CN109486826A - Larimichthys crocea scavenger receptor gene M ARCO gene and its immune defense function - Google Patents
Larimichthys crocea scavenger receptor gene M ARCO gene and its immune defense function Download PDFInfo
- Publication number
- CN109486826A CN109486826A CN201811123807.9A CN201811123807A CN109486826A CN 109486826 A CN109486826 A CN 109486826A CN 201811123807 A CN201811123807 A CN 201811123807A CN 109486826 A CN109486826 A CN 109486826A
- Authority
- CN
- China
- Prior art keywords
- gene
- marco
- larimichthys crocea
- arco
- scavenger receptor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1096—Processes for the isolation, preparation or purification of DNA or RNA cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Bioinformatics & Computational Biology (AREA)
- Cell Biology (AREA)
- Immunology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses Larimichthys crocea scavenger receptor gene M ARCO gene and its immune defense functions, MARCO gene open reading frame sequence is obtained using homologous clone method and RACE technology clone, its sequence is as shown in SEQ ID NO:1, overall length is 1218 bp, encode 405 amino acid, purposes of the above-mentioned MARCO gene in Larimichthys crocea immune defense function；Immune defense function includes the health and evolution for adjusting congenital immunity maintenance body.Have the beneficial effect that the present invention obtains MARCO gene using homologous clone method and RACE technology clone, Total RNAs extraction effect is good in cloning procedure, can inactivate endogenous RNA enzyme, improve the yield and purity of total serum IgE；MARCO genetic immunization defense function provides fundamental basis for disease caused by prevention pathogen, also provides theoretical direction to disclose Larimichthys crocea healthy aquaculture.
Description
Technical field
The present invention relates to gene engineering technology field, more particularly, to Larimichthys crocea scavenger receptor gene M ARCO gene and
Its immune defense function.
Technical background
Larimichthys crocea (Larimichthys crocea) it is distributed widely in China's southeastern coast, it is commonly called as " yellow croaker ", meat is fresh
Tender smooth, it is the common food fish on common people's dining table that nutritive value is high, finally extensive from resource scarcity state experienced
After propagating artificially and opening up the domestic and foreign markets energetically, the economic status of Larimichthys crocea is constantly promoted, and is propagated artificially also increasingly
Receive significant attention, but cultured large yellow croaker usually be unable to do without resist pathogen the problem of, thus the exploitation of gene involved in immunity and
Using showing important especially.The completion of genome sequencing based on Larimichthys crocea, people are new to one in the gene studies of Larimichthys crocea
Step, Larimichthys crocea congenital immunity gene expression characteristics are also gradually resolved, wherein the pattern-recognition as the first defence line of immune defense
Receptor (Pattern recognition receptors, PRRs) is particularly critical, such molecule prevents from infecting by both of which
With identification internal injury: i.e. pathogen-associated molecular pattern (pathogen-associated molecular patterns,
PAMPs) and associated molecular pattern (damage-associated molecular patterns, DAMPs) is damaged.Street cleaner by
Body (Scavenger Receptors, SRs) is first PRRs being described, and SRs is the albumen point of various structures Various Functions
The general designation of son can be combined, be shifted, degrade acetylation/oxidative modification low-density lipoprotein (acetylated low in the cell
Density lipoproteins, AcLDL/oxidised low density lipoproteins OxLDL), and can with it is more
Kind ligand binding plays different role.Presently found scavenger receptor substantially has A to H totally 8 class, referred to as scavenger receptor man
Race separately has I, J class still in the exploratory stage.The family member is in endothelial cell, macrophage, smooth muscle cell, haemocyte, broken
Scavenger receptor family member expression regulation is found in the cells such as osteocyte, fat cell, Dendritic Cells, blood platelet.Wherein A
The extracellular region of MARCO of class scavenger receptor a kind of lack alpha-helix curling motif, be collagen spline structure domain, these all with by
The formation of body tripolymer is closely related, contains 6 conservative cysteines in C-terminal, and have a SRCR structural domain, with
SR-AI structure has biggish similitude.MARCO great expression in the macrophage of splenic marginal zones, and spleen be human body most
Big peripheral lymphoid organ, the marginal zone are located at the intersection of white pulp and red pulp, and it is thin to be dispersed with macrophage abundant, dendron shape
Born of the same parents and bone-marrow-derived lymphocyte, the marginal sinus of marginal zone are the position of earliest contact and identification antigen, therefore may determine that in marginal zone height
The MARCO of expression participates in the immune response of body, plays the important function of identification pathogen.The combination of MARCO and PAMPs is main
It is related with SRCR structural domain, gram-positive bacteria and Gram-negative bacteria can be combined, moreover it is possible to micro- in conjunction with quartz particles and latex
Ball etc..It has been reported that the MARCO gene of people and mouse is after knocking out SRCR structural domain, it is impossible to which correct identification and combination are corresponding
Ligand.Therefore research MARCO gene and its immune function are to the inherent immunity system regulation machine for furtheing elucidate Larimichthys crocea
System, the influence for grasping the immune metabolism of MARCO gene pairs Larimichthys crocea lay the foundation.Meanwhile it being mentioned for disease caused by prevention pathogen
For theoretical basis, theoretical direction also is provided to disclose Larimichthys crocea healthy aquaculture.
