CN109481676A - A kind of preparation method of magnetic Nano photosensitizer composite system - Google Patents
A kind of preparation method of magnetic Nano photosensitizer composite system Download PDFInfo
- Publication number
- CN109481676A CN109481676A CN201811202035.8A CN201811202035A CN109481676A CN 109481676 A CN109481676 A CN 109481676A CN 201811202035 A CN201811202035 A CN 201811202035A CN 109481676 A CN109481676 A CN 109481676A
- Authority
- CN
- China
- Prior art keywords
- photosensitizer
- magnetic
- preparation
- cell
- cdte
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K41/00—Medicinal preparations obtained by treating materials with wave energy or particle radiation ; Therapies using these preparations
- A61K41/0057—Photodynamic therapy with a photosensitizer, i.e. agent able to produce reactive oxygen species upon exposure to light or radiation, e.g. UV or visible light; photocleavage of nucleic acids with an agent
- A61K41/0071—PDT with porphyrins having exactly 20 ring atoms, i.e. based on the non-expanded tetrapyrrolic ring system, e.g. bacteriochlorin, chlorin-e6, or phthalocyanines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K41/00—Medicinal preparations obtained by treating materials with wave energy or particle radiation ; Therapies using these preparations
- A61K41/0052—Thermotherapy; Hyperthermia; Magnetic induction; Induction heating therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention is a kind of preparation method of magnetic Nano photosensitizer composite system, and this method is to prepare Fe3O4Magnetic nanoparticle obtains magnetic Nano Photosensitizer particles Fe using the suction-operated of silica circle hole microballoon in surface-mounted quantum dot CdTe and photosensitizer in its surface cladding a thin layer silica using ethyl orthosilicate as modifying agent3O4@SiO2@Qdots/PS.The present invention can be using tumor cell specific bioluminescence as light source, and photosensitizer, which is excited, generates reactive oxygen species, and thermal energy can be converted electrical energy into alternating electric field, is a kind of novel and multifunctional photosensitizer.
Description
Technical field
The invention belongs to genetic engineering fields, and in particular to a kind of photosensitive composite system preparation method of magnetic Nano and answer
With.
Background technique
Photodynamic therapy (Photodynamic therapy, PDT) irradiates photosensitizer, quilt using the light source of certain wavelength
Photosensitizer and the oxygen molecule effect of excitation generate the reactive oxygen species (reactive based on singlet oxygen (singlet oxygen)
Oxygen species, ROS), to generate toxic effect to cell.Photodynamic therapy is a kind of effective, Noninvasive
Oncotherapy means.But enter in more than 30 years of clinical application at it, photodynamic therapy can't be tumour always and control
The main means (other than superficial cutaneum carcinoma) for the treatment of, as just palliative treatment or the auxiliary of other treatment methods, mainly
The adverse reaction that reason is the limitation of its treatment and gradually appears.No matter laser direct irradiation or optical fiber is used,
Exciting light all exists in tumor tissues to be unevenly distributed, and most photosensitizers also lack tumour-specific, therefore PDT is most common simultaneously
Hair disease is the perforation and therapeutic atrophy of hollow viscera.Due to being limited by internal penetration depth, external source irradiation light is difficult
The deep tissue of intelligent's body, so PDT is difficult to the treatment of deep tumor.
In order to solve the problems, such as excitation line, penetration depth is limited in the tissue and is unevenly distributed, current many basic research
Person is attempting the side by fluorescence resonance energy transfer (fluorescence resonance energy transfer, FRET)
Formula makes photosensitizer be excited indirectly.Fluorescence resonance energy transfer refers to that two fluorescence chromophoric groups are sufficiently closing to and (are being less than 10nm)
And when spectrum coincidence, it is excited to higher electron energy state after the photon of donor molecule absorption certain frequency, is returned in the electronics
Before ground state, by dipole-dipole interaction, energy is realized to neighbouring acceptor molecule transfer (i.e. generation resonance energy transfer).
Have many document reports, photosensitizer is connect with another fluorescent material, receptor of the photosensitizer as energy is in combination
Donor of the fluorescent material as energy, by exciting photosensitizer of the fluorescent material indirect activation as donor as receptor, from
And photodynamic effect is generated, deep tumor is treated in a manner of FRET.Donor fluorescent substance in these researchs has carbon to receive
Meter Dian, up-conversion luminescent material, ester soluble cyanine dye and quantum dot etc., they can be swashed by longer wavelengths of exciting light
Hair, it is possible to greatly improve the tissue penetration depths of excitation line.In addition, photosensitizer by and nanoparticle combination,
Its distributed density in tumor tissues can be improved, to improve the targeting for the treatment of.
