CN109486906A - MicroRNA non-enzymatic amplification detection method intracellular based on the affine nanometer transport vehicle of electrostatic and cell imaging - Google Patents
MicroRNA non-enzymatic amplification detection method intracellular based on the affine nanometer transport vehicle of electrostatic and cell imaging Download PDFInfo
- Publication number
- CN109486906A CN109486906A CN201811368048.2A CN201811368048A CN109486906A CN 109486906 A CN109486906 A CN 109486906A CN 201811368048 A CN201811368048 A CN 201811368048A CN 109486906 A CN109486906 A CN 109486906A
- Authority
- CN
- China
- Prior art keywords
- enzymatic amplification
- microrna
- solution
- cell
- added
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The present invention discloses a kind of microRNA non-enzymatic amplification detection method intracellular based on the affine nanometer transport vehicle of electrostatic and cell imaging.The present invention uses non-enzymatic amplification system, for DNA hair fastener probe H1, H2 sequence of detection target microRNA sequence design specific band fluorescence labels;H1, H2 and nanogold particle are assembled into complex, it is transported to tumour cell, when in amplification system contain microRNA to be measured, it can be in conjunction with H1, H1 stem is caused to open, resulting part single-stranded structure and H2 phase separation cause H2 stem to open, thus fluorophor FAM and quenching group BHQ-1 distance increases, and fluorescence intensity increases.With sepectrophotofluorometer fluorescence intensity, and imaging contexts intracellular are recorded with laser scanning co-focusing microscope.This method principle is simple and testing cost is low;Have many advantages, such as constant temperature without enzymatic amplification, high sensitivity, it is easy to operate, be easy to universal.
Description
Technical field
It is the invention belongs to nucleic acid detection technique field, in particular to a kind of based on the intracellular of the affine nanometer transport vehicle of electrostatic
MicroRNA non-enzymatic amplification detection method and its application in cell imaging.
Background technique
MicroRNA (miRNA) be highly conserved, length be 18-25nt, by non-coding endogenous gene codes
Small single stranded RNA.So far, functional mechanism of the miRNA in gene expression regulation is greatly paid close attention to, studies have shown that
MiRNA participates in numerous important cellular activities, including early development, virus defense, allelotaxis and formation, cell Proliferation and withers
It dies.In addition, their expression is directly related with kinds cancer, it can reflect the expression feelings of oncogene or tumor suppressor gene
Condition.Therefore, miRNA can be used as the valuable biomarker of cellular level research and related disease, wherein thin to illustrate
Sophisticated functions during born of the same parents and the research of miRNA biological function is had become to the announcement of miRNA information natural in living cells
Hot topic.Therefore, the innovative strategy for visualizing natural miRNA in living cells can significantly affect grinding for miRNA biology
Study carefully.
However, due to the low expression level of miRNA and internal complex environment in cell, the original of miRNA in living cells
Position monitoring and tracer are still faced with huge challenge.As first generation living cells imaging technique, fluorescence in situ hybridization (FISH) is surveyed
Determine method monitoring cell, the nucleic acid in tissue and animal pattern has become common method in cell biology, and be applied to
The imaging of mRNA.Although based on the technology of FISH in extensive research field being effective, the single fluorescence radiation of probe
Body is not able to satisfy the requirement of low concentration target.So far, some improved internal hybridization skills based on probe have been developed
Art, these technologies have opened up the new strategy in cell imaging field.Particularly, the method based on molecular beacon (MB) constructs high letter
It makes an uproar than strategy, has been applied to mRNA analysis and molecule sensing.The introducing of MB realizes specific DNA or RNA by loop-stem structure
Monitoring and tracking, realize high efficiency and high s/n ratio.But sensitivity is still limited by single fluorescent illuminant.
Therefore, inventor enters fluorescence quantum yield, probe steady and the transfer efficiency of cell by raising nucleic acid to improve
These limitations.By the reaction condition of optimization, nucleic acid probe can significantly improve fluorescence quantum yield, and it is strong to obtain higher fluorescence
Degree.Inventor's patent early period (Chinese patent: 201410768156.4) discloses a kind of exponential non-enzymatic amplification of target triggering
Platform, it is interacted by the circulation of two hairpin probes and is realized, fluorescence signal is amplified and can be shown using this strategy
It writes and improves sensitivity.Therefore, inventor has the idea being imaged into the cell for being applied to miRNA in living cells.Importantly,
Two hairpin probes are delivered to an important factor for efficiency in living cells is also during cell imaging.Before this, with nanometer
The development of technology and universal, nanogold particle (AuNPs) is increasingly concerned as carrier for drug, gene delivery, and
Substantially increase transfer efficiency.Therefore, we construct the AuNPs carrier of charge carrier to carry out the non-enzymatic amplification of target triggering
Intracellular transport, signal amplification is realized by the self assembly of DNA probe, and can be applied to living cells imaging.
Summary of the invention
In order to overcome the disadvantages and deficiencies of the prior art, the purpose of the present invention is to provide one kind to be based on the affine nanometer of electrostatic
The microRNA non-enzymatic amplification detection method intracellular of transport vehicle and cell imaging, and it is applied to living cells imaging.The party
Method is to enhance non-enzymatic amplification platform by fluorescence signal and combine nanometer transport vehicle for cell microRNA trace inspection intracellular
It surveys.This method high sensitivity, specificity are good, accurate, quick, easy to operate, and entire amplification procedure does not need the participation of enzyme.Cause
This, the present invention provides a kind of completely new on the basis of reducing testing cost for microRNA detection technique system
MicroRNA detection method.