Summary of the invention
One of the objects of the present invention is to provide a kind of Larimichthys crocea scavenger receptor gene M ARCO genes, use homologous
PCR cloning PCR and RACE technology clone obtain, and Total RNAs extraction effect is good in cloning procedure, can inactivate endogenous RNA enzyme, will not cause
The degradation of RNA keeps the integrality of RNA, improves the yield and purity of total serum IgE.
The second object of the present invention is to provide a kind of purposes of MARCO gene in Larimichthys crocea immune defense function, is
Disease caused by prevention pathogen is provided fundamental basis, and also provides theoretical direction to disclose Larimichthys crocea healthy aquaculture.
The present invention in background technique aiming at the problem that mentioning, the technical solution taken are as follows:
Larimichthys crocea scavenger receptor gene M ARCO gene, MARCO gene open reading frame sequence use homologous clone method and RACE
Technology clone obtains, and wherein MARCO gene open reading frame sequence is as shown in SEQ ID NO:1.
Preferably, it is 1218 bp that MARCO gene, which puts reading frame sequence overall length, 405 amino acid are encoded.
Preferably, MARCO gene cloning includes the following steps:
The cDNA synthesized using the total serum IgE reverse transcription of extraction is template amplification MARCO genetic fragment, purifying；
Amplified production after purification is subjected to T-A clone, is sequenced to get MARCO gene.
Further preferably, primer set for amplification are as follows:
MARCO-F:5'-ATGGAGACGTAGGTGGAGGGCACC-3'；
MARCO-R:5'-CTAGGAGCCCTCCAGTGCCGG-3'.
Further preferably, amplification reaction system are as follows: 2.5 μ L 10 × PCR Buffer, 0.4 μ L dNTPs, 0.8 μ L
MARCO-F, 0.8 μ L MARCO-R, 0.6 μ L Template cDNA, 0.4 μ L Taq DNA polymerase(TaKaRa),
14.5μL RNase free dd H2O。
Further preferably, amplification condition are as follows: 95 DEG C of initial denaturation 4min；94 DEG C of denaturation 30s, 55-65 DEG C of annealing 30s, 72 DEG C
Extend 2 min, recycles 35 times；Last 72 DEG C of extensions 10min.
Further preferably, Total RNAs extraction is extracted using Trizol Regent, phosphoguanidine and thiocarbamide.Trizol
Regent, phosphoguanidine and thiocarbamide can play gain effect, on the one hand can rapidly permeate into tissue, inactivate endogenous RNA enzyme, Bu Huiyin
The degradation of RNA is played, convenient for the subsequent extracted of RNA, and there is extremely strong cracking ability, it can lytic cell and group in a short time
Sample is knitted, the RNA enzyme activity for being denaturalized and cell being inhibited to release occurs rapidly for the protein that cell can be made to release, and effectively presses down
The degradation of RNA in sample preparation sheet, keeps the integrality of RNA；On the other hand the substances such as the protein of denaturation is assisted to be dissolved in subsequent add
The chloroform entered, enables RNA to be quickly distributed in upper strata aqueous phase, improves the yield and purity of total serum IgE.
Still more preferably, 0.03-0.04% phosphoguanidine and 0.01-0.02% thiocarbamide are contained in Trizol Regent.
The invention also discloses the purposes of Larimichthys crocea scavenger receptor gene M ARCO gene, MARCO gene is exempted from Larimichthys crocea
Purposes in epidemic disease defense function.MARCO gene is outside macrophage membrane containing collagen spline structure domain and rich in cysteine
Structural domain, these structural domains are the significant points in conjunction with aglucon, can promote the adherency of macrophage, are participated in removing machine body
Apoptotic cell also played an important role in terms of body defenses in addition it can resist the invasion of pathogen, be pre- diseases prevention
Disease caused by opportunistic pathogen is provided fundamental basis, and also provides theoretical direction to disclose Larimichthys crocea healthy aquaculture.
Compared with the prior art, the advantages of the present invention are as follows: the present invention has cloned MARCO gene, total serum IgE in cloning procedure
Extraction effect is good, can inactivate endogenous RNA enzyme, will not cause the degradation of RNA, keeps the integrality of RNA, improves the yield of total serum IgE
And purity；Purposes of the MARCO gene that the present invention clones in Larimichthys crocea immune defense function, for disease caused by prevention pathogen
Disease is provided fundamental basis, and also provides theoretical direction to disclose Larimichthys crocea healthy aquaculture.
Detailed description of the invention
Fig. 1 is large yellow croaker liver and spleen total serum IgE electrophoretogram in the embodiment of the present invention 1；
Fig. 2 is the clear MARCO gene expression amount of Larimichthys crocea and control group in the embodiment of the present invention 4.
