CN109468415A - A kind of detection method of infectivity muscle necrosis virus - Google Patents
A kind of detection method of infectivity muscle necrosis virus Download PDFInfo
- Publication number
- CN109468415A CN109468415A CN201811636671.1A CN201811636671A CN109468415A CN 109468415 A CN109468415 A CN 109468415A CN 201811636671 A CN201811636671 A CN 201811636671A CN 109468415 A CN109468415 A CN 109468415A
- Authority
- CN
- China
- Prior art keywords
- necrosis virus
- plasmid
- detection method
- template
- muscle necrosis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
The invention discloses a kind of detection methods of infectivity muscle necrosis virus, comprising the following steps: (1) designs specific primer and probe；(2) optimize quantitative fluorescent PCR reaction system and reaction condition；(3) plasmid standard containing aim sequence is extracted, as quantitative fluorescent PCR positive template, fluorescent quantitative PCR is carried out, obtains amplification curve and standard curve；(4) viral RNA for extracting sample to be tested, carries out fluorescent quantitative PCR, and detection extracts whether virus is the infectivity muscle necrosis virus positive.The present invention is using the 5 ' of full-length genome -3 ' the 835th base to the 901st base as purpose sequence, design specific primer and probe, detection sensitivity height, high specificity, and the repeatability of testing result is high, accurately and reliably, it is low to operator's technical requirements, it is easy to accomplish standardization is particularly suitable for the quarantine of entry and exit prawn.
Description
Technical field
The invention belongs to technical field of virus detection, and in particular to a kind of detection method of infectivity muscle necrosis virus.
Background technique
Aquaculture refers to breeding, cultivation and the production activity for harvesting aquatic animals and plants under conditions of artificial control.
Viral disease is an important factor for influencing yield in aquaculture, and intensive and multiplicity breeding way has many viruses
Opportunity, infectivity muscle necrosis virus (IMNV) are exactly one of them, and Penaeus Vannmei is the most susceptible shrimp of known IMNV
Kind, it can be infected in each stage of growth.The disease first came across the litopenaeus vannamei cultivation factory of Brazil inferior to 2002,
Incoming Indonesia in 2006, infection shrimp occur that body colour is whitened, uromere is rubescent, tail muscles tissue is in dotted or diffusion type,
Body surface has the symptom of irregular blackspot, and the death rate is differed 40%~70%.
IMNV is diplornavirus, mainly infects the striated muscle tissue of Penaeus Vannmei, and detection means is that discovery is infectious
One of method of disease, for the nucleic acid sequence research make to establish sensitive, special detection method, development is effectively controlled
Treatment measure is possibly realized.IMNV viral nucleic acid is the RNA of double-strand non-segmented negative, and the total nucleotide number of homophyletic does not have little difference,
But about 8226-8230bp, tool are ORF1 encoding RNA-binding proteins, main there are two nonoverlapping open reading frame (ORF)
Capsid protein, the RNA polymerase that ORF2 coding RNA relies on, is relatively conservative region.End up to the present, in GenBank
The sequence for sharing the virus shares 18 as a result, wherein NC-007915 is identical as AY570982, and whole genome sequence 7,10
The partial gene sequence of IMNV.
The detection method of IMNV includes immunological detection method and the detection method based on nucleic acid, immunology detection side
The principle of method is the method that virus is detected using special antigen-antibody reaction, different from being separately cultured for virus, immunology
The method used time it is short, do not need specific laboratory condition, the kit for commercialization can be developed, it is convenient and efficient, be suitable for
Side of a pond detection.The characteristics of detection method based on nucleic acid is due to highly sensitive and high specific, is widely used for testing
Room detection.China has not been reported the case of IMNV infection prawn, but deepening continuously with economic globalization process at present, cross-border
Exchange is more and more frequent, and the incoming risk of exotic also expands therewith, and the major way controlled risk is to reinforce immigration to move
The quarantine of object, it is accurate, sensitive, reproducible, and be easy to standardized detection method be entry and exit prawn quarantine station there is an urgent need to
's.Research emphasis is placed in sensitivity and specificity by the fluorescent quantitative PCR detection method of existing IMNV, and has ignored repetition
Property, poor repeatability leads to not obtain accurate detection result.
Summary of the invention
The purpose of the present invention is to provide a kind of detection method of infectivity muscle necrosis virus, detection method design is special
Specific primer and probe, detection sensitivity height, high specificity, and the repeatability of testing result is high, wants to operator's technology
Ask low, it is easy to accomplish standardization.