But these photodynamic treatments still need the excitation of external source light, if intracellular generation can be used
Endogenous light excite photosensitizer, then the photodynamic therapy of any depth, any region tumors may be implemented.Early in last
The nineties in century, researcher begin to attempt energy or chemiluminescent energy using bioluminescence as interior irradiation
Light source, Lai Jifa photosensitizer generate photodynamic effect.1994, Carpenter et al. reported them and uses bioluminescence
Energy directly activate photosensitizer hypericin (Hypericin) for treating the research achievement of antiviral therapy.In 2003,
The report such as Theodossiou, the bioluminescence that the luciferase generated with cellular endogenous issues can directly activate photosensitizer
Diiodocosin (Rose benga) generates photodynamic effect to cell.But their research is but by American scholar
The query of doctor Schipper, he is in report in 2006 with a large amount of experiment results proved, the luminous energy of intracellular biological
Amount is not sufficient to by way of radiation directly activate photosensitizer diiodocosin or hypericin, and it is dynamic cannot to generate light to cell
Mechanics effect.Hereafter in time many years, few researchers set foot in be led using the research of bioluminescence energy activation photosensitizer
Domain, this implement the imagination for not depending on external source exciting light progress photodynamic therapy can not.
Until 2012, just there is the report fluorescent material cationic oligomer styrene support such as Yuan (cationic oligo
Phenylene vinylene, OPV) can bioluminescence energy shift by way of (bioluminescence
Resonance energy transfer, BRET) it is activated, photodynamic effect is generated for antitumor and antimycotic control
It treats.2013, Hsu etc. reported a kind of method that spontaneous light-initiated photodynamic effect is used for oncotherapy, in its research,
Protein renilla luciferase and quantum dot QD655 carry out covalent bond and form nano particle (QD-Rlu8), then with contain light
The colloid Shu Yitong of quick dose of Temoporfin (Foscan) is swallowed by tumour cell, is added after substrate coelenterazine, is detected cell
Interior generation active oxygen, and the oncotherapy effect of photodynamics generation is demonstrated by inside and outside inhibition test, researcher points out,
Colloid beam due to QD-Rlu8 and containing photosensitizer has very big chance during cell swallows jointly and is stored in same
In phagosome, distance is many less than the chance of 10nm therebetween, therefore, can generate FRET effect, be added after coelenterazine,
The energy of bioluminescence passes to quantum dot by BRET, passes to photosensitizer further through FRET, it is achieved that not depending on outer
The photodynamic therapy effect of source excitation light.2014, Zhang etc. reported him on " analytical chemistry " again
Using chemiluminescence activation photosensitizer result of study, with coincidence spectrum photosensitizer and semi-conductor luminescent material it is hydrophobic
Nanometer corpusculum is formed after matrix package, surface connects horseradish peroxidase, and substrate luminol is added and generates chemiluminescence later
Resonance energy transfer (chemiluminescenc resonance energy transfer, CRET) activates fluorescent material, again
Photosensitizer is activated by FRET, the photodynamic therapy of bioluminescence energy excitation is realized in resonance energy transfer twice.It is above this
The common feature studied a bit is to excite photosensitizer indirectly by the continuous energy transfer mode of BRET (CRET)-FRET, thus sharp
Photodynamic effect is generated with endogenic bioluminescence (or chemiluminescence).But in these researchs, as PDT energy
The bioluminescence in source does not have tissue specificity, and main restraining factors are, in order to meet resonance energy transfer
Condition, the luciferase for generating bioluminescence usually require to be combined together in a manner of covalent bond with the receptor of energy, without
It can be expressed in specifically inside tumor cell.If can be made by the regulation in gene transcription level as the glimmering of the endogenous irradiation light of PDT
Light element enzyme is only expressed in liver cancer cells, then may be implemented not need external source exciting light, it is without tissue depth limitation, have
The photodynamic therapy of height hepatoma targeting character is achieved.
Summary of the invention
Technical problem: the present invention provide it is a kind of using the bioluminescence of cell internal specific as interior radiation source, to swollen
Tumor carries out the preparation method that photodynamic therapy combines the magnetic Nano photosensitizer composite system of Magnetic Fluid Hyperthermia simultaneously.
Technical solution: the present invention be based on composite magnetic nano particle, using intracellular specific biological shine into
Irradiation in row carries out photodynamic therapy to tumour, while combining the therapeutic scheme of Magnetic Fluid Hyperthermia.
The preparation method of magnetic Nano photosensitizer composite system of the invention, includes the following steps:
(1) Fe is prepared304Magnetic nanoparticle: by FeCl3And FeCl2It is placed in pure water reaction system, 50 DEG C, pH 9.5
± 0.1, N2Protection lower reaction 30 minutes, obtain Fe3O4Magnetic nanoparticle；
(2) ethyl orthosilicate MODIFIED Fe3O4: by Fe3O4Magnetic nanoparticle and pure water are with the mixing of mass ratio 1: 200, ultrasound
It is dispersed into colloidal solution, addition accounts for the ammonium hydroxide of reaction system volume 1/100 and accounts for the positive silicic acid second of reaction system volume 1/100
Ester, 50 DEG C are stirred to react 12 hours, in magnetic nanoparticle Surface Creation layer of silicon dioxide, obtain Fe3O4@SiO2；
(3) preparation of CdTe quantum particle: it is being passed through N2Under conditions of gas, by sodium borohydride: tellurium: pure water mixing, ice
Bath reaction is completely disappeared to black Te powder, and obtained upper layer lavender transparency liquid is sodium hydrogen telluride；PH's 9.0 ± 0.1
In pure water reaction system, N2Under magnetic agitation, CdCl is added using mercaptopropionic acid as stabilizer in protection2And sodium hydrogen telluride, heating
To 100 DEG C, N is passed through into reaction system2100 DEG C of gas and holding, magnetic agitation react 16 to 18 hours, obtain red water
Dissolubility CdTe colloidal solution；
(4)Fe3O4@SiO2The preparation of@Qdots/PS: dihematoporphyrin ethers aqueous solution and CdTe colloidal solution are mixed, stirring
Under add to dropwise concentration be 0.1mg/ml Fe3O4@SiO2In solution, wherein dihematoporphyrin ethers: CdTe: Fe3O4@SiO2Mass ratio
It is 1: 1: 1, is continually fed into N2Gas is stirred to react overnight at room temperature, and ultracentrifugation precipitation nano particle, pure water is washed after suspending again
It washs for several times, obtains Fe3O4@SiO2@Qdots/PS magnetic Nano photosensitizer.