Specific embodiment
The present invention program is described further below by embodiment:
Embodiment 1:
Larimichthys crocea scavenger receptor gene M ARCO gene, MARCO gene open reading frame sequence use homologous clone method and RACE
Technology clone obtain, MARCO gene open reading frame sequence be as shown in SEQ ID NO:1, specifically: ATGGAGACGTCGG
TGGACCGCACCAACAACCGAGTCTCGTACACGCAGAGTAACCCGCTGTTCGACATGTCGCTCAGCAGGACTGACCT
GTACAACTTCCAGCCTGACGATCTGAAGCCGGCGAGGCCGAGACGACAGTGGTGTTTAAACGTGATCATCGTTTAC
CTCGTCCTGCAGACCGGCCTGAACGCCTTCCTCATTTATAAAGTTTTCACGTTGGACTCATCGTCGTCGACCCTCG
GGGCTCAGAAGCAGACGTCCAATCACATGCCTCAGGGAGGAGAACCGAGCGGCGATGACACCCTCCAAACTCTCGT
CCGCAACAACAGTGAAGAAACCAAAACCCTGAGGGGTCAGCTGTGGGCGCTGGACAGCCAGGTCAAGAACCTCTGT
GCAGAGGAGGGTCAGCTGGGCAGGATGAGGTCTGACCTGAAGATGCTCAACTCAAGCGCCCGAAACCTGGAGGACA
AACTGATCAACCTCAAACAAGGACCTCCAGGTCCTCCGGGAAGAGACGGGCTTTCAGGACAGCCGGGCACACCTGG
AGACAGAGGCCTCAAAGGTGACATCGGTGACGCTGGCCCTCAAGGACTAAAGGGTGACAACGGACAACCCGGACAG
TCAGGAGCTCCGGGTCCCAGAGGACCACCTGGACCTGCAGGAGCCCCAGGGAATCAAGGACCAGGAGCTAAGGGAG
AGAAAGGAGCACCTGGGGGCCCAGGCCTTCCTGGACCCAAAGGTGACCCCGGCACCGCCGGGCAAAAAGGATCTTC
TGGATCTCAAGGTACCACTGGGCTACAAGGACAGAAAGCAGATTCTGGTCCACCGGGACCTCAAGGTGCATTGGGA
CCTCCTGGTGCCAAAGGAGATCAAGGTCCAGCTGGACCACCAGGTGCCAAAGCAGAGAGGGGAGACCAGGAAGCGA
ATGTGCGTCTCGTGCCGTCTGGATCCCGAGGCCGTGTGGAGGTGAAGGTAAACGGGGCCTGGGGCACCGTGTGTGA
CGACAACTTTGGCACCCCAGACGGCAAGGTGATCTGCAGGATGCTGGGCTTCCAGACCGCTACTGACACCTTCACT
GCCCCCCCAGGCACTGGAAAGATCTGGCTGGATGATCTGAAATGTACAGGAGCAGAGTTGGATATCATGGACTGCC
CACATCCTGGAGTCGGCGTCAACAACTGCCAACACAGCGAGGACGCCGGAGTGCAGTGCGCCTAG.The MARCO gene
Putting reading frame sequence overall length is 1218 bp, encodes 405 amino acid.
MARCO gene cloning includes the following steps:
1) Total RNAs extraction and detection
A) take the tissue sample of 30 mg in the centrifuge tube of 1.5mL；
B) 200 μ L Trizol Regent are added in centrifuge tube；
C) 800 μ L Trizol Regent are added in electricity consumption grinding rod after being quickly fully ground；
D) with liquid-transfering gun, pressure-vaccum is precipitated repeatedly, is made its resuspension, is placed at room temperature for 5min；
E) 200 μ L chloroforms are added, cover tightly centrifuge tube, is shaken with hand and acutely mixes 15s, be placed at room temperature for 10min；
F) under 4 DEG C of environment, 12000 × g is centrifuged 15min, and solution is made to be divided into upper, middle and lower-ranking；
G) upper strata aqueous phase solution is carefully drawn into another centrifuge tube, and 500 μ L isopropanols are added, mix gently；
H) mixed solution is placed in 30 min under -20 DEG C of environment；
I) under 4 DEG C of environment, 12000 × g is centrifuged 10min；
J) solution is discarded, 75% ethyl alcohol that 4 DEG C of 750 μ L pre-coolings are added is washed；
K) under 4 DEG C of environment, 12000 × g is centrifuged 10 min；
L) step 10 and 11 is repeated；
M) of short duration centrifugation after abandoning solution, exhausts residual liquid, sets in room temperature several minutes, thoroughly dry；
N) 30 μ L RNase free dd H are added in Xiang Shangshu RNA precipitate2O, slight mix make it dissolve.
