CN109486847A - The efficient inducible expression of bacillus subtilis based on artificial Gene expression - Google Patents
The efficient inducible expression of bacillus subtilis based on artificial Gene expression Download PDFInfo
- Publication number
- CN109486847A CN109486847A CN201811542046.0A CN201811542046A CN109486847A CN 109486847 A CN109486847 A CN 109486847A CN 201811542046 A CN201811542046 A CN 201811542046A CN 109486847 A CN109486847 A CN 109486847A
- Authority
- CN
- China
- Prior art keywords
- expression
- promoter
- gene expression
- activity
- efficient
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/07—Bacillus
- C12R2001/125—Bacillus subtilis ; Hay bacillus; Grass bacillus
Abstract
The invention discloses the efficient inducible expressions of bacillus subtilis based on artificial Gene expression, belong to gene engineering technology field.The present invention is efficiently manually composed in series type promoter using a kind of, by by the promoter and operon related elements (aporepressor and its binding site) Combination Design, and then make regulation of the activity of the constitutive promoter by inducer, finally construct the efficient inducible expression system of bacillus subtilis induced by inducer.The result shows that the artificial Gene expression activity in this system is higher by 15 times or so compared with the strong constitutive promoter of P43.And promoter activity can be precisely controlled by adding the inducer of various concentration.Therefore this efficient expression system structure is simple, activity is high, regulation is rigorous, has broad application prospects in heterologous protein high efficient expression and synthetic biology research.
Description
Technical field
The present invention relates to the efficient inducible expressions of bacillus subtilis based on artificial Gene expression, belong to gene work
Journey technical field.
Background technique
Bacillus subtilis is the Gram-positive type strain for being widely used in expressing foreign protein, because can be efficient
Expression foreign protein is widely used in terms of industrial enzyme preparation production.Promoter is the most basic of building efficient expression system
Element, the activity of promoter directly determine the efficiency of expression system.Promoter is functionally broadly divided into constitutive promoter
With two class of inducible promoter.Constitutive promoter thallus growth each stage can expression alien gene, and induce
Type promoter shows inactive or low activity when not being induced, and the activity of promoter substantially mentions after inducer is added
High and then efficiently expressing exogenous gene.Inducible promoter is widely used since its activity is controllable, and people can pass through tune
The reagent of inducer and expression time and the intensity of concentration control foreign gene is added in control.It is answered in bacillus subtilis at present
Mainly there are IPTG inducible system and xylose inducible system with relatively broad, wherein IPTG inducible system is based primarily upon pHT series
Vector construction forms, and uses the LacI aporepressor and binding site of non-natural hybrid promoter and Escherichia coli；And
Xylose inducible system is usually using natural PxylA promoter and XylR aporepressor.
Although the inducible systems such as IPTG, xylose are widely used, since promoter activity is limited, foreign protein
It is a critical issue of limitation system application always that expression quantity is low.People generally use transformation natural promoter and redesign
Two kinds of strategies of Artificial promoters improve the activity and stability of promoter.But high activity promoter is often not used to construct
Efficient induction type heterologous gene expression system, mainly often not due to promoter and the other elements of Gene expression regulation system
Compatible, the promoter of high activity, which tends not to be thwarted albumen, effectively inhibits activity.Therefore how efficient promoter structure is based on
Build the exploitation hot spot that the induction type heterologous gene expression system rigorously regulated and controled is current novel expression system.
Summary of the invention
The first purpose of the invention is to provide a kind of elements of controlling gene expression, comprising: (1) carrier；(2) artificial string
Join promoter；(3) repressor protein gene；(4) positioned at promoter transcription initiation site downstream can be with the DNA in conjunction with aporepressor
Segment；The artificial Gene expression includes PAWH-D30-106、PAH-D75-106Or PAH-D75-106, nucleotide sequence is respectively such as SEQ ID
NO.1, SEQ ID NO.2, shown in SEQ ID NO.3.