The technical solution adopted by the invention is as follows:
A kind of detection method of infectivity muscle necrosis virus, comprising the following steps:
(1) design of primers: the complete genome sequence of the infectivity muscle necrosis virus in GenBank is searched, with full-length genome
5 ' -3 ' the 835th base to the 901st base be purpose sequence, drawn using Primr premier software design specificity
Object and TaqMan probe, sequence is as follows, direction 5 ' → 3 ':
Forward primer: GAAGCCTAAATACACATCGAC；
Reverse primer: CTGCTTCGCTAAAACCTG；
Probe: AAAACCGGAGCTGACCAC, 5 ' ends are marked with Fam, and 3 ' ends are marked with BHQ-1；
(2) optimize quantitative fluorescent PCR reaction system and reaction condition；
(3) plasmid standard containing aim sequence is extracted, as quantitative fluorescent PCR positive template, carries out plasmid concentration
Detection, calculates the copy number of recombinant plasmid, plasmid is carried out doubling dilution with 10 times of dilutions, as standard plasmid mould
Plate, and no template control is set up, fluorescent quantitative PCR is carried out, amplification curve and standard curve are obtained；
(4) viral RNA for extracting sample to be tested, carries out fluorescent quantitative PCR, and detection extracts whether virus is infection
Property muscle necrosis virus it is positive.
Further, in step (3), quantitative fluorescent PCR reaction system are as follows: reaction 25 μ L of total volume, wherein
12.5 μ L of Probe qPCR SuperMix, it 7.5 μ L of RNase Free Water, 1 μ L of forward primer, 1 μ L of reverse primer, visits
1 μ L of needle, 2 μ L of template.
Further, the condition of quantitative fluorescent PCR are as follows: 94 DEG C of initial denaturation 5min, 95 DEG C of denaturation 15s, 60 DEG C of annealing extend
1min, 40 circulations.
Further, in step (4), quantitative fluorescent PCR reaction system are as follows: reaction total volume is 25 μ L, wherein 2*
OneStepRT-PCR Buffer III 12.5μL、TaKaRaEx Taq HS 0.5μL、PrimeScript RT Enzyme
0.5 μ L of MIXII, 1 μ L of forward primer, 1 μ L of reverse primer, 0.7 μ L of probe, ddH20 6.8 μ L, 2 μ L of template.
Further, the condition of quantitative fluorescent PCR are as follows: 42 DEG C of initial denaturations 5min, 95 DEG C of denaturation 10s, 95 DEG C of annealing 10s,
60 DEG C of extension 1min, 40 circulations.
Further, in step (3), plasmid standard is diluted to 108-1018 concentration gradients of copy/μ L are as mark
Quasi- plasmid template.
Further, in step (3), using ddH2O is as no template control.
Further, in step (3), the plasmid standard containing aim sequence are as follows: drawn using the specificity in step (1)
Object amplifies aim sequence, and aim sequence is connected into pUC57-simple carrier, be then transformed into Escherichia coli expand it is numerous,
Plasmid standard containing aim sequence needed for being extracted from Escherichia coli.
In conclusion by adopting the above-described technical solution, the beneficial effects of the present invention are:
1, the present invention using 5 ' -3 ' the 835th base of full-length genome to the 901st base as purpose sequence, design spy
Specific primer and probe, detection sensitivity height, high specificity, and the repeatability of testing result is high, accurately and reliably, to operator
Technical requirements are low, it is easy to accomplish standardization is particularly suitable for the quarantine of entry and exit prawn；
2, the present invention increases reverse transcriptase in fluorescence system, while realizing reverse transcription and fluorescent quantitative PCR, simplifies
Operating procedure improves detection efficiency.
Detailed description of the invention
Fig. 1 is plasmid standard amplification；
Fig. 2 is the agarose gel electrophoresis results of plasmid standard amplified production；
Fig. 3 is annealing, elongating temperature optimum results；
Fig. 4 is primer concentration optimum results；
Fig. 5 is concentration and probe concentration optimum results；
Fig. 6 is specificity experiments amplification (DNA group)；
Fig. 7 is specificity experiments amplification (RNA group)；
Fig. 8 is sensitivity determination result；
Fig. 9 is quantitation curves.
Specific embodiment
All features disclosed in this specification can be with any other than mutually exclusive feature and/or step
Mode combines.