Amplification procedure of the invention is made of basic principle of the invention non-enzymatic amplification reaction as shown in Figure 1:, and " signal is given
Step uses fluorescence signal mode out ".Firstly, for the DNA hair fastener probe of detection target microRNA sequence design specificity
H1, H2 sequence, wherein mark fluorescent group FAM, the 3 ' end labels of quenching group BHQ-1, H2 are glimmering respectively at the 5 ' ends and 3 ' ends of H1
Light group FAM, the 8th base T marks quenching group BHQ-1 from 5 ' ends;When microRNA to be measured is not present in amplification system,
Amplified reaction will not be activated, and cannot react between hair fastener probe, and therefore, it is still hair fastener knot that hair fastener probe, which will not be opened,
Structure, fluorophor FAM and quenching group BHQ-1 interact, and fluorescence is in cancellation state;It is to be measured when containing in amplification system
MicroRNA, microRNA to be measured can cause H1 stem to open, the resulting single-stranded knot in part in conjunction with hair fastener probe H1
Structure and H2 phase separation cause hair fastener probe H2 stem to open, and form H1+H2 double-strand composite construction with H1, thus fluorophor
FAM and quenching group BHQ-1 distance increases, and fluorescence intensity increases.Furthermore hair fastener probe H1, H2 and nanogold particle are assembled
It at complex, and is transported to intracellular, because tumour cell height expresses microRNA, therefore triggers non-enzymatic amplification, hair fastener probe H1,
H2 is opened, and fluorescence intensity increases.Extracellular non-enzymatic amplification fluorescence intensity finally is detected with sepectrophotofluorometer, and uses laser scanning
Laser Scanning Confocal Microscope records cell imaging contexts intracellular.
The purpose of the invention is achieved by the following technical solution: one kind based on the affine nanometer transport vehicle of electrostatic and cell at
The microRNA non-enzymatic amplification detection method intracellular of picture, comprising the following steps:
(1) synthesis of nanogold particle (AuNPs)
The synthesis of nanogold particle (AuNPs) the following steps are included:
A, nanogold particle synthetic system has PBS buffer solution, poly-L-Lysine PLL solution, chlorauric acid solution, finally plus
Enter nuclease-free water to mend volume to volume needed for system, sufficiently oscillation mixes, and whole process is protected from light;
B, by step a acquired solution brief centrifugation, fall within the solution of pipe lid adhesion in pipe, whole process is protected from light;
C, step b acquired solution is put in constant temperature blending instrument, constant temperature is protected from light incubation;
D, become red from yellow to step c solution, indicate the formation of nanogold particle, be put into 4 DEG C of refrigerators and save;
(2) it is used for the design of non-enzymatic amplification system hair fastener probe
According to hair fastener probe H1 needed for non-enzymatic amplification principle and microRNA sequence design non-enzymatic amplification system to be measured and
Hair fastener probe H2 sequence: hair fastener probe H1 use double end labelling strategies, 5 ' end and 3 ' end respectively mark fluorescent group FAM, quench
Go out group BHQ-1;3 ' end mark fluorescent group the FAM of H2, the 8th base T marks quenching group BHQ-1 from 5 ' ends;Hair fastener
Probe H1, H2 TE buffer solution, final concentration are 100 μM, are stored in -20 DEG C of refrigerators;
(3) hair fastener probe pre-processes
In order to make hair fastener probe H1, H2 be sufficiently formed hairpin structure, phosphoric acid is separately added into hair fastener probe H1, H2 solution
Salt buffer PBS, and set 1 for PBS final concentration ×;Then, it is heated to after 95 DEG C, is denaturalized it sufficiently;Finally, gradient
Cooling, until being down to room temperature, respectively obtains the pretreatment product of hair fastener probe H1, H2, product is stored in 4 DEG C or -20 DEG C of environment
In it is spare;After H1, H2 form sufficient hairpin structure, fluorophor FAM and quenching group BHQ-1 interact, fluorescent quenching;
(4) building of extracellular non-enzymatic amplification detection architecture
The pretreatment product of hair fastener probe H1, H2 obtained in a certain amount of step (3) are taken, and PBS buffer is added, then
RNase inhibitor is added, finally plus volume needed for DEPC water to detection architecture, mixes well;
(5) verifying and its sensitivity, specific detection of extracellular non-enzymatic amplification detection architecture
The microRNA to be measured of various concentration is added in step (4) non-enzymatic amplification detection architecture respectively, warm bath uses fluorescence
Spectrophotometer detects the fluorescence intensity of acquired solution, and determines the sensitivity of non-enzymatic amplification system;
Control group is set, the to be measured of same concentrations is then added in step (4) non-enzymatic amplification detection architecture respectively
MicroRNA, and microRNA210, the microRNA214 similar with its base sequence, warm bath use sepectrophotofluorometer
The fluorescence intensity of acquired solution is detected, and determines the specificity of non-enzymatic amplification system;
(6) building of non-enzymatic amplification nanogold particle delivery system
It is resulting to be added to step (1) for the pretreatment product for taking hair fastener probe H1, H2 obtained in a certain amount of step (3)
In AuNPs solution, after mixing well, warm bath;
(7) transhipment of tumour cell non-enzymatic amplification nanogold complex
A certain amount of step (6) acquired solution is taken, is added in tumour cell, is then put into 37 DEG C of carbon dioxide incubators
It is incubated for, at least 1 hour;
(8) dyeing of nucleus and skeleton
Product after being incubated in step (7) is taken out from carbon dioxide incubator, then carries out nucleus and skeleton
Dyeing, then carry out micro- sem observation, or be put into 4 DEG C of refrigerators and be kept in dark place;
(9) detection of cell fluorescence intensity and imaging intracellular
By gained final product in step (8), cell imaging contexts intracellular are observed with laser scanning co-focusing microscope, and
Record data.
Further, the detailed step of the nanogold particle synthesis is as follows:
A, 30mgPLL is taken to be dissolved in 3mL water, sufficiently oscillation, which mixes 5min, dissolves it all, and being configured to concentration is 10mg/
The PLL solution of mL is put into -20 DEG C of low temperature refrigerators and saves;
B, taking 10uL original content is the chlorauric acid solution of 1.52mol/L, is added in 142uL water, mixes well, be protected from light preparation
The chlorauric acid solution for being 0.1mol/L at concentration, is put into 4 DEG C of refrigerators and is kept in dark place;
C, take 20 × PBS50uL, while taking step a acquired solution 60uL, step b acquired solution 10uL, be added 880uL without
Nuclease water is mended to 1mL, and sufficiently oscillation mixes, and whole process is protected from light;
D, by step c acquired solution brief centrifugation, fall within the solution of pipe lid adhesion in pipe, whole process is protected from light;
E, step d acquired solution is put in constant temperature blending instrument, 300rpm, 66 DEG C constant-temperature incubation 3 hours, whole process is protected from light;
F, become red from yellow to step e solution, indicate the formation of nanogold particle, be put into 4 DEG C of refrigerators and save.