In one embodiment of the present invention, the aporepressor includes LacI, XylR, AraC or TetR.
In one embodiment of the present invention, when the aporepressor is LacI, gene expression is made by the induction of IPTG
With.
In one embodiment of the present invention, when the aporepressor is XylR, gene expression is made by the induction of xylose
With.
In one embodiment of the present invention, when the aporepressor is AraC, gene expression is lured by arabinose
Lead effect.
In one embodiment of the present invention, when the aporepressor is TetR, induction of the gene expression by tetracycline
Effect.
In one embodiment of the present invention, the carrier includes pHT-01.
A second object of the present invention is to provide a kind of recombinant plasmids, express the element of above-mentioned adjusting gene expression
Third object of the present invention is to provide a kind of genetic engineering bacteriums, express above-mentioned recombinant plasmid.
Fourth object of the present invention is to provide a kind of method of regulation destination gene expression, by above-mentioned adjusting gene expression
Element and target gene co-express.
Fifth object of the present invention is to provide the elements of above-mentioned controlling gene expression to prepare the application in destination protein.
Sixth object of the present invention is to provide the elements of above-mentioned controlling gene expression in food, chemical industry or pharmaceutical field
Using.
7th purpose of the invention is to provide said gene engineering bacteria and is preparing the application in destination protein.
8th purpose of the invention is to provide said gene engineering bacteria in the application of food, chemical industry or pharmaceutical field.
The present invention is efficiently manually composed in series type promoter using a kind of, by the way that the promoter is related to operon first
Part (aporepressor and its binding site) Combination Design, and then make regulation of the activity of the constitutive promoter by inducer,
Finally construct the efficient inducible expression system of bacillus subtilis induced by inducer.The result shows that with the strong composing type of P43
Promoter is compared, and the artificial Gene expression activity in this system is higher by 15 times or so.And it can be by adding various concentration
Inducer be precisely controlled promoter activity.Therefore this efficient expression system structure is simple, activity is high, regulation is rigorous, heterologous
Have broad application prospects in albumen high efficient expression and synthetic biology research.
Detailed description of the invention
Fig. 1: PAWH-D30-106、PAH-D75-106And PAH-D75-106Compared with P43 promoter activity.
The building of Fig. 2: IPTG inducible expression and characterization, a:IPTG inducible system principle；B:IPTG inducible system characterization；
C:SDS-PAGE verifies sfGFP expression.
The building of Fig. 3: xylose inducible expression and characterization, a:xylose inducible system principle；B:xylose induction system
System characterization；C:SDS-PAGE verifies sfGFP expression.
Specific embodiment
1, plasmid construction method: design includes the primer of promoter sequence, using pHT01 plasmid as skeleton template, is used
PrimeSTAR MAX archaeal dna polymerase (being purchased from Takara, article No.: R045Q) carries out full plasmid PCR, PCR program are as follows: initial denaturation
98 DEG C of 1min recycle to be denaturalized 98 DEG C of 30s, and anneal 50 DEG C of 30s, extend 72 DEG C of 1min, totally 30 circulations, last 72 DEG C of extensions
10min.Later with restriction enzyme DpnI digestion removal plasmid template, PCR product is purified.Same method amplification needs gram
Grand segment is later assembled multiple segments with Infusion recombination method, and conversion e. coli jm109 competence is thin
Born of the same parents.
2, the detection method of sfGFP fluorescence intensity: 12000 × g of sample is centrifuged 2min, collects thallus, and PBS buffer solution washes 3
It is secondary, it is diluted to certain density thallus suspension with PBS, takes 200 μ L to 96 hole elisa Plates, is put into SynergyTM H4 luciferase mark
Instrument detects fluorescence.Exciting light 485nm absorbs light 528nm, detects fluorescence.
3, culture medium: LB culture medium (L-1): tryptone 10g, NaCl 10g, yeast extract 5g, pH 7.0 are prepared solid
Agar powder 20g is added when body culture medium.