By the total serum IgE of acquisition with 1.5% non-deformed agarose gel electrophoresis detection, and detect its concentration and A260/A280
Value, electrophoretogram is as shown in Figure 1, be shown as 3 bands: 28SrRNA, 18SrRNA, 5.8SrRNA, it was demonstrated that and RNA extraction is more complete,
A260/A280 value meets the requirements, and can carry out subsequent experimental；
2) synthesis of first chain of cDNA
Reverse transcription is carried out to extracted RNA, obtains corresponding the first chain of cDNA, inverts reaction system are as follows: 5.0 μ L template ribonucleic acids,
1.0 μ L Oligo (dT) mix centrifugation and are placed in PCR instrument, and amplification condition is 0 DEG C of 10min after 70 DEG C of 10min, take out of short duration
After centrifugation, by following systems be added: 6.0 μ L templates/primer mixed liquor (above walking product), 2.0 μ L 5 × M-MLV buffer,
0.5 μ L dNTP Mixture(10mM), 0.25 μ L RNase Inhibitor(40 μ/μ L), 0.25 μ L RaTase M-MLV
(200 μ/μ L), 1.0 μ L RNase free ddH2O, mixing, which is centrifuged, is placed on 40 DEG C of 1h in PCR instrument, 70 DEG C of 15min, and 0 DEG C
5min can be obtained the first chain of cDNA, while invert 3 parts, and completion is placed on -80 DEG C of ultra low temperature freezers and saves；
3) MARCO gene magnification and purifying
According to Larimichthys crocea genome database, complete scavenger receptor family gene is expanded by 5.0 software design of Primer
The primer of ORF clones MARCO gene using cDNA as template, after the reaction was completed PCR product by 1.2% Ago-Gel into
Row electrophoresis is examined, using DL2000 DNA marker as the molecular weight marker of standard, the DNA solution fine jade obtained through PCR reaction
Sepharose QIAquick Gel Extraction Kit (TIANGEN, China) is purified, the specific steps are as follows:
A) column equilibration: it is put into collecting pipe to adsorption column CA2(adsorption column) in, 500 μ L equilibrium liquid BL, 12000rpm centrifugations are added
1min outwells the waste liquid in collecting pipe, adsorption column is placed back in collecting pipe；
B) single target DNA band is cut into from Ago-Gel (excision redundance as far as possible), is put into clean centrifugation
Guan Zhong weighs weight；
C) 3 times of volume (0.1g is considered as 100 μ L) sol solutions PN are added into glue, about 10 min are placed in 50 DEG C of water-baths, therebetween constantly
Centrifuge tube is spun upside down, leniently to ensure that blob of viscose sufficiently dissolves；
D) upper step acquired solution is added in adsorption column CA2, is placed at room temperature for 2min, 12000rpm is centrifuged 1min.It can more than 800 μ L
It is added by several times, removes the waste liquid in collecting pipe, adsorption column CA2 is put into collecting pipe；
E) 600 μ L bleaching liquid PW, 12000rpm centrifugation 1min are added, outwells waste liquid, adsorption column CA2 is put into collecting pipe；
F) step 5 is repeated；
G) adsorption column is put back in pipe, 12000rpm is centrifuged 2min, eliminates rinsing liquid as far as possible, adsorption column CA2 is placed in room temperature and is put
It sets several minutes, thoroughly dries, to prevent remaining rinsing liquid from influencing the experiment of next step；
H) adsorption column is put into a clean centrifuge tube, 30 μ L elution buffers is vacantly added dropwise to adsorbed film middle position
EB is placed at room temperature for 2min
I) 12000rpm is centrifuged 2min, collects DNA solution, is placed in -20 DEG C of low temperature refrigerators and saves；
PCR product carries out electrophoresis inspection by 1.2% Ago-Gel after the completion of purifying, using DL2000 DNA marker as
The molecular weight marker of standard, should be suitable with the molecular weight of product before purification；；
4) T-A is cloned
Product after purification is subjected to T-A clone, first with connection reaction kit TaKaRa pMD18-T Vector
(TaKaRa, Japan) carries out the building of recombinant vector, linked system (10 μ L of total volume) are as follows: 5.0 μ L Solution I, 4.2 μ
L PCR product, 0.8 μ L TaKaRa pMD18-T Vector are added each substance by sequence in system on ice one by one, gently mix
16 DEG C of connections overnight, carry out heat-shock transformed, specific steps after even after the completion of connection are as follows:
A) competent cell DH5 α (TIANGEN, China) is taken, subglacial melts 5min, therebetween by the pipette tips of 100 μ L in refrigerator
(- 20 DEG C) pre-coolings of frost, finally 100 μ L DH5 α are added in 10 μ L connection products；
B) water-bath is opened, then 42 DEG C of heat shock 90s are immediately placed in and stand 3min on ice；
C) liquid (connection product+DH5 α) in PCR pipe is added and is free of ampicillin (Amp-) LB liquid medium in,
Then at 37 DEG C with 180rpm shaken cultivation 1-2h；
D) during the cultivation process, 40 μ L(20mg/ml) X-Gal and 7 μ L(200mg/ml) IPTG is uniformly coated on Amp+LB is solid
On body plate, fully absorb it；
E) after shake culture, bacterium solution is centrifuged 5min with 4000rpm, removes most of supernatant, draw 130 μ L bacterium solutions in
The ready Amp of step 4+On LB solid plate, even spread, and mark；
F) 37 DEG C of overnight incubations are placed in
(all of above operation carries out in superclean bench)
Plate, which is put in 37 DEG C of constant incubators after overnight incubation, may occur in which bacterium colony, and the plate after culture is placed in again at 4 DEG C
1h, with sterile toothpick, picking white single colonie (particular number is according to bacterium colony practical on plate determination) in each plate, is placed in
Equipped with 800 μ L Amp+LB liquid medium EP pipe in, number, then in 37 DEG C of shaking tables with 180rpm shaken cultivation about 6h.