Further, hair fastener probe H1, H2 are dissolved separately in 1 × phosphate buffer PBS in the step (3),
Final concentration is 500nM.
Further, in step (3) gradient cooling since 95 DEG C, keep 5min again with the rate of 5 DEG C/min after
1min is cooled to next temperature spot, so circulation is gone down, until 25 DEG C of room temperature.
Further, it is all 50nM that detection architecture, which is 100 μ L, H1, H2 pretreatment product final concentrations, in the step (4),
PBS buffer solution final concentration of 1 ×, the final concentration of 1U/ μ L of RNase inhibitor.
Further, after the microRNA to be measured of various concentration is added in the step (5), 37 DEG C warm bath 1 hour, it
Afterwards with the fluorescence intensity of sepectrophotofluorometer detection acquired solution, the sensitivity of non-enzymatic amplification system is determined;
Be added same concentrations microRNA, microRNA210, microRNA214 to be measured after, 37 DEG C warm bath 1 hour, it
Afterwards with the fluorescence intensity of sepectrophotofluorometer detection acquired solution, the specificity of non-enzymatic amplification system is determined;
The sepectrophotofluorometer is Hitachi F-7000 sepectrophotofluorometer.
Further, it in the step (6), takes hair fastener probe H1, H2 to pre-process object, it is resulting to be added to step (1)
In AuNPs solution, hair fastener probe H1, H2 pre-process object final concentration be all 500nM, after mixing well, 37 DEG C warm bath 2 hours.
Further, nucleus is comprised the concrete steps that with what skeleton dyed in the step (8):
A, the culture solution of cell is discarded;
B, 1 × PBS is added, shakes gently, then discards PBS, repeats this step 1 time;
C, appropriate 4% paraformaldehyde is added, just all covers bottom cell, room temperature, which is protected from light, fixes 10 minutes;
D, 4% paraformaldehyde for discarding step c is cleaned cell twice, every time 5 minutes with 1 × PBS;
E, it takes the 20uMTRITCPhalloidin rhodamine of 5uL that phalloidine dye liquor is marked to be dissolved in 1mL1 × PBS, fills
Divide and mixes;
F, dye liquor obtained by step e is added in cell obtained by step d, room temperature is protected from light dyeing 30 minutes;
G, the dye liquor for discarding step f is cleaned cell twice, every time 5 minutes with 1 × PBS;
H, it takes the DAPI dye liquor (5mg/mL) of 1uL to be dissolved in 1mL1 × PBS, mixes well;
I, dye liquor obtained by step h is added in cell obtained by step g, room temperature is protected from light dyeing 5 minutes;
J, the dye liquor for discarding step i is cleaned cell twice, every time 5 minutes with 1 × PBS;
K, appropriate Fluoromount-G is takenTMWater-soluble mountant is added in cell obtained by step j, is protected from light at room temperature quiet
It sets 5 minutes, so that mountant carries out micro- sem observation after drying again, or is put into 4 DEG C of refrigerators and is kept in dark place.
Further, the microRNA to be measured is microRNA21, sequence are as follows:
UAGCUUAUCAGACUGAUGUUGA;
The sequence of the microRNA210 are as follows: CUGUGCGUGUGACAGCGGCUGA;
The sequence of microRNA214 are as follows: ACAGCAGGCACAGACAGGCAGU;
The sequence of the hair fastener probe H1 are as follows:
TCAACATCAGTCTGATAAGCTACCATGTGTAGATAGCTTATCAGACT CCTAATGGTGTGGC;
Its 5 ' end and 3 ' end difference mark fluorescent group FAM, quenching group BHQ-1;
The sequence of the hair fastener probe H2 are as follows:
ATAAGCTATCTACACATGGTAGCTTATCAGACTCCATGTGTAGA;
Its 3 ' end mark fluorescent group FAM, the 8th base T marks quenching group BHQ-1 from 5 ' ends.
In the present invention, related DNA product is synthesized by Hua Da Gene Tech. Company Limited.37 DEG C of isoperibols can
It is maintained by PCR instrument, water-bath or constant temperature blending instrument.
Poly-L-Lysine (PLL) described in step (1) refers to that poly-L-Lysine hydrobromate, molal weight are
15-30kDa is provided by SIGMA-ALDRICH company;
Gold chloride described in step (1) is provided by Sheng Gong bioengineering Co., Ltd, concentration 1.52mol/L;
Phosphate buffer PBS described in step (1) by Sheng Gong bioengineering Co., Ltd provide, concentration be 20 ×;
The buffer is handled by DEPC;
Nuclease-free water described in step (1) is provided by Invitrogen (Shanghai) Trading Co., Ltd.;
The DEPC water is 0.1% (v/v) DEPC water by autoclave sterilization;DEPC is pyrophosphoric acid diethylester;
RNase inhibitor described in step (4) is provided by precious bioengineering Co., Ltd;
Paraformaldehyde described in step (8) is provided by Shanghai Yi Sheng Biotechnology Co., Ltd;
TRITC Phalloidin rhodamine described in step (8) marks phalloidine dye liquor by the holy biological section of Shanghai assist
Skill Co., Ltd provides;
DAPI dye liquor described in step (8) is provided by Shanghai Yi Sheng Biotechnology Co., Ltd;
Fluoromount-G described in step (8)TMWater-soluble mountant is mentioned by Shanghai Yi Sheng Biotechnology Co., Ltd
For;
Laser scanning co-focusing microscope described in step (9) is preferably Zeiss laser scanning co-focusing microscope
LSM780。
The present invention has the following advantages and effects with respect to the prior art:
(1) present invention uses non-enzymatic amplification reaction system: overall process does not need the participation of enzyme, and principle is simple and testing cost
It is low.
(2) constant-temperature amplification: carrying out under constant temperature conditions, only needs 37 DEG C of reaction 1h that can obtain ideal experimental result.Instead
It answers device simple, also may be used with water-bath heating.
(3) highly sensitive: the sensitivity of extracellular non-enzymatic amplification experiment has had reached 100fmol.Realize microRNA trace
Measure the purpose of detection.