Further, in the method for the present invention, FeCl in the step (1)3And FeCl2Mass ratio is 5: 3.
Further, in the method for the present invention, sodium borohydride in the step (3): tellurium: pure water is according to molar ratio 2: 1: 0.5
Mixing.
Further, in the method for the present invention, after being warming up to 100 DEG C in the step (3), the vapor that reaction generates is led to
Cross condenser pipe condensation reflux.
Further, in the method for the present invention, sodium hydrogen telluride in the step step (3): Cd2+: the molar ratio of mercaptopropionic acid
It is 0.5: 1: 2.4.
Further, in the method for the present invention, dihematoporphyrin ethers in dihematoporphyrin ethers aqueous solution in the step (4): pure water
Mass ratio is 1: 10, CdTe in the CdTe colloidal solution: pure water mass ratio is 1: 10, the mass ratio of dihematoporphyrin ethers and CdTe
It is 1: 1.
(1)Fe3O4@SiO2The preparation of@Qdots/PS composite nanometer particle: coprecipitation prepares Fe 3 O 4 magnetic and receives
Rice grain Fe3O4, on its surface, cladding a thin layer silica forms Fe3O4@SiO2；Select launch wavelength for the quantum of 630nm
The photosensitizer dihematoporphyrin ethers (PS) that point (Qdots) and absorbing wavelength are 630nm, are assemblied in Fe by suction-operated3O4@SiO2
The reason salt water dissolution of photosensitizer dihematoporphyrin ethers is configured to 0.1mg/ml by surface, mixed with CdTe colloidal solution (0.1mg/ml)
It closes, is slowly dropped into Fe3O4@SiO2In (0.1mg/ml) solution, it is passed through N2Gas is stirred to react overnight at room temperature, and 1 × 106Rpm hypervelocity
Centrifugation Fe3O4@SiO2@Qdots/PS nano particle, pure water wash for several times after suspending again.
(2) interior irradiation photodynamic therapy is carried out to it using tumor cell specific bioluminescence: with molecular biosciences
Development, massive tumor specificity promoter is found, glimmering using afp promoter guidance downstream worm by taking liver cancer as an example
The expression of light element enzyme gene constructs recombination pAFP-luc, and after transfection tumor cell, composite nanometer particle is with 1mg/ml concentration
It is incubated overnight altogether with transfection cell, substrate luciferin is added, cell generates specific biological and shines, and quantum is excited in a manner of FUEL
Point generates ROS then by the photosensitizer in FRET excitation nano particle, carries out photodynamic therapy to cell.
(3) combine Magnetic Fluid Hyperthermia: cell (animal) being placed in alternating magnetic field, the magnetic core of nano particle is in magnetic field
In be warming up to 41 DEG C or more, to tumour carry out Magnetic Fluid Hyperthermia, with photodynamic therapy Synergistic killing tumour cell.
Photosensitizer and magnetic-particle building in same nanometer system, are utilized intracellular spontaneous light energy by the method for the present invention
It excites photosensitizer to generate reactive oxygen species, and can controllably heat up in alternating magnetic field.In the present invention, irradiation in specificity is realized
The solution of two critical issues, first, luciferase gene is in the specific expressed of liver cancer cells, with alpha-fetoprotein
(alpha-fetoprotein, AFP) promoter guides luciferase gene (luciferase) targeting in downstream thin in liver cancer
Intracellular expression；Second, the luciferase of cell inner expression can excite photosensitizer.Quantum dot is not needed to be limited to it by fluorescence excitation
The distance between light donor can be excited by the energy radiation mode of macroscopic view, that is, " uncombined bioluminescence excitation is glimmering
Light " (fluorescence by unbound excitation from luminescence, FUEL).Select launch wavelength with
The quantum dot and photosensitizer of excitation wavelength overlapping construct nano particle, in the particle that partial size is 50nm or so, there is foot between the two
Enough chances meet the condition of the distance less than 10nm, to meet the condition excitation photosensitizer of FRET, to realize using thin
Specific biological intracellular shines and carries out photodynamic therapy to tumour as interior irradiation energy.The present invention utilizes magnetic nanoparticle
As core, tumour cell Magnetic Fluid Hyperthermia can be carried out while photodynamic therapy, the two plays synergistic effect and reinforces
To the lethal effect of tumour cell.