With 18T plasmid vector universal primer M13R:5'-CGCCAGGGTTTTCCCAGTCACGAC-3' and M13F:5'-
AGCGGATAACAATTTCA CACAGGA-3' carries out bacterium solution PCR amplification, 10 μ L reaction systems as the PCR primer reacted are as follows:
5.0 μ L ExTaq(TaKaRa, 1.0 μ L bacterium solutions, 0.3 μ L M13F, 0.3 μ L M13R, 3.4 μ L ddH2O mixes centrifugation and is placed on
In PCR instrument.Amplification condition is 95 DEG C of initial denaturation 4min；94 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of 2 min of extension, circulation 35
It is secondary；Last 72 DEG C of extensions 7min.After the reaction was completed using DL2000 DNA marker as the molecular weight marker of standard, 1.2% fine jade
Recon containing suitable fragments size is served extra large Invitrogen biotech firm and carried out by sepharose electrophoresis detection PCR product
DNA sequence dna sequencing.
Above-mentioned Total RNAs extraction is extracted using Trizol Regent, phosphoguanidine and thiocarbamide, is contained in Trizol Regent
There are 0.03% phosphoguanidine and 0.01% thiocarbamide.Trizol Regent, phosphoguanidine and thiocarbamide can play gain effect, on the one hand may be used
Tissue is rapidly permeated into, endogenous RNA enzyme is inactivated, the degradation of RNA will not be caused, convenient for the subsequent extracted of RNA, and is had extremely strong
Cracking ability lytic cell and tissue samples, the protein that cell can be made to release can be denaturalized rapidly in a short time
And the RNA enzyme activity for inhibiting cell to release, effectively inhibit the degradation of RNA in sample, keeps the integrality of RNA；On the other hand
It assists the substances such as the protein of denaturation to be dissolved in the chloroform of subsequent addition, RNA is quickly distributed in upper strata aqueous phase, improve
The yield and purity of total serum IgE.
Said gene amplification primers are as follows:
MARCO-F:5'-ATGGAGACGTAGGTGGAGGGCACC-3'；
MARCO-R:5'-CTAGGAGCCCTCCAGTGCCGG-3'.
Above-mentioned amplification reaction system are as follows: 2.5 μ L 10 × PCR Buffer, 0.4 μ L dNTPs, 0.8 μ L MARCO-F, 0.8
μ L MARCO-R, 0.6 μ L Template cDNA, 0.4 μ L Taq DNA polymerase(TaKaRa), 14.5 μ L RNase
free dd H2O；Amplification condition are as follows: 95 DEG C of initial denaturation 4min；94 DEG C of denaturation 30s, 55-65 DEG C of annealing 30s, 72 DEG C extend
2min is recycled 35 times；Last 72 DEG C of extensions 10min.
The purposes of above-mentioned Larimichthys crocea scavenger receptor gene M ARCO gene, MARCO gene is in Larimichthys crocea immune defense function
In purposes.
Embodiment 2:
Larimichthys crocea scavenger receptor gene M ARCO gene, MARCO gene are obtained using homologous clone method and RACE technology clone,
The MARCO gene cDNA sequence overall length 8275bp.
MARCO gene cloning includes the following steps:
1) Total RNAs extraction and detection；
2) synthesis of first chain of cDNA；
3) MARCO gene magnification and purifying；
4) T-A is cloned.
Total RNAs extraction is extracted using Trizol Regent, phosphoguanidine and thiocarbamide, is contained in Trizol Regent
0.035% phosphoguanidine and 0.015% thiocarbamide.
Primer set for amplification are as follows:
MARCO-F:5'-ATGGAGACGTAGGTGGAGGGCACC-3'；
MARCO-R:5'-CTAGGAGCCCTCCAGTGCCGG-3'.
Amplification reaction system are as follows: 2.5 μ L 10 × PCR Buffer, 0.4 μ L dNTPs, 0.8 μ L MARCO-F, 0.8 μ L
MARCO-R, 0.6 μ L Template cDNA, 0.4 μ L Taq DNA polymerase(TaKaRa), 14.5 μ L RNase
free dd H2O, amplification condition are as follows: 95 DEG C of initial denaturation 4min；94 DEG C of denaturation 30s, 55-65 DEG C of annealing 30s, 72 DEG C extend 2
Min is recycled 35 times；Last 72 DEG C of extensions 10min.