(4) non-enzymatic amplification is applied to nanogold particle carrier transport hair fastener probe by born of the same parents by electrostatic affinity interaction
It is interior.
(5) it realizes miRNA detection intracellular, and is applied to cell imaging intracellular, other diversification applications can also be carried out.
(6) easy to operate, be easy to universal.
(7) it is suitable for detection of nucleic acids, Protein Detection: the experimental principle can also be used for binding protein aptamers the relevant technologies
It can be used for the detection of DNA and RNA, as long as rationally designing hair fastener probe sequence according to target sequence.
Detailed description of the invention
Fig. 1 is the schematic diagram of the microRNA non-enzymatic amplification detection method intracellular based on the affine nanometer transport vehicle of electrostatic;
Fig. 2 is nanogold particle (AuNPs) in conjunction with the phenogram before and after hairpin probe;
Fig. 3 is the result figure of extracellular non-enzymatic amplification detection platform sensitivity;
Fig. 4 is the result figure of extracellular non-enzymatic amplification detection platform specificity;
Fig. 5 is the result figure of human tumor cells imaging intracellular;
Fig. 6 is the result figure of human normal cell line imaging intracellular.
Specific embodiment
Present invention will now be described in further detail with reference to the embodiments and the accompanying drawings, but embodiments of the present invention are unlimited
In this.
The synthesis of 1 nanogold particle of embodiment (AuNPs)
When synthesizing AuNPs, it is used as end-capping reagent, reducing agent, PLL reduction using positively charged poly-L-Lysine (PLL)
Gold salt ion (AuCl4 -1) amino, metal ion induction amine is oxidized to nitrite, direct oxidation reduction reaction occurs, spontaneous
AuNPs is formed, PLL is encapsulated in the surface AuNPs, the formation of stable nanoparticles.The stabilisation of gained AuNPs is to pass through electrification
The combination of the space of polypeptide and electrostatic interaction guarantees.30mgPLL is taken to be dissolved in 3mL water first, sufficiently oscillation mixes
5min dissolves it all, is configured to the PLL solution that concentration is 10mg/mL;Taking 10uL original content is the gold chloride of 1.52mol/L
Solution is added in 142uL water, mixes well, and is protected from light the chlorauric acid solution for being configured to that concentration is 0.1mol/L;It is eventually adding seedless
Sour enzyme water mends volume to 1mL, and sufficiently oscillation mixes, and whole process is protected from light;Constitute 1mL system, wherein PBS buffer solution final concentration 1 ×,
The system solution brief centrifugation is made pipe by poly-L-Lysine (PLL) final concentration 0.6mg/mL, chlorauric acid solution final concentration 0.1M
The sticky solution of lid is fallen in pipe, and whole process is protected from light;In constant temperature blending instrument 300rpm, 66 DEG C Incubation in dark 3 hours;Solution is by Huang
Discoloration is red, indicates the formation of nanogold particle, can be put into 4 DEG C of refrigerators and save.
The foundation and its sensitivity of microRNA non-enzymatic amplification platform of the embodiment 2 based on the affine nanometer transport vehicle of electrostatic
Experiment
According to based on the affine nanometer transport vehicle of electrostatic microRNA non-enzymatic amplification platform principle, be directed to
Hair fastener probe H1, H2 needed for microRNA21 sequence design non-enzymatic amplification system, sequence are as shown in table 1.Hair fastener probe H1
Using double end labelling strategies, 5 ' ends and 3 ' end difference mark fluorescent group FAM, quenching group BHQ-1;3 ' end the labels of H2 are glimmering
Light group FAM, the 8th base T marks BHQ-1 from 5 ' ends.Hair fastener probe is synthesized by Hua Da Gene Tech. Company Limited,
H1, H2 can (100 μM of final concentration, be stored in -20 refrigerators) with TE buffer solution.
Used sequence in 1 embodiment of table
In order to make hair fastener probe H1, H2 be sufficiently formed hairpin structure, phosphoric acid is separately added into hair fastener probe H1, H2 solution
Salt buffer PBS, and set 1 for PBS final concentration ×, it is then heated to after 95 DEG C, is denaturalized it sufficiently, then gradient drops
Temperature keeps 5min to be cooled to next temperature spot after 1min with the rate of 5 DEG C/min again since 95 DEG C, so under circulation
It goes, until 25 DEG C of room temperature, specific temperature spot and soaking time are respectively 95 DEG C of 5min, 90 DEG C of 5min, 85 DEG C of 5min, 80 DEG C
5min、75℃5min、 70℃5min、65℃5min、60℃5min、55℃5min、50℃5min、45℃5min、40℃
5min,35℃5min,30℃5min,25℃5min.The pretreatment product of hair fastener probe H1, H2 is respectively obtained, product is stored in 4
DEG C or -20 DEG C of environment in it is spare.After H1, H2 form sufficient hairpin structure, fluorophor FAM and quenching group BHQ-1 are mutual
Effect, fluorescent quenching.
Entire extracellular non-enzymatic amplification detection amplification system is set as 100 μ L, takes the pretreatment product of hair fastener probe H1, H2,
4 μ L20 × PBS are added, RNase inhibitor is added, microRNA21 to be measured is added, finally plus DEPC processing water is mended to 100 μ L.
It mixes well.Make PBS final concentration of 0.8 ×, the pretreatment of RNase inhibitor final concentration of 1U/ μ L, hair fastener probe H1, H2 produces
Object final concentration is 50nM, after 37 DEG C incubate 1 hour, amplified production be put into sepectrophotofluorometer Hitachi F-7000 detect it is glimmering
Optical signal.
In order to verify the sensitivity of non-enzymatic amplification fluorescence detection platform, the amount that microRNA21 addition is respectively set is
100pmol, 10pmol, 1pmol, 100fmol, 10fmol, 1fmol, 100amol, 10amol, 0mol detect fluorescence signal,
Experimental result is as shown in Figure 3.From the figure 3, it may be seen that the sensitivity of the detection platform can reach 100fmol.By linear analysis, the party
Case has obtained preferable linear (R2=0.9771).