4,168 method for transformation of bacillus subtilis: the SPI culture medium that single colonie bacillus subtilis 168 is seeded to 2mL is chosen
In, 37 DEG C of shaking table culture 12h-14h；100 μ L are taken from culture, are seeded in 5mL SPI culture medium, 37 DEG C of shaking table culture 4-
Start to survey OD after 5h600.Work as OD600When about 1.0, pipette 200 μ L bacterium solutions and be forwarded in the SPII culture medium of 2mL, in 37 DEG C,
100r·min-1Shaking table is incubated for 1.5h；20 μ L l00 × EGTA (bis- (alpha-amido ethylether) tetraacethyls of ethylene glycol) are added in Xiang Guanzhong
Solution, in 37 DEG C, 100rmin-1500 μ L are dispensed per l.5mL centrifuge tube after cultivating 10min in shaking table；Xiang Guanzhong, which is added, to be passed through
Correctly appropriate plasmid, pressure-vaccum mixing are placed in 37 DEG C, 100rmin to sequence verification-1Shaking table in cultivate 2h；Culture terminates,
It draws about 200 μ L of bacterium solution and uniformly applies corresponding selective plate, 37 DEG C of culture 12h-14h.
5, SDS-PAGE is detected: taking 200 μ L bacterium solutions, 12000 × g is centrifuged 2min, collects thallus.Contain 20 μ g/ with 200 μ L
20mM Tris-HCl (pH8.0) buffer resuspension of mL concentration lysozyme, 37 DEG C of incubation 30min are with lytic cell wall.Later
12000 × g is centrifuged 5min after 50 μ L 10 × Loading Buffer, boiling water boiling 10min are added.Take 30 μ L Supernatant samples electrophoresis
Detection, through coomassie brilliant blue R250 dyeing and destainer decoloration post analysis electrophoresis result.
Embodiment 1: artificial Gene expression activity identification
PAWH-D30-106、PAH-D75-106And PAH-D75-106Promoter is artificial constructed core space tandem hybrid promoter.
PAWH-D30-106、PAH-D75-106、PAH-D75-106The sequence of promoter respectively as SEQ ID NO.1, SEQ ID NO.2,
Shown in SEQ ID NO.3.
By promoter PAWH-D30-106It is cloned with primer of sfGFP (Genbank ID:AVR55189.1) expression cassette in table 1
To pHT01 carrier, the P on original vector is replacedspacPromoter sequence.The expression vector is converted to bacillus subtilis 168
In, recombinant bacterium 20h is cultivated, the expression of sfGFP is detected.Detection contains P respectively in an identical mannerAH-D75-106With contain
PWAH-D75-106The expression of the sfGFP of the recombination bacteria culture fluid of recombinant plasmid.
By making comparisons with the case where common strong constitutive promoter P43 expression sfGFP, the results show that PAWH-D30-106、
PAH-D75-106、PWAH-D75-106Promoter expresses the horizontal high more than P43 promoter of sfGFP, reach 15 times of P43 or so (Fig. 1 and
Table 2).Illustrate promoter PAWH-D30-106、PAH-D75-106、PWAH-D75-106It is the very high strong constitutive promoter of activity.
1 expression vector establishment primer of table
| Primer | Sequence (5 ' -3 ')a |
| PpHT-AWH-i1 | CTAACGGAAAAGGGATTTTTGAGTGATCTTCTCAAAAAATAC |
| PpHT-AWH-i2 | CCTCGTATGTTTCAAAGAGTGCACCATATGCGG |
| PpHT-AWH-v1 | CATATGGTGCACTCTTTGAAACATACGAGGCTAATATCGG |
| PpHT-AWH-v2 | AAGATCACTCAAAAATCCCTTTTCCGTTAGCTTTTTC |
The artificial Gene expression activity of table 2
| Promoter | Fluorescence intensity (a.u./OD600) |
| P43 | 5370 |
| PAWH-D30-106 | 75340 |
| PAH-D75-106 | 77014 |
| PWAH-D75-106 | 77334 |
The building and characterization of embodiment 2:IPTG inducible expression system
The binding site sequence of lacI is GGAATTGTGAGCGGATAACAATTCC (SEQ ID NO.4), is designed
Primer P in table 3AWH-lacO-1/PAWHOn-lacO-2, LacI protein binding site is cloned into using full plasmid PCR method
Promoter PAWH-D30-106The downstream of transcription initiation site, while utilizing the lacI modular expression having in itself on pHT01 carrier framework
Aporepressor LacI thus constructs the expression system (Fig. 2 a) of IPTG induction type.