The utility model has the advantages that compared with prior art, the present invention having the advantage that
Better tissue specificity: the basis of optical dynamic therapy is photodynamic effect, is that a kind of oxygen molecule participates in
With the Photosensitive reaction of biological effect, photosensitizer, light irradiation and oxygen molecule constitute the three elements of photodynamic effect.Make tumor group
Tri-state oxygen in knitting becomes a large amount of toxic singlet oxygen, hydroxyl groups and peroxy radicals etc., causes cell Mitochondria, lysosome
The swelling of equal organelles and the destruction of nuclear membrane, cell membrane, lead to death of neoplastic cells, thus reach treatment and control tumour into
The purpose of exhibition.But photodynamic therapy also has significant limitation, mainly shows first: currently used photosensitizer
Mainly derivatives of porphyrin, these molecules lack targeting to tumor tissues, are difficult to be enriched in lesion and reach effective concentration, influence
Therapeutic effect；Second: photosensitizer molecule is mostly hydrophobic molecule, easy to reunite, is not easy to be transferred to lesion in vivo；Third: theoretical
Upper photodynamic therapy is suitable for the treatment of all tumours, but it is swollen to be currently used primarily in Superficial Malignant Tumours, the cancer of the esophagus, gastrointestinal tract
The treatment of tumor, mouth neoplasm, bladder cancer etc..This is primarily due to be that photosensitizer could generate light under conditions of absorbing visible light dynamic
Mechanics effect, and visible light is poor in the penetration capacity of tissue, treatment cannot be deep into organization internal, be confined to epidermis more
Or the tumor locus of shallow tissue regions；4th: the treatment light of photodynamics exists in tissue and cell to be unevenly distributed, i.e.,
Using optical fiber can not it is point-device control photodynamic therapy range, be easy to cause the therapeutic of hollow viscera
Perforation and atrophy.The above disadvantage significantly limits application of the photodynamic therapy in oncotherapy.And the present invention is logical
It crosses by quantum dot and photosensitizer preparation in nanoparticle, using quantum dot as intermediate medium, by self-luminous in tumour cell
Energy is transmitted by way of FUEL-FRET, excites photosensitizer.Killing is not generated for the cell of not bioluminescence to make
With avoiding the side effect of many tradition PDT, and do not limited by tissue depth, any depth, any position may be implemented
The photodynamic therapy of tumour.
Optical dynamic therapy combines Magnetic Fluid Hyperthermia, has Synergistic killing effect, improves the validity of oncotherapy.Light is dynamic
The effect of mechanics treatment largely additionally depends on the oxygen molecule concentration in tissue, and since tumor cell proliferation is too fast,
Tumor neogenetic blood vessels structure disturbance, blood supply cannot meet the needs in knurl, and most entity tumor diameters are more than 2mm (including liver cancer
It is interior) it would be at anaerobic condition, cause PDT curative effect to decline.Crossing heat therapy (Hyperthermia) can be improved local blood supply, mentions
High vasopermeability promotes absorption of the tissue to oxygen molecule to increase the curative effect of PDT, thermotherapy so as to improve the anoxia state of tumour
Joint photodynamic therapy will generate synergistic effect to the inhibition of tumour.Magnetic nanoparticle (magnetic
Nanoparticles, MNPs) it can be carried out controllably outside plus in alternating magnetic field (alternating magnetic field, AMF)
Heating, makes local temperature reach 41 DEG C~46 DEG C, and tumour cell is made to be heated apoptosis, i.e. Magnetic Fluid Hyperthermia (magnetic fluid
Hyperthermia, MFH) technology.Application value of the MFH in oncotherapy has been subjected to widely paying attention to, and MFH can pass through magnetic
MNPs is effectively gathered in tumor locus and realizes target hyperthermia by field positioning, reduces the damage of normal tissue；Tumour cell pair
The intake ability of nano particle is 8-400 times of normal cell, can be to tumour in alternating magnetic field by the MNPs of cell endocytic
Cell carries out " intracellular thermotherapy ", improves the validity of thermotherapy and avoids heating uneven.The present invention is by PDT and Magnetic Fluid Hyperthermia knot
Altogether, tumour cell is acted synergistically on, the validity for the treatment of can be improved.
Detailed description of the invention
Fig. 1 is Fe3O4@SiO2@Qdots/PS magnetic Nano photosensitizer composite system prepares schematic diagram.Fig. 2 is magnetic
Fe3O4The transmission electron microscope picture of nano particle
Fig. 3 is silicon dioxide coated Fe3O4(Fe3O4@SiO2) nano particle transmission electron microscope picture
Fig. 4 is CdTe quantum high resolution TEM figure
Fig. 5 is Fe3O4@SiO2@CdTe/PS magnetic nanoparticle complex transmission electron microscope picture quantum dot transmission electron microscope picture
Fig. 6 is the liver cancer cells image under fluorescence microscope that shines.
Fig. 7 is shine liver cancer cells and Fe3O4FUEL energy transmission occurs for@SiO2@CdTe nanoparticle.
Fig. 8 is Fe3O4@SiO2ROS is generated in@CdTe/PS mediated by nanoparticles luminescent cell.
Fig. 9 is the digestion qualification figure of recombination carrier pAFP-luc.Swimming lane 1:pAFP-luc is bis- through HindIII and XbaI
Digestion rear electrophoresis.Swimming lane M:DNA Marker.
Figure 10 is the HepG2 cell biological luminescence imaging figure transfected through recombination carrier pAFP-luc.
