 49

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 49

agcaggtatg tgtgtgtgga g 21

<210> 50

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 50

tgcacgatca gtttgggcta 20

<210> 51

<211> 42

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 51

aaaacgacgg ccagtgaatt agcaggtatg tgtgtgtgga gg 42

<210> 52

<211> 30

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 52

tagacagtgc caacgcgtaa tgagctcacc 30

<210> 53

<211> 35

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 53

ttacgcgttg gcactgtcta ttatagttca cagat 35

<210> 54

<211> 41

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 54

ttgtggatct ctagaggatc ccattctctg cccaatcttg c 41

<210> 55

<211> 19

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 55

gccatgagat cctgctgtg 19

<210> 56

<211> 14

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 56

cgatccctga tccc 14

<210> 57

<211> 38

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 57

atctagtacg ccatgagatc ctgctgtgta gcactgag 38

<210> 58

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 58

tcctagttcg aggtggcttg 20

<210> 59

<211> 23

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 59

tccaggtact gaaacatgag gca 23

<210> 60

<211> 19

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 60

ctgccgcaag aacgacgat 19

<210> 61

<211> 24

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 61

tctgcctcat tttaatggat gagc 24

<210> 62

<211> 45

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 62

gcctggcatt ctactgcatg ggctgaagcc ctggacacag taagc 45

<210> 63

<211> 26

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 63

ttgagaagag gagtttgatg ctgaga 26

<210> 64

<211> 32

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 64

cttcgtgagc ccccttttgc cagtggctgg cc 32

<210> 65

<211> 26

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 65

tccatcatca cactcttctc caaggc 26

<210> 66

<211> 45

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 66

atctagtact gagaagagga gtttgatgct gagaggacat ccagg 45

<210> 67

<211> 45

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 67

atctagtacc catcatcaca ctcttctcca aggctccttg caacc 45

<210> 68

<211> 44

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 68

atctagtacc caggtactga aacatgaggc aagcaaagtc acag 44

<210> 69

<211> 45

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 69

atctagtacc tgcctcattt taatggatga gctataggtt cagac 45

Claims (11)

1. A non-diagnostic method for detecting differential expression of an allele, comprising the steps of:

(a) Providing a sample to be detected, wherein the sample is an allele cDNA sample;

(b) Performing PCR amplification on the allele sequence of the sample to be detected by using the cDNA sample as a template and a first primer pair so as to obtain a first amplification product;

(c) Performing PCR amplification on the first amplification product obtained in step (b) with a second primer pair carrying a detectable label using the first amplification product as a template, thereby obtaining a second amplification product, wherein the second amplification product carries the detectable label;

(d) Digesting the second amplification product obtained in the step (c) under the action of a restriction enzyme, wherein when the second amplification product does not contain a digestion site of the restriction enzyme, a second amplification product LA which is not digested and carries the detectable label is formed; forming a second amplification product LG that is cleaved by an enzyme and that carries the detectable label when the second amplification product contains an enzyme cleavage site for the restriction enzyme, wherein the length L1 of the second amplification product LA is different from the length L2 of the second amplification product LG;

(e) Separating the second amplification product LA and the second amplification product LG; and

(f) Determining the amount M of detectable label of the second amplification product LA _LA The number M of detectable labels bound to the second amplification product LG _LG Thereby detecting differential expression of the alleles;

the alleles include wild type (or first subtype) alleles and mutant type (or second subtype) alleles,

in the method, two-step PCR reaction is needed for quantification, and a first-step PCR amplification primer is a first primer pair; the second PCR amplification primer is a second primer pair, the upstream primer and/or the downstream primer of the second primer pair is/are provided with more than 2 fluorescent markers, when one primer contains more than 2 fluorescent markers, the distance difference between any fluorescent markers is 2-40bp, and the ratio of the detected expression difference between the allele in the sample to be detected is 32:1 to 1:32.

2. the method of claim 1, wherein the detectable label is selected from the group consisting of: a fluorophore, a chemiluminescent group, a chromophore, or a combination thereof.

3. The method of claim 1, wherein in step (f), the fluorescence intensity of the second amplification product LA and the second amplification product LG are measured and compared to determine the differential expression of the alleles.

4. The method of claim 1, wherein the concentration of the first primer pair is 0.5-25 μ Μ.

5. The method of claim 1, wherein the concentration of the second primer pair is 0.5-25 μ Μ.

6. The method of claim 1, wherein in step (e), when the fluorescence intensity Y of LA is high _La Fluorescence intensity Y with LG _LG When there is a significant difference, it indicates that there is significant differential expression of the allele.

7. The method of claim 1, wherein the ratio of the detected differences in expression between alleles in the test sample is 16:1 to 1:16.

8. the method of claim 1, wherein the sample to be tested is from an animal, plant, bacterium, virus, or any species.

9. The method of claim 1, wherein the allele comprises a structural gene, a regulatory gene, or a combination thereof.

10. The method of claim 1, wherein the allele comprises a protein-coding gene, a miRNA gene, or a combination thereof.

11. The method of claim 1, wherein the allele is selected from the group consisting of:KIT、PLAG1、RRM2B、 CPE、IGF1R、PAPPA2、or a combination thereof.

Images