Go out aim sequence using the primer amplified that the present invention designs, aim sequence is connected into pUC57-simple and is carried
Then body is transformed into Escherichia coli and expand numerous, this carries the Escherichia coli of aim sequence plasmid by Hua Da gene biological
Technology Co., Ltd. synthesizes and provides.
Embodiment 1
The extraction process of plasmid standard containing aim sequence are as follows:
The Escherichia coli for carrying aim sequence plasmid are transferred to equipped with 5mL LB liquid medium with ampicillin
Test tube in, be placed in water bath with thermostatic control shaking table, 37 DEG C of concussions 16h, 250rpm.
According to making for the small extraction reagent kit centrifugal column type of plasmid (TIANprep Mini Plasmid Kit, DP103, Tiangeng)
With illustrate extract plasmid standard.Column equilibration step: adsorption column CP3 is put into collecting pipe, and the flat of 500 μ L is added into adsorption column
Weigh liquid BL, and 12000rpm is centrifuged 1min, outwells the waste liquid in collecting pipe, adsorption column is placed back in collecting pipe.Take 3mLLB liquid
The bacterium solution of body culture medium is added in centrifuge tube, and using desk centrifuge, 12000rpm is centrifuged 1min, absorbs supernatant, Xiang Liuyou bacterium
The solution P1 that 250 μ L contain RNaseA is added in the centrifuge tube of body precipitating, so that bacterial precipitation is thoroughly suspended using turbula shaker,
Then 250 μ L solution P2 are added into centrifuge tube, slowly spinning upside down 6-8 times cracks thallus sufficiently, and overturning step exists
It is completed within 5min, 350 μ L solution P3 is then added into centrifuge tube, slowly spins upside down 6-8 times, mixes well at once,
Occurs white flock precipitate at this time, 12000rpm is centrifuged 10min, collects supernatant, is transferred in adsorption column CP3,12000rpm
It is centrifuged 50s, the waste liquid in collecting pipe is outwelled, adsorption column CP3 is put into collecting pipe again.600 μ L are added into adsorption column CP3
Rinsing liquid PW, 12000rpm centrifugation 50s containing dehydrated alcohol, outwells the waste liquid in collecting pipe, is again put into adsorption column CP3
In collecting pipe, after being repeated twice, 12000 centrifugation 2min remove rinsing liquid remaining in adsorption column, adsorption column CP3 are placed in one
In a clean centrifuge tubes, 100 μ L elution buffer EB are added dropwise to the intermediate position of adsorbed film, are placed at room temperature for 2min,
12000rpm is centrifuged 2min, and plasmid solution is collected into centrifuge tube, measures the dense of mentioned nucleic acid using trace dna albumen instrument
Degree is 118.40ng/ μ L, is saved in -36 DEG C, and packing avoids multigelation.
In the present embodiment, LB liquid medium with ampicillin: peptone 10g, yeast powder 5g, NaCl 10g are put
Enter 1L beaker, add deionized water about 800mL, is stirred well to solute dissolution, with 5mol/L NaOH tune pH to 7.0, adds water to
1L is added ampicillin when being cooled to 50 DEG C after 121 DEG C of high pressure steam sterilization 20min, LB sterilizings, shakes up, ampicillin
100 μ g/mL of final concentration is saved in 4 DEG C.
In the present embodiment, using Thermo water bath with thermostatic control shaking table, 2 whirlpool blending instrument of Vortex-Genie, Thermo landing
Formula refrigerated centrifuge and ScanDrop100 trace dna albumen instrument.
Embodiment 2
The plasmid standard extracted in embodiment 1 uses ddH2O is diluted to 103、104Copy/μ L as template, and carries out
Fluorescent quantitative PCR, reaction system are as follows: reaction 25 μ L of total volume, whereinProbeqPCR SuperMix
12.5 μ L, 7.5 μ L of RNase Free Water, 1 μ L of forward primer, 1 μ L of reverse primer, 1 μ L of probe, 2 μ L of template.Fluorescence is fixed
Measure the condition of PCR are as follows: 94 DEG C of initial denaturation 5min, 95 DEG C of denaturation 15s, 60 DEG C of annealing extension 1min, 40 recycle.Amplification curve is shown in
Fig. 1, each concentration has carried out four amplifications, and (curve 1-4 is 103Copy/μ L, 5-8 104Copy/μ L).