The specificity verification of intracellular microRNA non-enzymatic amplification platform of the embodiment 3 based on the affine nanometer transport vehicle of electrostatic
For the specificity for verifying the microRNA non-enzymatic amplification platform intracellular based on the affine nanometer transport vehicle of electrostatic, difference
The base sequence microRNA210 and microRNA214 similar with microRNA21, the amount difference of addition is added to the platform
Be 10pmol, and detect fluorescence signal, experimental result as shown in figure 4, Control group is blank control, microRNA210,
Fluorescence intensity level of the microRNA214 and Control control group at launch wavelength 518nm be respectively 801.775a.u.,
788.7a.u., 739.5a.u., this three groups of fluorescence intensities remain basically stable;And microRNA21 experimental group is in launch wavelength 518nm
The fluorescence intensity level at place is 3763a.u., has obtained stronger fluorescence signal.Therefore, platform specificity is preferable.
4 human tumor cells of embodiment and normal cell imaging intracellular
In order to verify the feasibility that the platform is applied to cell detection, we devise cell imaging experiment intracellular.At this
In experiment, we have chosen three kinds of tumor cell lines: liver cancer cell lines (HepG2 cell line), lung cancer cell line (A549 cell
System), breast cancer cell line (MDA-MB-231 cell line), microRNA21 has been demonstrated there is height in these three cell lines
The phenomenon that expression;And have chosen three kinds of human normal cell line systems: in people's gastric mucosal cell system (GES-1 cell line), human umbilical vein
Chrotoplast system (HUVEC cell line), people immortalize epidermal cell system (HacaT cell line).
In the present solution, referring to above-mentioned experimental method, we take first a certain amount of hair fastener probe H1 by gradient cooling,
The pretreatment product of H2 is added in the AuNPs solution of synthesis, and after mixing well, hair fastener probe H1, H2 pretreatment product are whole
Concentration is all 500nM, 37 DEG C warm bath 2 hours, be assembled into AuNPs and hair fastener probe H1, H2 by electrostatic affinity interaction compound
Object;Then this compound is added in three kinds of tumour cells and three kinds of normal cells, is then put into 37 DEG C of carbon dioxide cultures
It is incubated in case, at least 1 hour.
The product after incubation is taken out from carbon dioxide incubator finally, carries out the dyeing of nucleus and skeleton, it is first
The culture solution of cell is first discarded, 1 × PBS is added and cleans twice;Then appropriate 4% paraformaldehyde is added, just all covers bottom
Portion's cell, room temperature, which is protected from light, fixes 10 minutes;4% paraformaldehyde is discarded, is cleaned cell twice, every time 5 points with 1 × PBS
Clock;Take the TRITC Phalloidin rhodamine of final concentration of 100nM that phalloidine dye liquor is marked to be added to thin after fixing
In born of the same parents, room temperature is protected from light dyeing 30 minutes;Dye liquor is discarded, is cleaned cell twice, every time 5 minutes with 1 × PBS;It takes final concentration of
The DAPI dye liquor room temperature of 5ug/mL is protected from light dyeing 5 minutes;DAPI dye liquor is discarded, is cleaned cell twice, every time 5 points with 1 × PBS
Clock;Finally take appropriate Fluoromount-GTMWater-soluble mountant is added in the cell after dyeing, is protected from light standing 5 at room temperature
Minute, so that mountant carries out micro- sem observation after drying again, or it is put into 4 DEG C of refrigerators and is kept in dark place.
Cell imaging contexts intracellular are observed with laser scanning co-focusing microscope LSM780, detect non-enzymatic amplification fluorescence intracellular
Signal.As shown in figure 5, in HepG2 cell line, A549 cell line, MDA-MB-231 cell line FAM green florescent signal with
TRITC Phalloidin rhodamine marks phalloidine red fluorescent, DAPI blue-fluorescence signal common location, illustrates this
All there is the highly expressed phenomenon of microRNA21 in three kinds of cell lines, and nanogold particle is successfully loaded with hair fastener probe H1, H2
At complex, this complex can enter cytoplasm across phospholipid bilayer, and be able to enter nucleus.It is normal as three kinds of people
The experimental conditions of cell, as shown in fig. 6, there is no hair fastener probe luminous signals.
The HepG2 cell line, A549 cell line, MDA-MB-231 cell line, which are purchased from the Shanghai Chinese, which wins biotechnology, has
Limit company.
The GES-1 cell line, HUVEC cell line, HacaT cell line open up the limited public affairs of morning biotechnology purchased from Guangzhou
Department.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention,
It should be equivalent substitute mode, be included within the scope of the present invention.