The purposes of above-mentioned Larimichthys crocea scavenger receptor gene M ARCO gene, MARCO gene is in Larimichthys crocea immune defense function
In purposes.
Embodiment 3:
Larimichthys crocea scavenger receptor gene M ARCO gene, MARCO gene are obtained using homologous clone method and RACE technology clone,
The MARCO gene cDNA sequence overall length 8275bp.
MARCO gene cloning includes the following steps:
1) Total RNAs extraction and detection；
2) synthesis of first chain of cDNA；
3) MARCO gene magnification and purifying；
4) T-A is cloned.
Total RNAs extraction is extracted using Trizol Regent, phosphoguanidine and thiocarbamide, is contained in Trizol Regent
0.04% phosphoguanidine and 0.02% thiocarbamide.
Primer set for amplification are as follows:
MARCO-F:5'-ATGGAGACGTAGGTGGAGGGCACC-3'；
MARCO-R:5'-CTAGGAGCCCTCCAGTGCCGG-3'.
Amplification reaction system are as follows: 2.5 μ L 10 × PCR Buffer, 0.4 μ L dNTPs, 0.8 μ L MARCO-F, 0.8 μ L
MARCO-R, 0.6 μ L Template cDNA, 0.4 μ L Taq DNA polymerase(TaKaRa), 14.5 μ L RNase
free dd H2O, amplification condition are as follows: 95 DEG C of initial denaturation 4min；94 DEG C of denaturation 30s, 55-65 DEG C of annealing 30s, 72 DEG C extend 2
Min is recycled 35 times；Last 72 DEG C of extensions 10min.
The purposes of above-mentioned Larimichthys crocea scavenger receptor gene M ARCO gene, MARCO gene is in Larimichthys crocea immune defense function
In purposes.
Embodiment 4:
The immune defense function of Larimichthys crocea scavenger receptor gene M ARCO gene
Experiment Larimichthys crocea (body long 20-30cm, weight 350-400g) is derived from Zhoushan Of Zhejiang Province Dong Ji farm, in 25 DEG C of clean seawater
In temporarily support 1 week, change fresh seawater daily.Larimichthys crocea is then randomly divided into 2 groups, every group 30, wherein experimental group is injected intraperitoneally
Vibrio anguillarum bacterium solution (the pH 7.4,1 × 10 that 100 μ L PBS are resuspended8CFU/mL), control group injects 100 μ L PBS(pH 7.4).It receives
Collection injection after 0h, 2h, 6h, 12h, for 24 hours, the liver organization of 48h, 72h extract total serum IgE.Each base of Larimichthys crocea scavenger receptor family
Because of result such as Fig. 2 of mRNA expression quantity of 0,6,12,24,48 and 72h and control group after infecting vibrio alginolyticus.MARCO gene
There are high expression quantity, and expression quantity highest when for 24 hours in 24-72h.
Routine operation in operation of the present invention step is well known to those skilled in the art, herein without repeating.
Technical solution of the present invention is described in detail in embodiment described above, it should be understood that the above is only
For specific embodiments of the present invention, it is not intended to restrict the invention, all any modifications made in spirit of the invention,
Supplement or similar fashion substitution etc., should all be included in the protection scope of the present invention.
Sequence table
<110>Zhejiang Ocean university
<120>Larimichthys crocea scavenger receptor gene M ARCO gene and its immune defense function
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1218
<212> DNA
<213>Larimichthys crocea (Larimichthys crocea)
<400> 1
atggagacgt cggtggaccg caccaacaac cgagtctcgt acacgcagag taacccgctg 60
ttcgacatgt cgctcagcag gactgacctg tacaacttcc agcctgacga tctgaagccg 120
gcgaggccga gacgacagtg gtgtttaaac gtgatcatcg tttacctcgt cctgcagacc 180
ggcctgaacg ccttcctcat ttataaagtt ttcacgttgg actcatcgtc gtcgaccctc 240