Product after amplification is subjected to agarose gel electrophoresis identification.1% Ago-Gel is prepared, agarose is weighed
1g is put into clean triangular flask, and 1 × TAE is added, mixes gently, is melted to clarification using microwave stove heating, is added after taking-up
3 ‰ GelRed.Glue plugs comb in the appropriate location of glue mould, after glue is slightly cool, pours into glue mould.Connect electrophoresis tank
Power supply, setting voltage are 100V, time 30min.After glue is cooling, comb is extracted vertically upward, glue is put into electrophoresis tank, loading wells
Close to cathode, 1 × TAE is added in electrophoresis tank and did not had glue, avoids generating aeration race glue process.Before point sample, by sample liquid 5
Comb hole is added in μ L and 1 μ 6 × loading of L buffer after mixing in clean gloves, two parallel holes are arranged.Start key is pressed,
See that cathode there are uniform minute bubbles to generate and proves to have begun electrophoresis, is imaged as early as possible after electrophoresis.
In the present embodiment, using 96 fluorescence quantitative PCR instrument of Bio Rod CFX, Jena, Germany detected through gel electrophoresis system,
U.S. Bio-Red chemiluminescence gel imaging system.The gel electrophoresis figure of amplified production such as Fig. 2 (M:DL2000 Marker；1-
2: plasmid standard amplified production) shown in, the results showed that, segment meets target fragment length 67bp in 100bp or so.
Embodiment 3
In the present embodiment, quantitative fluorescent PCR reaction system are as follows: reaction 25 μ L of total volume, whereinProbe
12.5 μ L of qPCR SuperMix, 7.5 μ L of RNase Free Water, 1 μ L of forward primer, 1 μ L of reverse primer, 1 μ L of probe,
2 μ L of template, using in embodiment 2 104Template under copy/μ L concentration, primer and probe concentration are 0.1-1 μm of ol/L.
The optimization of reaction system and reaction condition:
Annealing, the optimization of elongating temperature: being expanded using two-step method, and different annealing temperatures uses fluorescence quantitative PCR instrument ladder
Spend temperature function setting, early period program still are as follows: 94 DEG C of initial denaturation 5min, 95 DEG C of denaturation 15s, temperature are respectively set to 55 DEG C,
55.5 DEG C, 56.6 DEG C, 58.2 DEG C, 60.1 DEG C, 61.7 DEG C, 62.6 DEG C, 63.0 DEG C, recurring number is disposed as 40, uses simultaneously
ddH2O is as no template control hole.
As a result as shown in figure 3, corresponding curve, temperature is followed successively by 60.1 DEG C, 61.7 from top to bottom when abscissa is 40
DEG C, 58.2 DEG C, 56.6 DEG C, 55.5 DEG C, 55 DEG C, 62.6 DEG C, 63 DEG C, wherein 60.1 DEG C and 61.7 DEG C corresponding curved portion weights
It closes.The result shows that no template control hole obvious amplification occurs without amplification within the scope of 55-63 DEG C, and collect strong fluorescence
Signal, for Cq value 21.69 or so, difference is little, and relative intensity of fluorescence reaches 13000 at 60.1 DEG C, relatively mild.Therefore,
Annealing, optimal elongating temperature are 60 DEG C.
The optimization of primer concentration: being the forward primer and reverse primer of 10 μm of ol/L using concentration when system is prepared, just
It is separately added into 0.6 μ L to primer and reverse primer, 0.8 μ L, 1.0 μ L, 1.2 μ L, therefore, the end of forward primer and reverse primer is dense
Degree is respectively 0.24 μm of ol/L, 0.32 μm of ol/L, 0.40 μm of ol/L, 0.48 μm of ol/L.Each concentration sets up two parallel holes, and
Using ddH2O is as no template control hole.The condition of quantitative fluorescent PCR are as follows: 94 DEG C of initial denaturation 5min, 95 DEG C of denaturation 15s, 60 DEG C
Annealing extends 1min, 40 circulations.
As a result as shown in figure 4, abscissa be 40 when, corresponding curve, from top to bottom concentration be followed successively by 0.48 μm of ol/L,
0.48 μm of ol/L, 0.40 μm of ol/L, 0.24 μm of ol/L, 0.32 μm of ol/L, 0.24 μm of ol/L, wherein 0.40 μm of ol/L is corresponding
Two curve co-insides, corresponding two curve co-insides of 0.32 μm of ol/L.The result shows that no template control hole is without amplification, above-mentioned
Under the conditions of primer concentration, amplification curve can occur, and collect corresponding fluorescence signal, when primer concentration is 0.48 μm of ol/L
When, Cq value is minimum, is 21.21, and relative intensity of fluorescence reaches 12000, therefore it is 0.48 μm of ol/L that primer concentration is optimal.