Sequence table
<110>attached 5th hospital, Zhongshan University
<120>the microRNA non-enzymatic amplification detection method intracellular based on the affine nanometer transport vehicle of electrostatic and cell imaging
<130> 2018
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> RNA
<213>artificial sequence (Artificial Sequence)
<400> 1
uagcuuauca gacugauguu ga 22
<210> 2
<211> 22
<212> RNA
<213>artificial sequence (Artificial sequence)
<400> 2
cugugcgugu gacagcggcu ga 22
<210> 3
<211> 22
<212> RNA
<213>artificial sequence (Artificial sequence)
<400> 3
acagcaggca cagacaggca gu 22
<210> 4
<211> 61
<212> DNA
<213>artificial sequence (Artificial sequence)
<220>
<221>fluorophor FAM is modified
<222>((1)) .. (.(1))
<220>
<221>quenching group BHQ-1 is modified
<222>((25)) .. (.(25))
<400> 4
tcaacatcag tctgataagc taccatgtgt agatagctta tcagactcct aatggtgtgg 60
c 61
<210> 5
<211> 44
<212> DNA
<213>artificial sequence (Artificial sequence)
<220>
<221>fluorophor FAM is modified
<222>((44)) .. (.(44))
<400> 5
ataagctatc tacacatggt agcttatcag actccatgtg taga 44
Claims (10)
1. a kind of microRNA non-enzymatic amplification detection method intracellular based on the affine nanometer transport vehicle of electrostatic and cell imaging,
Be characterized in that the following steps are included:
(1) synthesis of nanogold particle (AuNPs)
The synthesis of nanogold particle (AuNPs) the following steps are included:
A, nanogold particle synthetic system has PBS buffer solution, poly-L-Lysine PLL solution, chlorauric acid solution, is eventually adding nothing
Nuclease water mends volume to volume needed for system, and sufficiently oscillation mixes, and whole process is protected from light;
B, by step a acquired solution brief centrifugation, fall within the solution of pipe lid adhesion in pipe, whole process is protected from light;
C, step b acquired solution is put in constant temperature blending instrument, constant temperature is protected from light incubation;
D, become red from yellow to step c solution, indicate the formation of nanogold particle, be put into 4 DEG C of refrigerators and save;
(2) it is used for the design of non-enzymatic amplification system hair fastener probe
According to hair fastener probe H1 and hair fastener needed for non-enzymatic amplification principle and microRNA sequence design non-enzymatic amplification system to be measured
Probe H2 sequence: hair fastener probe H1 use double end labelling strategies, 5 ' end and 3 ' end respectively mark fluorescent group FAM, base is quenched
Group BHQ-1;3 ' end mark fluorescent group the FAM of H2, the 8th bases adenine T marks quenching group BHQ-1 from 5 ' ends;Hair
Card probe H1, H2 TE buffer solution, final concentration are 100 μM, are stored in -20 DEG C of refrigerators;
(3) hair fastener probe pre-processes
In order to make hair fastener probe H1, H2 be sufficiently formed hairpin structure, it is slow that phosphate is separately added into hair fastener probe H1, H2 solution
Fliud flushing PBS, and set 1 for PBS final concentration ×;Then, it is heated to after 95 DEG C, is denaturalized it sufficiently;Finally, gradient drops
Temperature until being down to room temperature, respectively obtains the pretreatment product of hair fastener probe H1, H2, and product is stored in 4 DEG C or -20 DEG C of environment
It is spare;After H1, H2 form sufficient hairpin structure, fluorophor FAM and quenching group BHQ-1 interact, fluorescent quenching;
(4) building of extracellular non-enzymatic amplification detection architecture
The pretreatment product of hair fastener probe H1, H2 obtained in a certain amount of step (3) are taken, and PBS buffer solution is added, is added
RNase inhibitor finally plus volume needed for DEPC water to detection architecture mixes well;
(5) verifying and its sensitivity, specific detection of extracellular non-enzymatic amplification detection architecture
The microRNA to be measured of various concentration is added in step (4) non-enzymatic amplification detection architecture respectively, warm bath uses fluorescence spectrophotometer
Photometer detects the fluorescence intensity of acquired solution, and determines the sensitivity of non-enzymatic amplification system;
Control group is set, the to be measured of same concentrations is then added in step (4) non-enzymatic amplification detection architecture respectively
MicroRNA and microRNA210, the microRNA214 similar with microRNA base sequence to be measured, warm bath, with fluorescence point
Light photometer detects the fluorescence intensity of acquired solution, and determines the specificity of non-enzymatic amplification system;
(6) building of non-enzymatic amplification nanogold particle delivery system
The pretreatment product for taking hair fastener probe H1, H2 obtained in a certain amount of step (3) is added to step (1) resulting AuNPs
In solution, after mixing well, warm bath;
(7) transhipment of tumour cell non-enzymatic amplification nanogold complex
A certain amount of step (6) acquired solution is taken, is added in tumour cell, is then put into 37 DEG C of carbon dioxide incubators and incubates
It educates, at least 1 hour;
(8) dyeing of nucleus and skeleton
Product after being incubated in step (7) is taken out from carbon dioxide incubator, then carries out the dye of nucleus and skeleton
Color, then micro- sem observation is carried out, or be put into 4 DEG C of refrigerators and be kept in dark place;
(9) detection of cell fluorescence intensity and imaging intracellular
By gained final product in step (8), cell imaging contexts intracellular are observed with laser scanning co-focusing microscope, and record
Data.
2. a kind of microRNA intracellular based on the affine nanometer transport vehicle of electrostatic and cell imaging according to claim 1
Non-enzymatic amplification detection method, it is characterised in that:
The detailed step of the nanogold particle synthesis is as follows:
A, 30mg PLL is taken to be dissolved in 3mL water, sufficiently oscillation, which mixes 5min, dissolves it all, and being configured to concentration is 10mg/mL
PLL solution, be put into -20 DEG C of low temperature refrigerators and save;
B, take 10uL original content be 1.52mol/L chlorauric acid solution, be added 142uL water in, mix well, be protected from light be configured to it is dense
Degree is the chlorauric acid solution of 0.1mol/L, is put into 4 DEG C of refrigerators and is kept in dark place;
C, 20 × PBS 50uL is taken, while taking step a acquired solution 60uL, it is seedless that 880uL is added in step b acquired solution 10uL
Sour enzyme water is mended to 1mL, and sufficiently oscillation mixes, and whole process is protected from light;
D, by step c acquired solution brief centrifugation, fall within the solution of pipe lid adhesion in pipe, whole process is protected from light;
E, step d acquired solution is put in constant temperature blending instrument, 300rpm, 66 DEG C constant-temperature incubation 3 hours, whole process is protected from light;
F, become red from yellow to step e solution, indicate the formation of nanogold particle, be put into 4 DEG C of refrigerators and save.
3. a kind of microRNA intracellular based on the affine nanometer transport vehicle of electrostatic and cell imaging according to claim 1
Non-enzymatic amplification detection method, it is characterised in that:
Hair fastener probe H1, H2 are dissolved separately in 1 × phosphate buffer PBS in the step (3), final concentration is
500nM。
4. a kind of microRNA intracellular based on the affine nanometer transport vehicle of electrostatic and cell imaging according to claim 1
Non-enzymatic amplification detection method, it is characterised in that:
Gradient cooling described in step (3) keeps 5min to be cooled to again with the rate of 5 DEG C/min after 1min since 95 DEG C
Next temperature spot, so circulation is gone down, until 25 DEG C of room temperature.
5. a kind of microRNA intracellular based on the affine nanometer transport vehicle of electrostatic and cell imaging according to claim 1
Non-enzymatic amplification detection method, it is characterised in that:
It is all 50nM that detection architecture, which is 100 μ L, H1, H2 pretreatment product final concentrations, in the step (4), and PBS buffer solution is dense eventually
Degree for 1 ×, the final concentration of 1U/ μ L of RNase inhibitor.