Figure 11 is imaged under untreated fish group cell fluorescence microscope, for detecting DCF fluorescence.
Figure 12 is Substrate controls group cell fluorescence microscope imaging, is used for lower detection DCF fluorescence.
Figure 13 is interior irradiation photodynamic therapy group cell light microscope imaging, is used for lower detection DCF fluorescence.
Figure 14 is the activity of Caspase 3 in group of cells, and for * compared with first group of negative control, difference does not have statistics
Meaning, p > 0.05, n=10；
* is compared with first group of negative control group, the statistically significant p < 0.05, n=10. of difference
Figure 15 is the absorbance value of group of cells MTT test.* compared with first group of negative control, difference does not have statistics
Meaning, p > 0.05, n=10；* is compared with first group of negative control group, the statistically significant p < 0.05, n=10. of difference
Figure 16 is negative control group cell in transmission electron microscope picture.Show that lower subcellular structure is complete under Electronic Speculum.
Figure 17 is eucaryotic cell structure under optical dynamic therapy group transmission electron microscope, and cell shows typical apoptosis form under Electronic Speculum.
Specific embodiment
The present invention is further elaborated with below by embodiment.
Key step of the invention includes:
(1)Fe3O4@SiO2The preparation of@Qdots/PS composite nanometer particle: coprecipitation prepares Fe 3 O 4 magnetic and receives
Rice grain Fe3O4, on its surface, cladding a thin layer silica forms Fe3O4@SiO2；Select launch wavelength for the quantum of 630nm
The photosensitizer dihematoporphyrin ethers (PS) that point (Qdots) and absorbing wavelength are 630nm, are assemblied in Fe by suction-operated3O4@SiO2
The reason salt water dissolution of photosensitizer dihematoporphyrin ethers is configured to 0.1mg/ml by surface, mixed with CdTe colloidal solution (0.1mg/ml)
It closes, is slowly dropped into Fe3O4@SiO2In (0.1mg/ml) solution, it is passed through N2Gas is stirred to react overnight at room temperature, and 1 × 106Rpm hypervelocity
Centrifugation Fe3O4@SiO2@Qdots/PS nano particle, pure water wash for several times after suspending again.
(2) interior irradiation photodynamic therapy is carried out to it using tumor cell specific bioluminescence: with molecular biosciences
Development, massive tumor specificity promoter is found, glimmering using afp promoter guidance downstream worm by taking liver cancer as an example
The expression of light element enzyme gene constructs recombination pAFP-luc, and after transfection tumor cell, composite nanometer particle is with 1mg/ml concentration
It is incubated overnight altogether with transfection cell, substrate luciferin is added, cell generates specific biological and shines, and quantum is excited in a manner of FUEL
Point generates ROS then by the photosensitizer in FRET excitation nano particle, carries out photodynamic therapy to cell.
(3) combine Magnetic Fluid Hyperthermia: cell (animal) being placed in alternating magnetic field, the magnetic core of nano particle is in magnetic field
In be warming up to 41 DEG C or more, to tumour carry out Magnetic Fluid Hyperthermia, with photodynamic therapy Synergistic killing tumour cell.
Photosensitizer and magnetic-particle building in same nanometer system, are utilized intracellular spontaneous light energy by the method for the present invention
It excites photosensitizer to generate reactive oxygen species, and can controllably heat up in alternating magnetic field.In the present invention, irradiation in specificity is realized
The solution of two critical issues, first, luciferase gene is in the specific expressed of liver cancer cells, with alpha-fetoprotein
(alpha-fetoprotein, AFP) promoter guides luciferase gene (luciferase) targeting in downstream thin in liver cancer
Intracellular expression；Second, the luciferase of cell inner expression can excite photosensitizer.Quantum dot is not needed to be limited to it by fluorescence excitation
The distance between light donor can be excited by the energy radiation mode of macroscopic view, that is, " uncombined bioluminescence excitation is glimmering
Light " (fluorescence by unbound excitation from luminescence, FUEL).Select launch wavelength with
The quantum dot and photosensitizer of excitation wavelength overlapping construct nano particle, in the particle that partial size is 50nm or so, there is foot between the two
Enough chances meet the condition of the distance less than 10nm, to meet the condition excitation photosensitizer of FRET, to realize using thin
Specific biological intracellular shines and carries out photodynamic therapy to tumour as interior irradiation energy.The present invention utilizes magnetic nanoparticle
As core, tumour cell Magnetic Fluid Hyperthermia can be carried out while photodynamic therapy, the two plays synergistic effect and reinforces
To the lethal effect of tumour cell.
In the embodiment of the present invention, the hepatoma H22 cells of the AFP positive are selected, verifies in liver cancer cells and mediates specifically
Property in irradiation PDT combine Magnetic Fluid Hyperthermia.