With sfGFP, Characterisation of proteins expression quantity level, building obtain plasmid pHT-AWH-lac-sfGFP as a purpose.It should
Recombinant plasmid transformed is into bacillus subtilis 168,37 DEG C in LB culture medium, cultivates recombinant bacterium under 200rpm, detects afterwards for 24 hours
The expression of sfGFP.
In no IPTG inducer, aporepressor LacI can be combined effectively in promoter transcription initiation site downstream, resistance
Only transcription of the RNA polymerase to downstream gene, to inhibit the expression of downstream gene.When IPTG is added, the activity of promoter
It is released.It is higher (being no more than 1mM) that IPTG concentration is added, promoter activity is stronger.Therefore, the dosage of adjusting IPTG can be passed through
Obtain the downstream gene expression intensity (Fig. 2 b and table 4) of varying strength.SDS-PAGE detection also demonstrates various concentration inducer
The addition of IPTG obtains the sfGFP expression (Fig. 2 c) of varying strength.
3 IPTG inducible expression carrier of table constructs primer
| Primer | Sequence (5 ' -3 ')a |
| PAWH-lacO-1 | GGAATTGTGAGCGGATAACAATTCCATGCTTTTATTCGAACATCATATTTAAAG |
| PAWH-lacO-2 | GGAATTGTTATCCGCTCACAATTCCTAGTGTATCAATTCCACGATTTTTTC |
Under the IPTG induction of 4 various concentration of table, sfGFP expression
| Condition | Fluorescence intensity (a.u./OD600) |
| pHT-01 | 179 |
| PHT-AWH (non-combined operation) | 6635 |
| 0mM IPTG | 516 |
| 0.01mM IPTG | 929 |
| 0.05mM IPTG | 1993 |
| 0.1mM IPTG | 2665 |
| 0.5mM IPTG | 4132 |
| 1mM IPTG | 4163 |
The building and characterization of embodiment 3:xylose inducible expression system
Aporepressor XylR binding site is cloned into promoter P using the primer in table 3AWH-D30-106Transcription initiation site
Downstream, while by the lacI gene replacement on pHT01 carrier framework be xylR gene, building XylR express module, thus
Construct the expression system of xylose induction type.
Using plasmid pHT-AWH-lac-sfGFP as template, expanded with primer PAWH-xylR-v1/PAWH-xylR-v2 (table 5)
Increase carrier framework, expands xylR gene with primer PAWH-xylR-i1/PAWH-xylR-i2, two segments of amplification are recombinated, are obtained
The plasmid that lacI is replaced by xylR is obtained, primer PAWH-xylO-1/PAWH-xylO-2 is recycled, passes through the method for full plasmid PCR
The binding site of lacI is replaced with to binding site AGTTAGTTTATTGGATAAACAAACTAACT (the SEQ ID of xylR
NO.5), final building obtains plasmid pHT-AWH-xyl-sfGFP.
By the recombinant plasmid transformed into bacillus subtilis 168,37 DEG C in LB culture medium, recombination is cultivated under 200rpm
Bacterium detects the expression of sfGFP afterwards for 24 hours.