ggggctcaga agcagacgtc caatcacatg cctcagggag gagaaccgag cggcgatgac 300
accctccaaa ctctcgtccg caacaacagt gaagaaacca aaaccctgag gggtcagctg 360
tgggcgctgg acagccaggt caagaacctc tgtgcagagg agggtcagct gggcaggatg 420
aggtctgacc tgaagatgct caactcaagc gcccgaaacc tggaggacaa actgatcaac 480
ctcaaacaag gacctccagg tcctccggga agagacgggc tttcaggaca gccgggcaca 540
cctggagaca gaggcctcaa aggtgacatc ggtgacgctg gccctcaagg actaaagggt 600
gacaacggac aacccggaca gtcaggagct ccgggtccca gaggaccacc tggacctgca 660
ggagccccag ggaatcaagg accaggagct aagggagaga aaggagcacc tgggggccca 720
ggccttcctg gacccaaagg tgaccccggc accgccgggc aaaaaggatc ttctggatct 780
caaggtacca ctgggctaca aggacagaaa gcagattctg gtccaccggg acctcaaggt 840
gcattgggac ctcctggtgc caaaggagat caaggtccag ctggaccacc aggtgccaaa 900
gcagagaggg gagaccagga agcgaatgtg cgtctcgtgc cgtctggatc ccgaggccgt 960
gtggaggtga aggtaaacgg ggcctggggc accgtgtgtg acgacaactt tggcacccca 1020
gacggcaagg tgatctgcag gatgctgggc ttccagaccg ctactgacac cttcactgcc 1080
cccccaggca ctggaaagat ctggctggat gatctgaaat gtacaggagc agagttggat 1140
atcatggact gcccacatcc tggagtcggc gtcaacaact gccaacacag cgaggacgcc 1200
ggagtgcagt gcgcctag
<210> 2
<211> 24
<212> DNA
<213>primer (Artificial Sequence)
<400> 2
atggagacgt aggtggaggg cacc 24
<210> 3
<211> 24
<212> DNA
<213>primer (Artificial Sequence)
<400> 3
atggagacgt aggtggaggg cacc 24
Claims (9)
1. Larimichthys crocea scavenger receptor gene M ARCO gene, it is characterised in that: the MARCO gene open reading frame sequence is adopted
It is obtained with homologous clone method and RACE technology clone, the MARCO gene open reading frame sequence is as shown in SEQ ID NO:1.
2. Larimichthys crocea scavenger receptor gene M ARCO gene according to claim 1, it is characterised in that: the MARCO
It is 1218 bp that gene, which puts reading frame sequence overall length, encodes 405 amino acid.
3. Larimichthys crocea scavenger receptor gene M ARCO gene according to claim 1, it is characterised in that: the MARCO base
Because clone includes the following steps:
The cDNA synthesized using the total serum IgE reverse transcription of extraction is template amplification MARCO genetic fragment, purifying；
Amplified production after purification is subjected to T-A clone, is sequenced to get MARCO gene.
4. Larimichthys crocea scavenger receptor gene M ARCO gene according to claim 2, it is characterised in that: the gene expands
Add primer are as follows:
MARCO-F:5'-ATGGAGACGTAGGTGGAGGGCACC-3'；
MARCO-R:5'-CTAGGAGCCCTCCAGTGCCGG-3'.
5. Larimichthys crocea scavenger receptor gene M ARCO gene according to claim 2, it is characterised in that: the amplification is anti-
Answer system are as follows: 2.5 μ L 10 × PCR Buffer, 0.4 μ L dNTPs, 0.8 μ L MARCO-F, 0.8 μ L MARCO-R, 0.6 μ L
Template cDNA, 0.4 μ L Taq DNA polymerase(TaKaRa), 14.5 μ L RNase free dd H2O。
6. Larimichthys crocea scavenger receptor gene M ARCO gene according to claim 2, it is characterised in that: the amplification item
Part are as follows: 95 DEG C of initial denaturation 4min；94 DEG C of denaturation 30s, 55-65 DEG C of annealing 30s, 72 DEG C of 2 min of extension are recycled 35 times；Last 72
DEG C extend 10min.
7. Larimichthys crocea scavenger receptor gene M ARCO gene according to claim 2, it is characterised in that: the total serum IgE
It extracts and is extracted using Trizol Regent, phosphoguanidine and thiocarbamide.
8. Larimichthys crocea scavenger receptor gene M ARCO gene according to claim 8, it is characterised in that: the Trizol
Contain 0.03-0.04% phosphoguanidine and 0.01-0.02% thiocarbamide in Regent.