1, the luciferase gene recombinant vector and transfecting hepatoma cells HepG2 of the mediation of AFP promoter are prepared:
AFP promoter sequence is referred to from Invivogen company, and composition sequence is as follows:
ACGCGTCCTGCAGTTTGAGGAGAATATTTGTTATATTTGCAAAATAAAATAAGTTTGCAAGTTTTTTTT
TTCTGCCCCAAAGAGCTCTGTGTCCTTGAACATAAAATACAAATAACCGCTATGCTGTTAATTATTGGCAAATGTCC
CATTTTCAACCTAAGGAAATACCATAAAGTAACAGATATACCAACAAAAGGTTACTAGTTAACAGGCATTGCCTGAA
AAGAGTATAAAAGAATTTCAGCATGATTTTCCATATTGTGCTTCCACCACTGCCAATAACACCAAGCTT
Plasmid is contained into AFP promoter sequence downstream connection luciferase gene luciferase (luc), building recombination
Expression vector pAFP-luc.Fig. 1 is shown in recombinant vector digestion identification.PAFP-luc is transfected to HepG2 cell with commercial reagents,
Substrate D-Luciferin is added in 48h after transfection, and the expression (Fig. 2) of reporter gene in cell is observed in living imaging instrument.
2.Fe3O4@SiO2The optical dynamic therapy of the bioluminescent cells HepG2 of@CdTe/PS mediated by nanoparticles.It will transfection
Bioluminescent cells are divided into following three groups afterwards:
(1) untreated negative control group cell.
(2) substrate D-Luciferin control group: D- fluorescein working solution (150 μ g/mL) is added in cell culture, and one day
After be changed to cell culture fluid.
(3) photodynamic therapy group: Fe3O4@SiO2@CdTe/PS nanoparticle was incubated for altogether with 1mg/mL concentration and cell
Supernatant is removed after night, cell is added D- fluorescein working solution (150 μ g/mL) afterwards three times with buffer solution for cleaning, is changed to after one day
Cell culture fluid.
Every group of cell manipulation is equipped with 10 operation repetitive holes, and all operationss processes of all grouping cells are being protected from light
Under the conditions of operate, cell aluminium-foil paper is fully wrapped around when incubation is placed in incubator, and active oxygen is used after 72 hours
(Reactive Oxygen Species, ROS) detection probe detects all reactive oxygen species for being grouped and generating into the cell, active oxygen
Probe is a kind of fluorescence probe precursor DCFH-DA, DCFH-DA itself without fluorescence, can pass freely through cell membrane, into intracellular
Afterwards, DCFH is generated by intracellular esterase hydrolyzed.DCFH is unable to permeabilized cells film, and assembles in the cell.Intracellular activity
Oxygen can aoxidize non-blooming DCFH and generate the DCF for having fluorescence.The fluorescence that DCF is detected under fluorescence microscope can represent into the cell
The level (Fig. 3-5) of active oxygen, optical dynamic therapy group excite photosensitizer using intracellular autofluorescence, generate a large amount of active oxygen
Cluster (ROS).For the apoptosis situation for reflecting cell, the day of cysteine in group of cells is detected with 3 assay kit of Caspase
Activity (the figure of aspartic acid proteolytic enzyme (cysteinyl aspartate specific proteinase) Caspase 3
6), it is seen that the expression of Caspase 3 rises in optical dynamic therapy group cell；Each grouping cell is detected respectively with MTT test simultaneously
Proliferative conditions (Fig. 7), optical dynamic therapy group cell proliferation rate decline.Changing for PDT group subcellular structure is observed under transmission electron microscope
Become (Fig. 8-9), show as typical apoptosis form: cell membrane form is still complete, and normal structure of mitochondria disappears, nucleus
Interior chromatin concentration side is poly-.Result above confirms that the present invention can be shone using intracellular biological as interior radiation source, exciting light
Quick dose, to carry out photodynamic therapy effect to cell.
3.Fe3O4@SiO2The optical dynamic therapy and magnetic current of the bioluminescent cells HepG2 of@CdTe/PS mediated by nanoparticles
The combination therapy that body heat is treated.Bioluminescent cells after transfection are divided into following three groups:
(1) photodynamic therapy group: Fe3O4@SiO2@CdTe/PS nanoparticle was incubated for altogether with 1mg/mL concentration and cell
Supernatant is removed after night, cell is added D- fluorescein working solution (150 μ g/mL) afterwards three times with buffer solution for cleaning, is changed to after one day
Cell culture fluid.
(2) Magnetic Fluid Hyperthermia group: Fe3O4@SiO2@CdTe/PS nanoparticle is incubated overnight with 1mg/mL concentration with cell altogether
After remove supernatant, cell is placed in alternating magnetic field (frequency f=230kHz, electric current I=30A) interior thermotherapy 60 minutes.
(3) irradiation optical dynamic therapy is in Magnetic Fluid Hyperthermia combination therapy group in: Fe3O4@SiO2@CdTe/PS nanoparticle with
1mg/mL concentration and cell remove supernatant after being incubated overnight altogether, cell is added D- fluorescein with buffer solution for cleaning afterwards three times and works
Liquid (150 μ g/mL), was changed to cell culture fluid after one day, and cell is then placed in alternating magnetic field (frequency f=230kHz, electric current I
=30A) interior thermotherapy 60 minutes.
Above three groups of cells all operationss process carries out under the conditions of being protected from light, and every group of cell manipulation is equipped with 10 parallel behaviour
Make hole.Cells from light culture.After 5 days, all cells MTT testing inspection cell proliferation rate (table 1).It can be seen that PDT and magnetic fluid
Thermotherapy combination therapy group has maximum proliferation inhibition rate to cell.