The optimization of concentration and probe concentration: progress concentration and probe concentration preliminary experiment first is separately added into the probe 0.2,0.5 of 10 μm of ol/L,
0.8 μ L analyzes Cq value and relative intensity of fluorescence.Probe 0.4 the μ L, 0.5 μ L, 0.6 μ L, 0.7 μ of 10 μm of ol/L is selected in formal experiment
L, the final concentration of probe are respectively 0.16 μm of ol/L, 0.20 μm of ol/L, 0.24 μm of ol/L, 0.28 μm of ol/L, and each concentration is set up
Two parallel holes, primer concentration is 0.48 μm of ol/L, and uses ddH2O is as no template control hole.The condition of quantitative fluorescent PCR
Are as follows: 94 DEG C of initial denaturation 5min, 95 DEG C of denaturation 15s, 60 DEG C of annealing extension 1min, 40 recycle.
Preliminary result shows, when 0.8 μ L probe is added, relative intensity of fluorescence and Cq value and difference is not when 1.0 μ L is added
Greatly.Formal experimental result is as shown in figure 5, when abscissa is 40, and corresponding curve, concentration is followed successively by 0.24 μm of ol/ from top to bottom
L, 0.24 μm of ol/L, 0.28 μm of ol/L, 0.20 μm of ol/L, 0.20 μm of ol/L, 0.16 μm of ol/L, 0.16 μm of ol/L, wherein 0.28
μm corresponding two curve co-insides of ol/L.The result shows that no template control hole is without amplification, the final concentration of 0.24 μm of ol/L of probe
When, relative intensity of fluorescence highest, and Cq value is minimum, therefore in this method, optimal concentration and probe concentration is 0.24 μm of ol/L.
Embodiment 4
Quantitative fluorescent PCR specificity verification: white spot syndrome epidemic disease is extracted using paramagnetic particle method viral DNA/RNA extracts kit
Seedling, classical swine fever virus vaccine, porcine reproductive and respiratory syndrome virus vaccine, aftosa vaccine, H5 subtype avian influenza vaccine nucleic acid
Sample, as RNA group template and bovine respiratory syncytial virus vaccine, Cyprinidae herpesviral II type vaccine, circovirus II
The sample of nucleic acid of type vaccine carries out quantitative fluorescent PCR as DNA group template, and the plasmid standard that embodiment 1 is obtained dilutes
To 104-1032 concentration gradients of copy/μ L as positive control, and use ddH2O is as no template control.
The quantitative fluorescent PCR of DNA group, positive control and no template control is using the reaction system and optimization in embodiment 2
Condition, the quantitative fluorescent PCR reaction system of RNA group are as follows: react 25 μ L of total volume, wherein 2*OneStep RT-PCR Buffer
12.5 μ L of III, 0.5 μ L of TaKaRaEx Taq HS, 0.5 μ L of PrimeScript RT Enzyme MIXII, 1 μ of forward primer
L, 1 μ L of reverse primer, 0.7 μ L of probe, ddH20 6.8 μ L, 2 μ L of template.The condition of quantitative fluorescent PCR are as follows: 42 DEG C of initial denaturations
5min, 95 DEG C of deformation 10s, 95 DEG C of annealing 10s, 60 DEG C of extension 1min, 40 recycle.
As a result as shown in Figure 6, Figure 7, DNA group: no template control is without amplification, and plasmid standard Cq value is 23.32, other samples
Product are without amplification.RNA group: no template control is without amplification, and plasmid standard Cq value is 25.12, other samples are without amplification.The primer pair
For existing 8 kinds of viral nucleic acids without amplification, specificity is good.
Embodiment 5
Quantitative fluorescent PCR sensitivity technique: carrying out plasmid concentration detection to the plasmid standard that embodiment 1 is extracted again,
Concentration is 90.30ng/ μ L, according to copy numberWherein, M=660 is (every in double-strand
The relative molecular mass of a base), L=299 (fragment length), calculating copy number is 2.75 × 1011Copy/μ L, with 10 times
Plasmid is carried out doubling dilution by dilution, is diluted to 108-1018 concentration gradients of copy/μ L use ddH as template2O
As no template control, fluorescent quantitative PCR is carried out, using the reaction system and reaction condition in embodiment 2, as a result as schemed
8, shown in Fig. 9, for no template control without amplification, sensitivity can reach 10 copies/μ L.It is bent that quantitative criterion is obtained by above-mentioned amplification
Line y=-3.404x+37.12, R2=0.997, linear good, amplification efficiency 96.7%.