In no inducer xylose, aporepressor xylR can effectively be combined in promoter transcription initiation site downstream,
Transcription of the RNA polymerase to promoter is prevented, to inhibit the expression (Fig. 3 a) of downstream gene.When addition various concentration
When xylose, the activity of promoter is gradually released, therefore the downstream of varying strength can be obtained by adjusting xylose concentration
Gene expression intensities.As the concentration of xylose steps up, the fluorescence signal that sfGFP expression generates therewith enhances, when
When xylose concentration meets or exceeds 1% (W/V), the expression of sfGFP is even higher than the control of constitutive expression sfGFP
PHT-AWH (Fig. 3 b and table 6).Further SDS-PAGE detection further demonstrates the addition of various concentration inducer xylose
Obtain the sfGFP expression (Fig. 3 c) of varying strength.
5 xylose inducible expression carrier of table constructs primer
Under the different xylose concentrations of table 4, sfGFP expression
| Condition | Fluorescence intensity (a.u./OD600) |
| pHT-01 | 179 |
| PHT-AWH (non-combined operation) | 6635 |
| 0% xylose | 393 |
| 0.01% xylose | 2263 |
| 0.05% xylose | 3808 |
| 0.1% xylose | 4322 |
| 0.5% xylose | 5480 |
| 1% xylose | 7326 |
| 2% xylose | 9556 |
Although the present invention has been described by way of example and in terms of the preferred embodiments, it is not intended to limit the invention, any to be familiar with this skill
The people of art can do various change and modification, therefore protection model of the invention without departing from the spirit and scope of the present invention
Enclosing subject to the definition of the claims.
SEQUENCE LISTING
<110>Southern Yangtze University
<120>the efficient inducible expression of bacillus subtilis based on artificial Gene expression
<160> 17
<170> PatentIn version 3.3
<210> 1
<211> 245
<212> DNA
<213>artificial synthesized
<400> 1
aagcaaaaaa agtttgactc ggtattttaa ctatgttaat attgtaaaat gccaatgtat 60
attttataaa aaaattgaaa ccttttgaaa cgaagctcgt atacatacag accggtgaag 120
gtgtaactat atcctatttt ttcaaaaaat attttaaaaa cgagcaggat ttcagaaaaa 180
atcgtggaat tgatacacta atgcttttat tcgaacatca tatttaaagt acaggaggtc 240
cacat 245
<210> 2
<211> 230
<212> DNA
<213>artificial synthesized
<400> 2
aagcaaaaaa agtttgactc ggtattttaa ctatgttaat attgtaaaat gccaatgtat 60
tttttattta ccttatgccc gaaatgaaag ctttatgacc taattgtgta actatatcct 120
attttttcaa aaaatatttt aaaaacgagc aggatttcag aaaaaatcgt ggaattgata 180
cactaatgct tttattcgaa catcatattt aaagtacagg aggtccacat 230
<210> 3
<211> 290
<212> DNA
<213>artificial synthesized
<400> 3
attttataaa aaaattgaaa ccttttgaaa cgaagctcgt atacatacag accggtgaag 60
aagcaaaaaa agtttgactc ggtattttaa ctatgttaat attgtaaaat gccaatgtat 120
tttttattta ccttatgccc gaaatgaaag ctttatgacc taattgtgta actatatcct 180
attttttcaa aaaatatttt aaaaacgagc aggatttcag aaaaaatcgt ggaattgata 240