9. the purposes of the described in any item Larimichthys crocea scavenger receptor gene M ARCO genes of claim 1-8, it is characterised in that:
Purposes of the MARCO gene in Larimichthys crocea immune defense function；The immune defense function includes adjusting congenital immunity dimension
Protect the health and evolution of body.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811123807.9A CN109486826A (en) | 2018-09-26 | 2018-09-26 | Larimichthys crocea scavenger receptor gene M ARCO gene and its immune defense function |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811123807.9A CN109486826A (en) | 2018-09-26 | 2018-09-26 | Larimichthys crocea scavenger receptor gene M ARCO gene and its immune defense function |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109486826A true CN109486826A (en) | 2019-03-19 |
Family
ID=65689954
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811123807.9A Pending CN109486826A (en) | 2018-09-26 | 2018-09-26 | Larimichthys crocea scavenger receptor gene M ARCO gene and its immune defense function |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109486826A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110358771A (en) * | 2019-08-15 | 2019-10-22 | 浙江海洋大学 | Larimichthys crocea scavenger receptor SCARA3 gene and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107586327A (en) * | 2017-11-02 | 2018-01-16 | 浙江海洋大学 | Tiger spot cuttlefish neuropeptide FMRFamide genital regulating agent |
| CN109295172A (en) * | 2018-09-26 | 2019-02-01 | 浙江海洋大学 | The codon preference analysis method of Larimichthys crocea scavenger receptor family gene |
| CN110358771A (en) * | 2019-08-15 | 2019-10-22 | 浙江海洋大学 | Larimichthys crocea scavenger receptor SCARA3 gene and application thereof |
-
2018
- 2018-09-26 CN CN201811123807.9A patent/CN109486826A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107586327A (en) * | 2017-11-02 | 2018-01-16 | 浙江海洋大学 | Tiger spot cuttlefish neuropeptide FMRFamide genital regulating agent |
| CN109295172A (en) * | 2018-09-26 | 2019-02-01 | 浙江海洋大学 | The codon preference analysis method of Larimichthys crocea scavenger receptor family gene |
| CN110358771A (en) * | 2019-08-15 | 2019-10-22 | 浙江海洋大学 | Larimichthys crocea scavenger receptor SCARA3 gene and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| HE J 等: "Larimichthys crocea macrophage receptor with collagenous structure (marco), mRNA", 《GENBANK DATABASE》 * |
| JIANYU HE 等: "Identification of SCARA3, SCARA5 and MARCO of class A scavenger receptor-like family in Pseudosciaena crocea", 《FISH & SHELLFISH IMMUNOLOGY》 * |
| 何建瑜 等: "大黄鱼清道夫受体A家族基因的鉴定及其抗溶藻弧菌感染的分子机制研究", 《2014年全国海水养殖学术研讨会论文集》 * |
| 何建瑜: "大黄鱼清道夫受体家族基因鉴定及表达分析", 《中国优秀硕士学位论文全文数据库（电子期刊）农业科技辑》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110358771A (en) * | 2019-08-15 | 2019-10-22 | 浙江海洋大学 | Larimichthys crocea scavenger receptor SCARA3 gene and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2270227T3 (en) | MET-1 CORN PROMOTER. | |
| CN109912699B (en) | Phytophthora camphora effector protein Avh87 and encoding gene and application thereof | |
| CN107760663A (en) | The clone of chufa pepc genes and structure and the application of expression vector | |
| CN106086229A (en) | Molecular marker that chicken growth traits is relevant and discrimination method thereof and application | |
| CN108192898B (en) | The whole genome sequence and its amplimer of Seneca Valley virus SVV/CH/ZZ/2016 | |
| CN107653260A (en) | A kind of preparation method and application of Recombinant Lactococcus lactis | |
| CN106609267A (en) | Application of cucumber CsTTG1 gene to regulating of development of plant epidermal hair, fruit thorns and thorn galls | |
| CN110358771A (en) | Larimichthys crocea scavenger receptor SCARA3 gene and application thereof | |
| CN107365778A (en) | Regulate and control transcription factor gene and its application of lutein synthesis | |
| CN109486826A (en) | Larimichthys crocea scavenger receptor gene M ARCO gene and its immune defense function | |
| Qiao et al. | Identification and molecular characterization of Cathepsin L gene and its expression analysis during early ontogenetic development of kuruma shrimp Marsupenaeus japonicus | |
| CN1710076A (en) | Use of boea crassifolia BcBCP1 gene for breeding drought-salt-tolerant plants | |
| CN109400690A (en) | The recombination bursicon albumen for promoting rice shrimp antibacterial peptide to increase and its application | |
| CN102533775A (en) | Full-length complementary deoxyribonucleic acid (cDNA) sequence of Paralichthys olivaceus pattern recognition Toll-like receptor TLR21 and applications thereof | |
| CN101693739A (en) | Chlorogenic acid synthesis associated protein and encoding gene thereof and application | |
| CN109868277A (en) | Sepiella maindroni Toll-like receptor gene and its immune defense function | |
| CN102242134A (en) | Cloning of soybean GmSGT (Glycine max serine glyoxylate aminotransferase) gene and 5' UTR (Untranslated Regions) thereof and application thereof | |
| CN108841793A (en) | Anti- duck Mx-A monoclonal antibody and its detection duck Mx albumen application | |
| CN109942705B (en) | MSTN nano antibody, construction method and application thereof | |
| CN108659108B (en) | NAC transcription factor related to hardening of golden pear fruit tops | |
| CN102021188A (en) | Artemisia sphaerocephala delta 12 fatty acid desaturase (As FAD2) gene and application | |
| Meng et al. | pik3r3b, a novel immune-related gene in Nile tilapia (Oreochromis niloticus): Identification, expression and analysis of antibacterial activity | |
| CN111484960A (en) | Novel Edwardsiella attenuated target spot and application thereof | |
| CN105039350B (en) | The cDNA full length sequences of lefteye flounder pattern recognition receptors TLR8 and its application | |
| CN109608535A (en) | A kind of the chicken alpha interferon peptide chain and its recombinant expression engineered strain of optimization |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190319 |