Embodiment 6
The detection of quantitative fluorescent PCR repeatability: the plasmid standard extracted to embodiment 1 is carried out plasmid with 10 times of dilutions
Doubling dilution is diluted to 103、105、1073 concentration gradients of copy/μ L as template, and use ddH2O is as no template
Control carries out fluorescent quantitative PCR, and using the reaction system and reaction condition in embodiment 2, each concentration is in triplicate.
1 repeated experiment result of table
It the results are shown in Table 1, without amplification, the Cq value coefficient of variation of three dilutions is respectively less than 1%, much low in no template control hole
In the coefficient of variation of existing method for detecting virus 5% or so, show that the repeatability of this method is good.
Embodiment 7
15 batches of samples, including 14 batches of Penaeus Vannmeis, 1 batch of Penaeus monodon are taken, every batch of Penaeus Vannmei sample takes 15- at random
20 musculature is placed in the 15mL centrifuge tube equipped with MagNA Lyser Green Beads, 2~4mL PBS is added, in sample
It is beaten on product homogenizer to smooth homogenate, is put into -70 DEG C of refrigerator freezings, then take out room temperature thawing, repetitive operation 3-4 times, with release
Intracellular virus, then 10000rpm is centrifuged 5min, and supernatant is taken to extract.Using the method in embodiment 4, reagent is used
Box and instrument for extracting nucleic acid extract supernatant, obtain 100 μ L or so nucleic acid, totally 15 samples, are used using it as template
The method of the present invention carries out fluorescent quantitative PCR, using the quantitative fluorescent PCR reaction system and reaction item of RNA group in embodiment 4
Two parallel holes are arranged in part, each sample, while using plasmid standard as positive control, with ddH2O is as no template control, sun
Property control and no template control using the quantitative fluorescent PCR reaction system and reaction condition in embodiment 2.
The results show that no template control is not detected in 14 batches of Penaeus Vannmeis and 1 batch of Penaeus monodon sample without amplification
IMNV, meanwhile, there is obvious amplification curve using plasmid standard as the Positive control wells of template.
It is as described above the embodiment of the present invention.The present invention is not limited to the above-described embodiments, anyone should learn that
The structure change made under the inspiration of the present invention, the technical schemes that are same or similar to the present invention each fall within this
Within the protection scope of invention.
Claims (8)
1. a kind of detection method of infectivity muscle necrosis virus, which comprises the following steps:
(1) design of primers: the complete genome sequence of the infectivity muscle necrosis virus in GenBank is searched, with the 5 ' of full-length genome-
3 ' the 835th base to the 901st base is purpose sequence, using Primr premier software design specific primer with
TaqMan probe, sequence is as follows, direction 5 ' → 3 ':
Forward primer: GAAGCCTAAATACACATCGAC；
Reverse primer: CTGCTTCGCTAAAACCTG；
Probe: AAAACCGGAGCTGACCAC, 5 ' ends are marked with Fam, and 3 ' ends are marked with BHQ-1；
(2) optimize quantitative fluorescent PCR reaction system and reaction condition；
(3) plasmid standard containing aim sequence is extracted, as quantitative fluorescent PCR positive template, carries out plasmid concentration detection,
The copy number of recombinant plasmid is calculated, plasmid is subjected to doubling dilution with 10 times of dilutions, as standard plasmid template, and
No template control is set up, fluorescent quantitative PCR is carried out, obtains amplification curve and standard curve；
(4) viral RNA for extracting sample to be tested, carries out fluorescent quantitative PCR, and detection extracts whether virus is infectiousness flesh
Meat necrosis virus is positive.
2. a kind of detection method of infectivity muscle necrosis virus according to claim 1, which is characterized in that the step
(3) in, quantitative fluorescent PCR reaction system are as follows: reaction 25 μ L of total volume, whereinProbe qPCR
12.5 μ L of SuperMix, 7.5 μ L of RNase Free Water, 1 μ L of forward primer, 1 μ L of reverse primer, 1 μ L of probe, 2 μ of template
L。
3. a kind of detection method of infectivity muscle necrosis virus according to claim 2, which is characterized in that the fluorescence
The condition of quantitative PCR are as follows: 94 DEG C of initial denaturation 5min, 95 DEG C of denaturation 15s, 60 DEG C of annealing extension 1min, 40 recycle.