cactaatgct tttattcgaa catcatattt aaagtacagg aggtccacat 290
<210> 4
<211> 25
<212> DNA
<213>artificial synthesized
<400> 4
ggaattgtga gcggataaca attcc 25
<210> 5
<211> 29
<212> DNA
<213>artificial synthesized
<400> 5
agttagttta ttggataaac aaactaact 29
<210> 6
<211> 42
<212> DNA
<213>artificial synthesized
<400> 6
ctaacggaaa agggattttt gagtgatctt ctcaaaaaat ac 42
<210> 7
<211> 33
<212> DNA
<213>artificial synthesized
<400> 7
cctcgtatgt ttcaaagagt gcaccatatg cgg 33
<210> 8
<211> 40
<212> DNA
<213>artificial synthesized
<400> 8
catatggtgc actctttgaa acatacgagg ctaatatcgg 40
<210> 9
<211> 37
<212> DNA
<213>artificial synthesized
<400> 9
aagatcactc aaaaatccct tttccgttag ctttttc 37
<210> 10
<211> 54
<212> DNA
<213>artificial synthesized
<400> 10
ggaattgtga gcggataaca attccatgct tttattcgaa catcatattt aaag 54
<210> 11
<211> 51
<212> DNA
<213>artificial synthesized
<400> 11
ggaattgtta tccgctcaca attcctagtg tatcaattcc acgatttttt c 51
<210> 12
<211> 58
<212> DNA
<213>artificial synthesized
<400> 12
agttagttta ttggataaac aaactaacta tgcttttatt cgaacatcat atttaaag 58
<210> 13
<211> 55
<212> DNA
<213>artificial synthesized
<400> 13
agttagtttg tttatccaat aaactaactt agtgtatcaa ttccacgatt ttttc 55
<210> 14
<211> 44
<212> DNA
<213>artificial synthesized
<400> 14
ttaattgcgt tgcgcctaac ttataggggt aacacttaaa aaag 44
<210> 15
<211> 40
<212> DNA
<213>artificial synthesized
<400> 15
agggagacga ttttgatggt tattattcaa attgcagatc 40
<210> 16
<211> 32
<212> DNA
<213>artificial synthesized
<400> 16
ttgaataata accatcaaaa tcgtctccct cc 32
<210> 17
<211> 32
<212> DNA
<213>artificial synthesized
<400> 17
acccctataa gttaggcgca acgcaattaa tg 32
Claims (10)
1. a kind of element of controlling gene expression characterized by comprising (1) carrier；(2) artificial Gene expression；(3) it hinders
Hold back protein gene；(4) positioned at promoter transcription initiation site downstream can be with the DNA fragmentation in conjunction with aporepressor；It is described artificial
Gene expression includes PAWH-D30-106、PAH-D75-106Or PAH-D75-106, nucleotide sequence is respectively such as SEQ ID NO.1, SEQ ID
Shown in NO.2, SEQ ID NO.3.
2. element as described in claim 1, which is characterized in that the aporepressor includes LacI, XylR, AraC or TetR.
3. element as claimed in claim 1 or 2, which is characterized in that the carrier includes pHT-01.
4. the plasmid containing any element of claim 1-3.
5. expressing the genetic engineering bacterium of plasmid described in claim 4.
6. a kind of method of regulation destination gene expression, which is characterized in that by claim the 1-3 any element and purpose
Gene co-expressing.
7. any element of claim 1-3 is preparing the application in destination protein.
8. any element of claim 1-3 is in the application of food, chemical industry or pharmaceutical field.
9. genetic engineering bacterium described in claim 5 is preparing the application in destination protein.