6. a kind of microRNA intracellular based on the affine nanometer transport vehicle of electrostatic and cell imaging according to claim 1
Non-enzymatic amplification detection method, it is characterised in that:
After the microRNA to be measured of various concentration is added in the step (5), 37 DEG C warm bath 1 hour, later with fluorescence spectrophotometer light
The fluorescence intensity of degree meter detection acquired solution, determines the sensitivity of non-enzymatic amplification system;
Be added same concentrations microRNA, microRNA210, microRNA214 to be measured after, 37 DEG C warm bath 1 hour, Zhi Houyong
Sepectrophotofluorometer detects the fluorescence intensity of acquired solution, determines the specificity of non-enzymatic amplification system;
The sepectrophotofluorometer is Hitachi F-7000 sepectrophotofluorometer.
7. a kind of microRNA intracellular based on the affine nanometer transport vehicle of electrostatic and cell imaging according to claim 1
Non-enzymatic amplification detection method, it is characterised in that:
In the step (6), takes hair fastener probe H1, H2 to pre-process object, be added in the resulting AuNPs solution of step (1), hair fastener
Probe H1, H2 pre-process object final concentration be all 500nM, after mixing well, 37 DEG C warm bath 2 hours.
8. a kind of microRNA intracellular based on the affine nanometer transport vehicle of electrostatic and cell imaging according to claim 1
Non-enzymatic amplification detection method, it is characterised in that:
Nucleus is comprised the concrete steps that with what skeleton dyed in the step (8):
A, the culture solution of cell is discarded;
B, 1 × PBS is added, shakes gently, then discards PBS, repeats this step 1 time;
C, appropriate 4% paraformaldehyde is added, just all covers bottom cell, room temperature, which is protected from light, fixes 10 minutes;
D, 4% paraformaldehyde for discarding step c is cleaned cell twice, every time 5 minutes with 1 × PBS;
E, take the 20uM TRITC Phalloidin rhodamine of 5uL that phalloidine dye liquor is marked to be dissolved in 1 × PBS of 1mL, sufficiently
It mixes;
F, dye liquor obtained by step e is added in cell obtained by step d, room temperature is protected from light dyeing 30 minutes;
G, the dye liquor for discarding step f is cleaned cell twice, every time 5 minutes with 1 × PBS;
H, it takes the 5mg/mLDAPI dye liquor of 1uL to be dissolved in 1 × PBS of 1mL, mixes well;
I, dye liquor obtained by step h is added in cell obtained by step g, room temperature is protected from light dyeing 5 minutes;
J, the dye liquor for discarding step i is cleaned cell twice, every time 5 minutes with 1 × PBS;
K, appropriate Fluoromount-G is takenTMWater-soluble mountant is added in cell obtained by step j, is protected from light 5 points of standing at room temperature
Clock so that mountant carries out micro- sem observation after drying again, or is put into 4 DEG C of refrigerators and is kept in dark place.
9. a kind of microRNA intracellular based on the affine nanometer transport vehicle of electrostatic and cell imaging according to claim 1
Non-enzymatic amplification detection method, it is characterised in that:
The microRNA to be measured is microRNA21, sequence UAGCUUAUCAGACUGAUGUUGA;
The sequence of the microRNA210 are as follows: CUGUGCGUGUGACAGCGGCUGA;
The sequence of microRNA214 are as follows: ACAGCAGGCACAGACAGGCAGU.
10. according to claim 1 a kind of intracellular based on the affine nanometer transport vehicle of electrostatic and cell imaging
MicroRNA non-enzymatic amplification detection method, it is characterised in that:
The sequence of the hair fastener probe H1 are as follows: TCAACATCAGTCTGATAAGCTACCATGT GTAGATAGCTTATCAGAC
TCCTAATGGTGTGGC;
Its 5 ' end and 3 ' end difference mark fluorescent group FAM, quenching group BHQ-1;
The sequence of the hair fastener probe H2 are as follows:
ATAAGCTATCTACACATGGTAGCTTATCAGACTCCATGTGTAGA;
Its 3 ' end mark fluorescent group FAM, the 8th base T marks quenching group BHQ-1 from 5 ' ends.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811368048.2A CN109486906A (en) | 2018-11-16 | 2018-11-16 | MicroRNA non-enzymatic amplification detection method intracellular based on the affine nanometer transport vehicle of electrostatic and cell imaging |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811368048.2A CN109486906A (en) | 2018-11-16 | 2018-11-16 | MicroRNA non-enzymatic amplification detection method intracellular based on the affine nanometer transport vehicle of electrostatic and cell imaging |
Publications (1)
Publication Number | Publication Date |
---|---|
CN109486906A true CN109486906A (en) | 2019-03-19 |
Family
ID=65696112
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201811368048.2A Pending CN109486906A (en) | 2018-11-16 | 2018-11-16 | MicroRNA non-enzymatic amplification detection method intracellular based on the affine nanometer transport vehicle of electrostatic and cell imaging |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN109486906A (en) |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110878336A (en) * | 2019-11-18 | 2020-03-13 | 大连理工大学 | Based on Fe3O4Optical sensing detection method for miRNA of @ C nanoparticles |
CN111549102A (en) * | 2020-05-28 | 2020-08-18 | 西南大学 | Amphiphilic DNA nano micelle and preparation method and application thereof |
CN113621687A (en) * | 2021-08-24 | 2021-11-09 | 青岛科技大学 | Method for detecting miRNA-21 |
CN113789373A (en) * | 2021-08-24 | 2021-12-14 | 中山大学 | Exosome-based light-controlled signal amplification technology and application thereof in microRNA detection and imaging |
CN114480646A (en) * | 2022-01-20 | 2022-05-13 | 中山大学 | Fluorescent probe for living cell miRNA continuous imaging monitoring |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103383355A (en) * | 2013-07-12 | 2013-11-06 | 华南师范大学 | MicroRNA detection method based on non-enzymatic amplification and electrochemiluminescence principles |
CN103555767A (en) * | 2013-10-28 | 2014-02-05 | 北京工业大学 | Preparation method and applications of microRNA nano-carrier self-assembled layer by layer |