4. a kind of detection method of infectivity muscle necrosis virus according to claim 1, which is characterized in that the step
(4) in, quantitative fluorescent PCR reaction system are as follows: reaction total volume is 25 μ L, wherein 2*OneStep RT-PCR Buffer III
It is 12.5 μ L, 0.5 μ L of TaKaRaEx Taq HS, 0.5 μ L of PrimeScript RT Enzyme MIXII, 1 μ L of forward primer, anti-
To 1 μ L of primer, 0.7 μ L of probe, ddH20 6.8 μ L, 2 μ L of template.
5. a kind of detection method of infectivity muscle necrosis virus according to claim 4, which is characterized in that the fluorescence
The condition of quantitative PCR are as follows: 42 DEG C of initial denaturation 5min, 95 DEG C of denaturation 10s, 95 DEG C of annealing 10s, 60 DEG C of extension 1min, 40 recycle.
6. a kind of detection method of infectivity muscle necrosis virus according to claim 1, which is characterized in that the step
(3) in, plasmid standard is diluted to 108-1018 concentration gradients of copy/μ L are as standard plasmid template.
7. a kind of detection method of infectivity muscle necrosis virus according to claim 1, which is characterized in that the step
(3) in, using ddH2O is as no template control.
8. a kind of detection method of infectivity muscle necrosis virus according to claim 1, which is characterized in that the step
(3) in, the plasmid standard containing aim sequence are as follows: go out aim sequence using the primer amplified in step (1), by mesh
Sequence be connected into pUC57-simple carrier, be then transformed into Escherichia coli expand it is numerous, from Escherichia coli extract needed for
Plasmid standard containing aim sequence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811636671.1A CN109468415A (en) | 2018-12-29 | 2018-12-29 | A kind of detection method of infectivity muscle necrosis virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811636671.1A CN109468415A (en) | 2018-12-29 | 2018-12-29 | A kind of detection method of infectivity muscle necrosis virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109468415A true CN109468415A (en) | 2019-03-15 |
Family
ID=65677044
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811636671.1A Pending CN109468415A (en) | 2018-12-29 | 2018-12-29 | A kind of detection method of infectivity muscle necrosis virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109468415A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102251057A (en) * | 2011-06-18 | 2011-11-23 | 鲁东大学 | RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection kit and method for prawn infective muscle necrosis virus by one-step process |
| US20120108649A1 (en) * | 2010-10-27 | 2012-05-03 | Harrisvaccines, Inc. | Methods and compositions to protect aquatic invertebrates from disease |
| CN102559484A (en) * | 2012-01-31 | 2012-07-11 | 鲁东大学 | Fluorescence quantitative PCR detection kit and detection method for prawn infectious myonecrosis viruses |
| CN105368985A (en) * | 2015-12-10 | 2016-03-02 | 国家海洋局第三海洋研究所 | Prawn TSV and IMNV fluorescent quantitative detection primer, probe and kit |
| CN106086233A (en) * | 2016-06-08 | 2016-11-09 | 山东拜尔检测有限公司 | The RT LAMP detection kit of infectivity muscle necrosis virus and detection method |
| WO2018056803A1 (en) * | 2016-09-21 | 2018-03-29 | Universiti Malaya | Rapid detection of prawn viruses, method and kit thereof |
-
2018
- 2018-12-29 CN CN201811636671.1A patent/CN109468415A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120108649A1 (en) * | 2010-10-27 | 2012-05-03 | Harrisvaccines, Inc. | Methods and compositions to protect aquatic invertebrates from disease |
| CN102251057A (en) * | 2011-06-18 | 2011-11-23 | 鲁东大学 | RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection kit and method for prawn infective muscle necrosis virus by one-step process |
| CN102559484A (en) * | 2012-01-31 | 2012-07-11 | 鲁东大学 | Fluorescence quantitative PCR detection kit and detection method for prawn infectious myonecrosis viruses |
| CN105368985A (en) * | 2015-12-10 | 2016-03-02 | 国家海洋局第三海洋研究所 | Prawn TSV and IMNV fluorescent quantitative detection primer, probe and kit |
| CN106086233A (en) * | 2016-06-08 | 2016-11-09 | 山东拜尔检测有限公司 | The RT LAMP detection kit of infectivity muscle necrosis virus and detection method |
| WO2018056803A1 (en) * | 2016-09-21 | 2018-03-29 | Universiti Malaya | Rapid detection of prawn viruses, method and kit thereof |