The treatment of table 1 grouping MTT test cell absorbance and increment inhibiting rate
Claims (6)
1. a kind of preparation method of magnetic Nano photosensitizer composite system, which is characterized in that this method includes the following steps:
(1) Fe is prepared3O4Magnetic nanoparticle: by FeCl3And FeCl2It is placed in pure water reaction system, 50 DEG C, pH 9.5 ± 0.1,
N2Protection lower reaction 30 minutes, obtain Fe3O4Magnetic nanoparticle；
(2) ethyl orthosilicate MODIFIED Fe3O4: by Fe3O4Magnetic nanoparticle and pure water are with the mixing of mass ratio 1: 200, ultrasonic disperse
At colloidal solution, addition accounts for the ammonium hydroxide of reaction system volume 1/100 and accounts for the ethyl orthosilicate of reaction system volume 1/100, and 50
It DEG C is stirred to react 12 hours, in magnetic nanoparticle Surface Creation layer of silicon dioxide, obtains Fe3O4@SiO2；
(3) preparation of CdTe quantum particle: it is being passed through N2Under conditions of gas, by sodium borohydride: tellurium: pure water mixing, ice bath reaction
It is completely disappeared to black Te powder, obtained upper layer lavender transparency liquid is sodium hydrogen telluride；It is anti-in the pure water of pH 9.0 ± 0.1
It answers in system, N2Under magnetic agitation, CdCl is added using mercaptopropionic acid as stabilizer in protection2And sodium hydrogen telluride, it is warming up to 100
DEG C, N is passed through into reaction system2100 DEG C of gas and holding, magnetic agitation react 16 to 18 hours, obtain red water solubility
CdTe colloidal solution；
(4)Fe3O4@SiO2The preparation of@Qdots/PS: dihematoporphyrin ethers aqueous solution and CdTe colloidal solution are mixed, under stirring by
It is added dropwise to the Fe that concentration is 0.1mg/ml3O4@SiO2In solution, wherein dihematoporphyrin ethers: CdTe: Fe3O4@SiO2Mass ratio is 1:
1: 1, it is continually fed into N2Gas is stirred to react overnight at room temperature, and ultracentrifugation precipitation nano particle, pure water washs number after suspending again
It is secondary, obtain Fe3O4@SiO2@Qdots/PS magnetic Nano photosensitizer.
2. the preparation method of magnetic Nano photosensitizer composite system according to claim 1, which is characterized in that the step
(1) FeCl in3And FeCl2Mass ratio is 5: 3.
3. the preparation method of magnetic Nano photosensitizer composite system according to claim 1, which is characterized in that the step
(3) sodium borohydride in: tellurium: pure water is mixed according to molar ratio 2: 1: 0.5.
4. the preparation method of magnetic Nano photosensitizer composite system according to claim 1,2 or 3, which is characterized in that institute
It states after being warming up to 100 DEG C in step (3), the vapor that reaction is generated is condensed by condenser pipe to flow back.
5. the preparation method of magnetic Nano photosensitizer composite system according to claim 1,2 or 3, which is characterized in that institute
State sodium hydrogen telluride in step step (3): Cd2+: the molar ratio of mercaptopropionic acid is 0.5: 1: 2.4.
6. the preparation method of magnetic Nano photosensitizer composite system according to claim 1,2 or 3, which is characterized in that institute
State in step (4) dihematoporphyrin ethers in dihematoporphyrin ethers aqueous solution: pure water mass ratio is 1: 10, in the CdTe colloidal solution
CdTe: pure water mass ratio is 1: 10, and the mass ratio of dihematoporphyrin ethers and CdTe are 1: 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811202035.8A CN109481676A (en) | 2018-10-15 | 2018-10-15 | A kind of preparation method of magnetic Nano photosensitizer composite system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811202035.8A CN109481676A (en) | 2018-10-15 | 2018-10-15 | A kind of preparation method of magnetic Nano photosensitizer composite system |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109481676A true CN109481676A (en) | 2019-03-19 |
Family
ID=65690350
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811202035.8A Pending CN109481676A (en) | 2018-10-15 | 2018-10-15 | A kind of preparation method of magnetic Nano photosensitizer composite system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109481676A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109453376A (en) * | 2018-11-08 | 2019-03-12 | 东南大学 | A kind of preparation method of composite magnetic nanometric photosensitizer |
| CN110776910A (en) * | 2019-11-05 | 2020-02-11 | 重庆科技学院 | Double-function magnetic fluorescent nano composite Fe 3O 4Preparation method of @ CDs microspheres |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100226856A1 (en) * | 2009-03-06 | 2010-09-09 | Franco Vitaliano | Dynamic bio-nanoparticle elements |
| CN103566381A (en) * | 2013-10-30 | 2014-02-12 | 华东理工大学 | Multifunctional magnetic nano particle and preparation method thereof |
| CN107952081A (en) * | 2017-11-15 | 2018-04-24 | 广东药科大学 | PH controlled-release target medicament nano transport agents and its preparation method and application |