10. genetic engineering bacterium described in claim 5 is in the application of food, chemical industry or pharmaceutical field.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811542046.0A CN109486847B (en) | 2018-12-17 | 2018-12-17 | Bacillus subtilis efficient induction expression system based on artificial tandem promoter |
| PCT/CN2019/078809 WO2020124830A1 (en) | 2018-12-17 | 2019-03-20 | Artifical tandem promoter-based efficient inducible bacillus subtilis expression system |
| US17/160,582 US20210163963A1 (en) | 2018-12-17 | 2021-01-28 | Bacillus Subtilis Efficiently-Induced Expression System Based on Artificial Series Promoter |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811542046.0A CN109486847B (en) | 2018-12-17 | 2018-12-17 | Bacillus subtilis efficient induction expression system based on artificial tandem promoter |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109486847A true CN109486847A (en) | 2019-03-19 |
| CN109486847B CN109486847B (en) | 2021-03-02 |
Family
ID=65710484
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811542046.0A Active CN109486847B (en) | 2018-12-17 | 2018-12-17 | Bacillus subtilis efficient induction expression system based on artificial tandem promoter |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN109486847B (en) |
| WO (1) | WO2020124830A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111269926A (en) * | 2019-12-31 | 2020-06-12 | 江南大学 | Cobalt ion inducible protein expression system and application |
| WO2020124830A1 (en) * | 2018-12-17 | 2020-06-25 | 江南大学 | Artifical tandem promoter-based efficient inducible bacillus subtilis expression system |
| CN112877352A (en) * | 2021-02-08 | 2021-06-01 | 华南理工大学 | Cumate induction system suitable for corynebacterium glutamicum, plasmid vector constructed by induction system and application |
| CN115232829A (en) * | 2022-05-18 | 2022-10-25 | 北京大学口腔医学院 | Protein induction expression plasmid in streptococcus mutans, and preparation method and application thereof |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| HK87484A (en) * | 1979-07-05 | 1984-11-16 | Genentech Inc | Plasmid with tandem promoter system |
| US5955310A (en) * | 1998-02-26 | 1999-09-21 | Novo Nordisk Biotech, Inc. | Methods for producing a polypeptide in a bacillus cell |
| US6361973B1 (en) * | 1999-03-22 | 2002-03-26 | Novozymes Biotech, Inc. | Promoters for expressing genes in a fungal cell |
| CN1678624A (en) * | 2002-07-03 | 2005-10-05 | 陶氏环球技术公司 | Benzoate- and anthranilate-inducible promoters |
| CN102382855A (en) * | 2011-11-14 | 2012-03-21 | 福州大学 | Bacillus subtilis xylose induced exocrine expression vector |
| CN104789566A (en) * | 2015-04-24 | 2015-07-22 | 江南大学 | Novel promoter and application thereof |
| CN105779444A (en) * | 2014-12-16 | 2016-07-20 | 青岛蔚蓝生物集团有限公司 | Tandem promoters capable of improving protein expression quantities of bacilli |
| CN108220288A (en) * | 2016-12-13 | 2018-06-29 | 上海凯赛生物技术研发中心有限公司 | A kind of polynucleotide, transformant and its application |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS6027388A (en) * | 1983-07-22 | 1985-02-12 | Green Cross Corp:The | Plasmid |
| CN101402959B (en) * | 2008-11-14 | 2010-12-01 | 南京农业大学 | Promotor replacement method for improving volume of production of bacillus subtilis surfactin |
| CN109486847B (en) * | 2018-12-17 | 2021-03-02 | 江南大学 | Bacillus subtilis efficient induction expression system based on artificial tandem promoter |
-
2018
- 2018-12-17 CN CN201811542046.0A patent/CN109486847B/en active Active
-
2019
- 2019-03-20 WO PCT/CN2019/078809 patent/WO2020124830A1/en active Application Filing
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| HK87484A (en) * | 1979-07-05 | 1984-11-16 | Genentech Inc | Plasmid with tandem promoter system |
| US5955310A (en) * | 1998-02-26 | 1999-09-21 | Novo Nordisk Biotech, Inc. | Methods for producing a polypeptide in a bacillus cell |
| US6361973B1 (en) * | 1999-03-22 | 2002-03-26 | Novozymes Biotech, Inc. | Promoters for expressing genes in a fungal cell |
| CN1678624A (en) * | 2002-07-03 | 2005-10-05 | 陶氏环球技术公司 | Benzoate- and anthranilate-inducible promoters |
| CN102382855A (en) * | 2011-11-14 | 2012-03-21 | 福州大学 | Bacillus subtilis xylose induced exocrine expression vector |