Non-Patent Citations (4)
| Title |
|---|
| NAIM,S等: ""Penaeid shrimp infectious myonecrosis virus isolate IMNV-ID-LP-11 complete genome"", 《GENBANK》 * |
| SHYAM KOKKATTUNIVARTHIL等: ""New set of PCR primers for SYBR green-based qPCR detection of IMNV in India"", 《AQUACULTURE》 * |
| THALES P.D. ANDRADE: ""Real-time reverse transcription polymerase chain reaction assay using TaqMan probe for detection and quantification of Infectious myonecrosis virus (IMNV)"", 《AQUACULTURE》 * |
| 刘鸿玲: ""对虾传染性肌肉坏死病毒PCR检测方法建立及样品检测"", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106636012B (en) | One boar lid his virus stain, vaccine combination and its preparation method and application | |
| CN107299155A (en) | A kind of primer and probe of goose astrovirus real-time fluorescence quantitative PCR detection | |
| CN112795704B (en) | RAA primer pair, probe combination and kit for detecting porcine pseudorabies virus | |
| CN112176105B (en) | Special primer for virus BVDV, BRV and BCV one-tube multiplex fluorescence PCR detection and application thereof | |
| CN103320535A (en) | Method for identifying wild strain and vaccine strain of hog cholera virus | |
| CN105463132A (en) | Genetic marker of canine parvovirus and specific primers as well as probe thereof | |
| CN110885900B (en) | Freeze-dried microchip, kit and method for identifying classical strain of porcine reproductive and respiratory syndrome virus and NADC30-Like strain | |
| CN108342510B (en) | Multiple RT-PCR kit for BTV-11 type, 17 type, 20 type, 23 type and 24 type genotype typing identification and detection method thereof | |
| CN110607398B (en) | RT-LAMP kit for fluorescent visual rapid detection of porcine epidemic diarrhea virus | |
| CN107287352A (en) | The probe primer group and its method of duck enteritis virus and duck hepatitis virus quick detection | |
| CN113249517A (en) | Primer, probe and kit for real-time fluorescent quantitative PCR (polymerase chain reaction) detection of bovine plague | |
| CN109468415A (en) | A kind of detection method of infectivity muscle necrosis virus | |
| CN111500773B (en) | Fluorescent quantitative RT-PCR primer, probe and kit for identification of serotype of epidemic hemorrhagic disease virus | |
| CN108324727A (en) | MiR-1307 or its precursor are preparing the application in preventing and/or treating the composition of mouth disease virus infection | |
| CN114592089A (en) | Triple TaqMan fluorescent quantitative PCR kit for simultaneously detecting three circovirus | |
| CN106834539A (en) | Highly pathogenic PRRSV and CSFV simultaneous quantitative detection kit | |
| CN112522446A (en) | Detection primer pair and kit for wild strain of porcine pseudorabies virus | |
| CN110885902B (en) | Freeze-drying microchip, kit and method for detecting porcine reproductive and respiratory syndrome virus and identifying highly pathogenic classical variant strain of porcine reproductive and respiratory syndrome virus | |
| CN112063757A (en) | Primer and kit for detecting African swine fever virus and application of primer and kit | |
| CN112877479A (en) | Primer for rapidly detecting exogenous viruses in porcine pseudorabies live vaccine and application of primer in kit | |
| CN108384889B (en) | Multiple RT-PCR kit for genotyping and identifying bluetongue virus and detection method thereof | |
| CN106702024B (en) | Kit for detecting Zika virus and application thereof | |
| CN115976273B (en) | Dual fluorescence PCR detection kit for identifying African swine fever virus genes type I and type II | |
| CN110093458A (en) | Detect Nest RT-PCR primer sets, kit and the application of the atypical pestivirus of pig | |
| CN111187859B (en) | Dual TaqMan qPCR detection method for detecting influenza C and influenza D |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: No.28, South 4th section, 1st ring road, Wuhou District, Chengdu, Sichuan 610041 Applicant after: Chengdu Customs Technology Center Address before: No.28, South 4th section, 1st ring road, Wuhou District, Chengdu, Sichuan 610041 Applicant before: SICHUAN ENTRY-EXIT INSPECTION AND QUARANTINE BUREAU INSPECTION AND QUARANTINE TECHNIQUE CENTER |
|
| CB02 | Change of applicant information | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190315 |
|
| RJ01 | Rejection of invention patent application after publication |