CN104450920A (en) * | 2014-12-11 | 2015-03-25 | 华南师范大学 | MicroRNA trace detection method based on exponential order non-enzymatic amplification and electrochemical luminescence principle |
CN105606576A (en) * | 2016-02-01 | 2016-05-25 | 清华大学 | Method for detecting specific mRNA in cell adopting molecular probe |
US20160220708A1 (en) * | 2015-02-02 | 2016-08-04 | The Chinese University Of Hong Kong | Nano-constructs for polynucleotide delivery |
-
2018
- 2018-11-16 CN CN201811368048.2A patent/CN109486906A/en active Pending
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103383355A (en) * | 2013-07-12 | 2013-11-06 | 华南师范大学 | MicroRNA detection method based on non-enzymatic amplification and electrochemiluminescence principles |
CN103555767A (en) * | 2013-10-28 | 2014-02-05 | 北京工业大学 | Preparation method and applications of microRNA nano-carrier self-assembled layer by layer |
CN104450920A (en) * | 2014-12-11 | 2015-03-25 | 华南师范大学 | MicroRNA trace detection method based on exponential order non-enzymatic amplification and electrochemical luminescence principle |
US20160220708A1 (en) * | 2015-02-02 | 2016-08-04 | The Chinese University Of Hong Kong | Nano-constructs for polynucleotide delivery |
CN105606576A (en) * | 2016-02-01 | 2016-05-25 | 清华大学 | Method for detecting specific mRNA in cell adopting molecular probe |
Non-Patent Citations (3)
Title |
---|
KEYING ZHANG等: "Lighting Up MicroRNA in Living Cells by the Disassembly of Lock-Like DNA-Programmed UCNPs-AuNPs through the Target Cycling Amplification Strategy", 《SMALL》 * |
刘海云: "癌症相关MicroRNA检测及成像研究", 《中国博士学位论文全文数据库 医药卫生科技辑》 * |
施勤等: "《骨科常用实验技术方法》", 31 December 2017, 苏州大学出版社 * |
Cited By (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110878336A (en) * | 2019-11-18 | 2020-03-13 | 大连理工大学 | Based on Fe3O4Optical sensing detection method for miRNA of @ C nanoparticles |
CN110878336B (en) * | 2019-11-18 | 2022-06-14 | 大连理工大学 | Based on Fe3O4Optical sensing detection method for miRNA of @ C nanoparticles |
CN111549102A (en) * | 2020-05-28 | 2020-08-18 | 西南大学 | Amphiphilic DNA nano micelle and preparation method and application thereof |
CN111549102B (en) * | 2020-05-28 | 2023-02-28 | 西南大学 | Amphiphilic DNA nano micelle and preparation method and application thereof |
CN113621687A (en) * | 2021-08-24 | 2021-11-09 | 青岛科技大学 | Method for detecting miRNA-21 |
CN113789373A (en) * | 2021-08-24 | 2021-12-14 | 中山大学 | Exosome-based light-controlled signal amplification technology and application thereof in microRNA detection and imaging |
CN113789373B (en) * | 2021-08-24 | 2023-09-05 | 中山大学 | Exosome-based light-operated signal amplification technology and application thereof in microRNA detection and imaging |
CN114480646A (en) * | 2022-01-20 | 2022-05-13 | 中山大学 | Fluorescent probe for living cell miRNA continuous imaging monitoring |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN109486906A (en) | MicroRNA non-enzymatic amplification detection method intracellular based on the affine nanometer transport vehicle of electrostatic and cell imaging | |
Chu et al. | Labeling tumor cells with fluorescent nanocrystal–aptamer bioconjugates | |
Wang et al. | Recognition and capture of metastatic hepatocellular carcinoma cells using aptamer-conjugated quantum dots and magnetic particles | |
Hwang et al. | Smart magnetic fluorescent nanoparticle imaging probes to monitor microRNAs | |
Zhang et al. | Targeted quantum dots fluorescence probes functionalized with aptamer and peptide for transferrin receptor on tumor cells | |
CN101836117A (en) | A rapid and sensitive method for detection of biological targets | |
Zhang et al. | A cell-based single-stranded DNA aptamer specifically targets gastric cancer | |
CN104894243B (en) | Nucleic acid aptamer probe, device and its application for tumour cell detection | |
CN102220431A (en) | Probe for detecting nucleic acid in living cells and application method thereof | |
CN108486107A (en) | Novel mRNA based on bimolecular fluorescence complementary and circular rna labeling method | |
CN105385691A (en) | Nucleic acid adapter used for detecting human high-metastasis colon cancer cell strain LoVo and detection kit | |
Wang et al. | Generating lung-metastatic osteosarcoma targeting aptamers for in vivo and clinical tissue imaging | |
CN108430336A (en) | Circulating cells, the internal collection of protein and nucleic acid and Local Quantitative and signature analysis | |
CN110819716B (en) | Activated near infrared two-region beacon probe composition and application thereof | |
Wang et al. | Simultaneous detection of multiple exosomal microRNAs for exosome screening based on rolling circle amplification | |
Zhang et al. | Nano-magnetic aptamer sensor incorporating AND logic recognition-launched hybridization chain reaction for organ origin identification of circulating tumor cells | |
Malicki et al. | Imaging of clear cell renal carcinoma with immune checkpoint targeting aptamer-based probe | |
CN107884377B (en) | Cell exosome-based nanocluster probe and application thereof in preparation of imaging preparation | |
Jiang et al. | A near-infrared cationic fluorescent probe based on thieno [3, 2-b] thiophene for RNA imaging and long-term cellular tracing | |
Sun et al. | In situ detection of exosomal RNAs for cancer diagnosis | |
CN107723342B (en) | Telomere probe and preparation method and application thereof | |
Deng et al. | Gold nanoparticle-based beacon to detect STAT5b mRNA expression in living cells: a case optimized by bioinformatics screen | |
CN104450713A (en) | Sequence and application of oligonucleotide aptamer C6-8 for specific recognition of heterogeneous ribonucleoprotein A2/B1 (hnRNPA2/B1) | |
CN114231599B (en) | Hybrid nanosphere based on metal-DNA coordination and preparation method and application thereof | |
Sui et al. | A modified protocol for the detection of three different mRNAs with a new-generation in situ hybridization chain reaction on frozen sections |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190319 |
|
RJ01 | Rejection of invention patent application after publication |