| CN107998389A (en) * | 2017-11-20 | 2018-05-08 | 中国人民解放军军事医学科学院卫生装备研究所 | It is a kind of can bioluminescence triggering upper conversion carbon quantum dot-protoporphyrin IX complex photosensitizer and preparation method thereof |
-
2018
- 2018-10-15 CN CN201811202035.8A patent/CN109481676A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100226856A1 (en) * | 2009-03-06 | 2010-09-09 | Franco Vitaliano | Dynamic bio-nanoparticle elements |
| CN103566381A (en) * | 2013-10-30 | 2014-02-12 | 华东理工大学 | Multifunctional magnetic nano particle and preparation method thereof |
| CN107952081A (en) * | 2017-11-15 | 2018-04-24 | 广东药科大学 | PH controlled-release target medicament nano transport agents and its preparation method and application |
| CN107998389A (en) * | 2017-11-20 | 2018-05-08 | 中国人民解放军军事医学科学院卫生装备研究所 | It is a kind of can bioluminescence triggering upper conversion carbon quantum dot-protoporphyrin IX complex photosensitizer and preparation method thereof |
Non-Patent Citations (3)
| Title |
|---|
| CHENYAN YUAN ET AL: "Luciferase gene-loaded CS-Qdots as selfilluminating probes for specific hepatoma imaging", 《RSC ADV.》 * |
| CHIA-YEN HSU ET AL: "Bioluminescence resonance energy transfer using luciferase-immobilized quantum dots for self-illuminated photodynamic therapy", 《BIOMATERIALS》 * |
| 陈 伟: "癌症治疗的新方法——纳米自发光光动力疗法", 《玉林师范学院学报（自然科学）》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109453376A (en) * | 2018-11-08 | 2019-03-12 | 东南大学 | A kind of preparation method of composite magnetic nanometric photosensitizer |
| CN110776910A (en) * | 2019-11-05 | 2020-02-11 | 重庆科技学院 | Double-function magnetic fluorescent nano composite Fe 3O 4Preparation method of @ CDs microspheres |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhu et al. | Zwitterionic AIEgens: Rational Molecular Design for NIR‐II Fluorescence Imaging‐Guided Synergistic Phototherapy | |
| Lu et al. | Highly Emissive Nd3+‐Sensitized Multilayered Upconversion Nanoparticles for Efficient 795 nm Operated Photodynamic Therapy | |
| Tian et al. | Development of a novel anti-tumor theranostic platform: a near-infrared molecular upconversion sensitizer for deep-seated cancer photodynamic therapy | |
| Chen et al. | NIR-II light activated photodynamic therapy with protein-capped gold nanoclusters | |
| Dou et al. | Effective near-infrared photodynamic therapy assisted by upconversion nanoparticles conjugated with photosensitizers | |
| Lee et al. | Near-infrared light-triggered photodynamic therapy and apoptosis using upconversion nanoparticles with dual photosensitizers | |
| Park et al. | Advanced smart-photosensitizers for more effective cancer treatment | |
| Qian et al. | Photosensitizer encapsulated organically modified silica nanoparticles for direct two-photon photodynamic therapy and in vivo functional imaging | |
| Wang et al. | Graphene oxide covalently grafted upconversion nanoparticles for combined NIR mediated imaging and photothermal/photodynamic cancer therapy | |
| Chatterjee et al. | Upconverting nanoparticles as nanotransducers for photodynamic therapy in cancer cells | |
| Zhou et al. | Cancer photothermal therapy in the near-infrared region by using single-walled carbon nanotubes | |
| Wang et al. | Upconversion nanoparticles for photodynamic therapy and other cancer therapeutics | |
| Wang et al. | Lanthanide-doped upconversion nanoparticles electrostatically coupled with photosensitizers for near-infrared-triggered photodynamic therapy | |
| Liu et al. | Synergistic targeting and efficient photodynamic therapy based on graphene oxide quantum dot‐upconversion nanocrystal hybrid nanoparticles | |
| Mi et al. | A photochromic upconversion nanoarchitecture: towards activatable bioimaging and dual NIR light-programmed singlet oxygen generation | |
| Song et al. | Upconversion system with quantum dots as sensitizer: improved photoluminescence and PDT efficiency | |
| Chan et al. | Advanced sensing, imaging, and therapy nanoplatforms based on Nd 3+-doped nanoparticle composites exhibiting upconversion induced by 808 nm near-infrared light | |
| Liu et al. | Dye‐Sensitized Rare Earth Nanoparticles with Up/Down Conversion Luminescence for On‐Demand Gas Therapy of Glioblastoma Guided by NIR‐II Fluorescence Imaging | |
| Wu et al. | A two-dimensional molecular beacon for mRNA-activated intelligent cancer theranostics | |
| Hayashi et al. | One‐Pot Synthesis of Dual Stimulus‐Responsive Degradable Hollow Hybrid Nanoparticles for Image‐Guided Trimodal Therapy | |
| Zhang et al. | Low-dose x-ray excited photodynamic therapy based on naluf4: Tb 3+–rose bengal nanocomposite | |
| Wu et al. | Photosensitizer-assembled PEGylated graphene-copper sulfide nanohybrids as a synergistic near-infrared phototherapeutic agent | |
| BRPI0713940A2 (en) | core and shell nanoparticles, and use and process for manufacturing | |
| Xin et al. | Upconversion nanomaterials: a platform for biosensing, theranostic and photoregulation | |
| Hu et al. | Förster resonance energy transfer-based dual-modal theranostic nanoprobe for in situ visualization of cancer photothermal therapy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190319 |
|
| RJ01 | Rejection of invention patent application after publication |