| CN105779444A (en) * | 2014-12-16 | 2016-07-20 | 青岛蔚蓝生物集团有限公司 | Tandem promoters capable of improving protein expression quantities of bacilli |
| CN104789566A (en) * | 2015-04-24 | 2015-07-22 | 江南大学 | Novel promoter and application thereof |
| CN108220288A (en) * | 2016-12-13 | 2018-06-29 | 上海凯赛生物技术研发中心有限公司 | A kind of polynucleotide, transformant and its application |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020124830A1 (en) * | 2018-12-17 | 2020-06-25 | 江南大学 | Artifical tandem promoter-based efficient inducible bacillus subtilis expression system |
| CN111269926A (en) * | 2019-12-31 | 2020-06-12 | 江南大学 | Cobalt ion inducible protein expression system and application |
| CN112877352A (en) * | 2021-02-08 | 2021-06-01 | 华南理工大学 | Cumate induction system suitable for corynebacterium glutamicum, plasmid vector constructed by induction system and application |
| CN115232829A (en) * | 2022-05-18 | 2022-10-25 | 北京大学口腔医学院 | Protein induction expression plasmid in streptococcus mutans, and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109486847B (en) | 2021-03-02 |
| WO2020124830A1 (en) | 2020-06-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109486847A (en) | The efficient inducible expression of bacillus subtilis based on artificial Gene expression | |
| Yim et al. | Isolation of fully synthetic promoters for high‐level gene expression in Corynebacterium glutamicum | |
| Su et al. | Heterologous gene expression in filamentous fungi | |
| Palomares et al. | Production of recombinant proteins: challenges and solutions | |
| Sharma et al. | Genetic transformation of lignin degrading fungi facilitated by Agrobacterium tumefaciens | |
| Mori et al. | Signal peptide optimization tool for the secretion of recombinant protein from Saccharomyces cerevisiae | |
| CN114846146A (en) | Engineered guide RNAs for increasing efficiency of CRISPR/Cas12f1 system and uses thereof | |
| EP2699588B1 (en) | Filamentous fungi having an altered viscosity phenotype | |
| Koo et al. | Expression of bovine lactoferrin N-lobe by the green alga, Chlorella vulgaris | |
| US20210163963A1 (en) | Bacillus Subtilis Efficiently-Induced Expression System Based on Artificial Series Promoter | |
| Gitzinger et al. | Functional cross‐kingdom conservation of mammalian and moss (Physcomitrella patens) transcription, translation and secretion machineries | |
| CN106497954A (en) | A kind of labelled protein expression cassette of inducible regulation and control and its recombinant vector and the application of structure | |
| CN108220322B (en) | DNA for improving expression quantity of bacillus subtilis protein | |
| Welsch et al. | Stepwise optimization of a low-temperature Bacillus subtilis expression system for “difficult to express” proteins | |
| RU2017121232A (en) | PLASMIDES AND METHOD FOR PRODUCING VIRUS PARTICLES | |
| CN111363714B (en) | Construction method of food-grade streptococcus thermophilus expression vector | |
| CN101993887B (en) | Efficient bacillus secretory expression carrier and building method thereof | |
| CN108165551A (en) | Carrier T and the application of a kind of improved promoter and its composition | |
| CN109652417B (en) | Method for constructing efficient bacillus subtilis promoter | |
| CN113667687B (en) | AI-2 molecular response-based starting element and escherichia coli dynamic regulation system and method constructed by same | |
| JP5735775B2 (en) | Modified promoter | |
| JP7061018B2 (en) | A novel promoter and a method for producing a protein using the promoter | |
| CN103642807B (en) | Enhanced bombyx mori nuclear polyhedrosis virus inducible promoter En39k and application thereof | |
| Sun et al. | Simultaneous manipulation of multiple genes within a same regulatory stage for iterative evolution of Trichoderma reesei | |
| CN109852650B (en) | Artificial aptamer enzyme regulated and controlled by theophylline and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhou Zhemin Inventor after: Cui Wenjing Inventor after: Hao Wenliang Inventor after: Han Laichuang Inventor after: Zhou Li Inventor after: Liu Zhongmei Inventor after: Yan Yu Inventor before: Zhou Zhemin Inventor before: Cui Wenjing Inventor before: Han Laichuang Inventor before: Hao Wenliang Inventor before: Zhou Li Inventor before: Liu Zhongmei Inventor before: Yan Yu |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |