CN109457043B

CN109457043B - Real-timePCR detection primer and detection method for panax notoginseng root rot pathogenic bacteria fusarium oxysporum

Info

Publication number: CN109457043B
Application number: CN201811516523.6A
Authority: CN
Inventors: 刘迪秋; 李欣; 李珊; 张应鹏; 邱炳玲
Original assignee: Kunming University of Science and Technology
Current assignee: Kunming University of Science and Technology
Priority date: 2018-12-12
Filing date: 2018-12-12
Publication date: 2021-11-19
Anticipated expiration: 2038-12-12
Also published as: CN109457043A

Abstract

The invention discloses a Real-time PCR detection primer and a detection method for panax notoginseng root rot pathogen fusarium oxysporum, wherein the nucleotide sequence of the detection primer is as follows: an upstream primer Fo-QF, 5 'CTCAAACAGTGGTACATGCGAGG 3'; the downstream primer Fo-QR is 5 'CATCTAGGTCTTCCATCCACTTGA 3'; the invention designs a specific primer of the fusarium oxysporum, and establishes a standard curve for qualitative and quantitative molecular detection and accurate disease diagnosis of the fusarium oxysporum; the technology and the method can quickly obtain the complex pseudo-ginseng planting soil and the dynamic change of the quantity of fusarium oxysporum in the diseased pseudo-ginseng plant, thereby providing technical support for pseudo-ginseng soil treatment, early diagnosis and dynamic monitoring of root rot and molecular detection of diseased pseudo-ginseng seeds and seedlings.

Description

Real-timePCR detection primer and detection method for panax notoginseng root rot pathogenic bacteria fusarium oxysporum

Technical Field

The invention relates to a Real-time PCR detection primer and a detection method of fusarium oxysporum f.sp.c.f.sp.c.f.sp.c.f.sp.c.f.sp.c.f.sp.c.f.sp.c.f.sp.sp.sp.sp.c.f.sp.c.f.sp.sp.sp.sp.c.f.f.sp.f.sp.c.f.sp.f.sp.f.sp.f.sp.f.sp.f.sp.sp.f.sp.f.sp.sp.f.f.sp.f.f.sp.f.sp.f.sp.f.f.sp.f.sp.sp.f.sp.sp.f.sp.sp.sp.m.f.sp.sp.sp.sp.sp.sp.sp.sp.f.sp.sp.sp.sp.f.sp.sp.sp.f.sp.sp.sp.f.f.f.f.sp.sp.sp.f.f.f.sp.sp.f.sp.f.f.f.sp.f.f.sp.sp.f.f.sp.f.sp.sp.sp.f.f.f.f.f.sp.f.f.f.sp.f.f.f.f.f.f.f.sp.f.f.f.f.f.f.f.f.f.f.f.f.f.sp.sp.f.f.f.f.f.f.f.f.f.f.f.f.f.f.f.f.f.sp.f.f.f.f.f.f.f.f.f.f.f.f.f.f.f.f.f.f.sp.f.f.f. in field, which can be used in field for quick molecular detection of molecular and can be used in detecting field and detection of plant diseases.

Background

Notoginseng (radix Notoginseng)Panax notoginseng(Burk) F.H. Chen) Yuanqi, Shangeng, Tian san Qi, Shen san Qi, Xue Shen, Dian san Qi and so on, which have the reputations of "Nanguo Shen Cao" and "jin Bu Shi". The use of notoginseng for treating diseases for hundreds of years is recorded in the compendium of materia medica, wherein notoginseng has the efficacy of stopping bleeding, dissipating blood stasis and relieving pain, has special efficacy on incised wound, traumatic injury and bleeding, and also has the efficacy of detumescence, relieving pain, resisting inflammation, resisting aging, improving immunity and the like (Zhang Jing, Liu Gui celery, Wang Qingpeng plantResearch on chemical components of saponins in panax notoginseng, Chaocheng university school newspaper (Nature science edition), 2018,31 (2): 43-59.). The notoginseng contains various chemical components, wherein the total saponins of the notoginseng is one of main effective active components, and the content of the total saponins of the notoginseng is about 8 to 12 percent. In addition, the pseudo-ginseng also contains compounds such as alcohols, flavonoids, nucleosides, alkaloids, proteins, vitamin C and the like and various inorganic elements such as potassium, magnesium, calcium and the like, which is the special basis of the pseudo-ginseng with various effects.

Panax notoginseng has platelet aggregation inhibiting and thrombolytic effects, and can inhibit platelet adhesion and aggregation and prevent thrombosis by improving vascular endothelial function, improving blood flow state and improving blood components (Wang J, Huang ZG, et al, Screening of anti-platelet aggregation agents from)Panax notoginsenguse human plastelet extraction and HPLC-DAD-ESI-MS/MS. Journal of Separation Science 2015, 31 (6-7): 1173-1180.). Notoginsenoside can significantly reduce experimental thrombosis, inhibit thrombin-induced platelet aggregation in a dose-dependent manner, and inhibit increase of free calcium concentration in blood platelets of rats with thrombin-induced normal blood pressure and renal hypertension. Notoginseng radix also affects blood pressure, and Notoginseng radix total saponin has effects of directly dilating blood vessel and lowering blood pressure. At present, notoginsenoside is widely considered as a calcium channel blocker, and the vascular dilation mechanism of the notoginsenoside is probably that notoginsenoside blocks Ca caused by norepinephrine²⁺The function of the influx. It also has effects in lowering arterial pressure and slightly reducing heart rate, and can reduce heart workload (Liu Y, Hao F, et al.Panax notoginseng saponins promote endothelial progenitor cell mobilization and attenuate atherosclerotic lesions in apolipoprotein E knockout mice. Cellular Physiology &Biochemistry, 2013, 32 (4): 814-. Notoginseng radix also has anti-atherosclerosis effect. The compound capsule for treating thrombosis contains Notoginseng radix as main ingredient, and has effects in dilating the calibers of fine artery and vein, improving microcirculation, increasing blood perfusion of tissue, and prolonging tissue anoxia survival time.

The panax notoginseng is mainly produced in Yunnan Shanzhou, with the rapid development of the panax notoginseng industry in recent years, the planting area has changed greatly, the Yunnan producing area is expanded from the Shanzhou to the areas of Yunnan red river, Yuxi, Qujing, Kunming, Dali and the like, and Guizhou, Sichuan and the like start to be cultivated. With the increasing year by year of the planting area of the panax notoginseng, the problems of the panax notoginseng in large-scale production come along with the increase of the planting area of the panax notoginseng, and the current main reasons for restricting the sustainable development of the panax notoginseng have two aspects: firstly, the problem of continuous cropping obstacle is serious, the land resource suitable for planting pseudo-ginseng is increasingly tense in the actual production of pseudo-ginseng, the multiple cropping can be carried out after 10-15 years, and the continuous cropping obstacle greatly increases the planting cost of pseudo-ginseng. Secondly, there is no good new variety, the germplasm resources of panax notoginseng are seriously degraded, the types of diseases of panax notoginseng are increased year by year, the disease area is increased year by year, and the huge loss is caused to the large-scale production of panax notoginseng (treximing, chrysolol, etc. the current situation and the development strategy of the panax notoginseng industry in China. Chinese traditional medicine journal, 2014, 39(4): 553-557).

The root rot of panax notoginseng is the most serious disease in the growth process of panax notoginseng, the annual incidence rate is 5-20%, the serious disease rate is more than 70%, the roots of plants are rotten after the plants are infected with diseases, the overground parts of the plants are yellow and withered, and the plants are commonly called chicken droppings and rotten smelly seven. (Deng people, He Yingjie, Zhao Zheng Li. application of botanical nematicide "Lindi No. 1" in the prevention and treatment of root rot of Panax notoginseng. university of Yunnan school (Nature science), 2016, 30(S1): 57-62.). The main symptoms of the root rot of panax notoginseng include yellow rot type, dry crack type, rotten marrow type, acute withered type, wet rot type, dry stem type and the like, and the yellow rot type and the acute withered type are common. Isolated from rotten roots of Panax notoginseng (F.sp.) including Fusarium oxysporum (F.oxysporum: (F.sp.))Fusarium oxysporum) Fusarium fungi in the panax pseudoginseng is also separated into various pathogens such as bacteria and nematodes, and panax pseudoginseng root rot is considered to be caused by complex infection of the fungi, the bacteria and the nematodes (Jianni, ovarian spirifer, leaf cloud peak. research on panax pseudoginseng diseases, south agriculture proceedings 2011, 42(9): 1070-.

Fusarium oxysporum is a typical soil-borne disease fungus, is an important group in Fusarium, belongs to soil inhabitation bacteria, is a saprophytic bacteria which is large in quantity and active in soil and organic matters, has a wide host range, and can cause blight of more than 100 plants, thereby causing serious economic loss. The fusarium oxysporum infected plant blight is a worldwide soil-borne fungal disease, and germs are harmful plants from roots to cause vascular bundle diseases to cause plant withering and can occur in the whole growth period of the plants. Fusarium oxysporum invades into the plant body by using spore germination tubes or mycelia, directly enters the plant body from the wound of root tip and root or the formation point of lateral root, grows among cells of root cortex, then invades into a conduit through a schlieren of xylem, and grows upwards in the conduit to the stem and top of the plant (zhang, Yang dao, Chen Shi. identification of pathogenic fusarium species and research on dominant population of tomato wilt. Phytopathology report, 2016, 46 (4): 561-.

As a high-sensitivity and high-specificity nucleic acid detection means, the real-time fluorescence quantitative PCR technology is fast and accurate compared with a pathogen isolation culture and microscopic observation method, and has been widely applied to pathogen diagnosis and control research of plant diseases caused by fungi, bacteria, viruses, nematodes and the like. In addition, when the generation mechanism and the generation rule of plant diseases are researched, the dynamic change of the quantity of plant pathogenic fungi in a complex environment can be obtained, and the technical support is provided for prevention, early diagnosis and dynamic monitoring.

Disclosure of Invention

The invention provides a Real-time PCR molecular detection primer and a detection method for fusarium oxysporum of panax notoginseng root rot, aiming at the current situation that detection and identification of fusarium oxysporum of panax notoginseng root rot are mainly based on pathogenic morphological characteristics, the procedure is complicated, the time consumption is long, the identification experience requirement is high, the accuracy is low, the quantitative analysis of pathogenic bacteria cannot be carried out, and the quick and accurate diagnosis of the panax notoginseng root rot is difficult to meet.

In order to realize the purpose, the invention adopts the following technical scheme:

the invention firstly provides a Real-time PCR detection primer of panax notoginseng root rot pathogen fusarium oxysporum, and the nucleotide sequence is as follows:

upstream primer Fo-QF:5 'CTCAAACAGTGGTACATGCGAGG 3'

The downstream primer Fo-QR is 5 'CATCTAGGTCTTCCATCCACTTGA 3';

the primers Fo-QF and Fo-QR amplify 209 bp products of the specificity of the fusarium oxysporum of the panax notoginseng root rot.

The invention also provides a rapid detection method of panax notoginseng root rot germs, which comprises the following steps:

(1) extracting DNA of a panax notoginseng detection sample or soil;

(2) performing real-time fluorescence quantitative PCR amplification by using the extracted DNA of a panax notoginseng detection sample or soil as a template, wherein a real-time fluorescence quantitative PCR amplification reaction system is 20 mu L and comprises 10 mu L of 2 XSSYBR Green Mix, 7 mu L of nuclease-free water, 1 mu L of upstream primer Fo-QF (2 mu mol/L) and 1 mu L of downstream primer Fo-QR (2 mu mol/L) 1 mu L, DNA template; amplifying on a fluorescent quantitative PCR instrument, wherein the amplification procedure is 95 ℃ for 2 min, then carrying out 45 cyclic reactions, each cyclic reaction is 95 ℃ for 1min, 62 ℃ for 30s and 72 ℃ for 1min, and measuring the fluorescence value at 72 ℃; automatically collecting and recording fluorescence signals after each cycle is finished;

(3) establishment of real-time fluorescent quantitative PCR standard curve

Preparation of 35 ng/. mu.L recombinant plasmid pGEM-T-CYP505As a standard substance, 10 times of concentration gradient dilution is carried out, 5 gradients are arranged in total, the concentration is in the range of 0.0035 ng/mu L to 35 ng/mu L, and the dilution medium is nuclease-free water; carrying out real-time fluorescent quantitative PCR reaction on the standard substance with 5 gradients, wherein each gradient is set for 3 times of repetition; the fluorescent quantitative PCR reaction system and the amplification procedure are the same as the step (2), the fluorescence value is measured at 72 ℃, the fluorescent signal is collected and recorded after each cycle reaction is finished, the plasmid mass logarithm value corresponding to each gradient concentration is taken as the ordinate, the Ct value is taken as the abscissa, the linear regression equation is obtained, and a standard curve is established;

(4) if the fluorescence signal exists, the existence of the fusarium oxysporum which is the pathogenic bacterium of the root rot in the detected sample can be judged, the Ct value obtained in the previous step is substituted into the standard curve constructed by the invention, and the quantity of the fusarium oxysporum in the detected sample is calculated.

The invention has the advantages that:

(1) the accuracy is high: the invention designs a Real-time PCR primer with specific amplification effect on the fusarium oxysporum of the panax notoginseng root rot pathogen according to the characteristics of high conservation and species variability of a fungus deoxyribonucleic acid sequence in a fungal strain; the detection and analysis of the rotten roots of the panax notoginseng root rot disease plants and the healthy panax notoginseng roots in different planting bases are carried out, and a 209 bp strip can be specifically amplified only at the rotten roots of the panax notoginseng root rot disease plants, so that the primer designed by the invention is accurate and reliable in detecting panax notoginseng root rot disease pathogenic bacteria fusarium oxysporum;

(2) the specificity is strong: the primer designed by the invention has strong specificity to fusarium oxysporum, a pathogenic bacterium of panax notoginseng root rot, and can be used for distinguishing pathogenic bacteria of common diseases of panax notoginseng such as panax notoginseng root rot, panax notoginseng black spot and the like;

(3) the sensitivity is high: the designed specific primers are utilized to carry out Real-time PCR analysis, and the detection sensitivity of the fusarium oxysporum of the pathogenic bacteria of the panax notoginseng root rot can reach 0.35 pg/mu L on the DNA level;

(4) the applicability is wide, the practicality is good: the detection method of the pathogenic bacteria fusarium oxysporum of the panax notoginseng root rot can detect not only pathogenic bacteria mycelia, but also infected panax notoginseng roots, leaves, seeds, seedlings and soil, and can realize early detection of the panax notoginseng root rot, namely detection before disease manifestation, and prevention and treatment of large-area outbreak and epidemic of diseases.

Drawings

FIG. 1 is an amplification electrophoresis chart for verifying the specificity of Fusarium oxysporum fatty acid omega hydroxylase gene, wherein lane M is 2000bp DNA Marker, lane 2 is Sclerotinia sclerotiorum, lane 3 is Alternaria tabacum, lane 4 is Fusarium ginseng, lane 5 is Fusarium verticillium, lane 6 is Fusarium graminearum, lane 7 is Fusarium oxysporum, lane 8 is Fusarium solani, and lane 9 is a negative control (no template);

FIG. 2 is a real-time fluorescence quantitative PCR specific amplification curve (a) and a melting curve (b) of a primer pair of a pathogen fusarium oxysporum of panax notoginseng root rot, wherein eight DNA templates are respectively ginseng alternaria alternata, alternaria alternate, sclerotinia sclerotiorum, fusarium solani, fusarium oxysporum, fusarium verticillium, fusarium graminearum and gluconobacter viniferum;

FIG. 3 is a diagram showing the amplification curve of real-time fluorescent quantitative PCR of plasmids constructed by using Fusarium oxysporum fatty acid omega hydroxylase gene (CYP 505) fragment of the present invention, wherein the concentrations of 1 to 5 are 35ng/μ L, 3.5 ng/μ L, 0.35 ng/μ L, 0.035 ng/μ L and 0.0035ng/μ L respectively for recombinant plasmid pGEM-T-CYP505Real-time fluorescent quantitative amplification curve of the standard;

FIG. 4 is a standard curve diagram established with the Ct value as the abscissa and the logarithm value of the standard quality quantity of plasmid as the ordinate;

FIG. 5 is a graph showing the real-time fluorescent quantitative PCR amplification curve of 14 samples of Panax notoginseng and DNA of Panax notoginseng planting soil using the primers and detection method of the present invention, wherein 4 samples for detection of Ct values are No. 7, No. 8, No. 9 and No. 10, which are root samples of plants with root rot of Panax notoginseng.

Detailed Description

The present invention is further illustrated by the following figures and examples, without limiting the scope of the invention thereto, wherein the process is carried out in a conventional manner unless otherwise specified, and wherein reagents are used, such as reagents used or formulated in a conventional manner, unless otherwise specified.

Example 1: fusarium oxysporum fatty acid omega hydroxylase gene (CYP 505) specificity analysis

According to the previous research result, selecting fusarium oxysporum fatty acid omega hydroxylase (P450 foxy, AB 030037.1) gene as a gene locus for designing a specific PCR primer; the upstream and downstream primer sequences were Fo-F (5 'CATCCAACGCCGCCCACTTTATC 3') and Fo-R (5 'CAGCAACCACCAACGCTTCTTCG 3'), respectively. The primer sequence was synthesized by Kunming Shuoqing Biotech Co.

Several pathogenic fungi which are refrigerated and preserved are taken out of a refrigerator at 4 ℃, and are respectively ginseng alternaria (A), (B), (C)Alternaria panax) Alternaria alternata (A) and (B)Alternaria alternata) Sclerotinia sclerotiorum (A) and (B)Sclerotinia sclerotiorum) Fusarium solani (F.solani) (II)Fusarium solani) Fusarium oxysporum (F.), (Fusarium oxysporum) Fusarium verticillatum (A)Fusarium verticillioides) Fusarium graminearum (F.graminearum)Fusarium graminearum) Staphylococus viticola (A. vinifera)Botryosphaeria dothidea) (ii) a Inoculating a proper amount of hyphae into a fresh PDA culture medium, and then placing the hyphae into an incubator at 28 ℃ for culture; five days later, hyphae are scraped, genome DNA of several fungi is extracted by adopting a CTAB method, and the purity and the mass concentration of the extracted DNA are detected by adopting an ultraviolet spectrophotometer.

Carrying out PCR by taking the genomic DNA of the pathogenic fungi as a template so as to detect the specificity of the primer; the PCR reaction (20. mu.L) was as follows: 2 xRapid Taq Master Mix 10 uL, sterile double distilled water 7 uL, upstream primer Fo-F (2 uM) 1 uL, downstream primer Fo-R (2 uM) 1 uL, DNA template 1 uL; the PCR amplification conditions were: 3 min at 95 ℃; 28 cycles of 94 ℃ for 30s, 57 ℃ for 30s, 72 ℃ for 45 s; 5 min at 72 ℃; the PCR product was detected by 1.2% agarose gel electrophoresis, and the result is shown in FIG. 1, the pair of primers only produced about 400 bp of amplification product in the PCR amplification using Fusarium oxysporum DNA as the template, and the length of the amplification product is 378 bp. The primer designed by the invention can be preliminarily determined to have interspecific specificity, and the primer only generates a specific strip in the fusarium and does not cause effective amplification in other fusarium fungi, so that the fusarium can be specifically distinguished from other fusarium pathogenic bacteria.

Carrying out T-A cloning on the PCR product, selecting pGEM-T easy Vector System (Promega, USA) as a cloning Vector, connecting the cloning Vector with the PCR amplification product of the invention, transferring the connection product into escherichia coli DH5 alpha competent cells, then selecting positive clone sequencing, and carrying out bioinformatics analysis on the sequencing result; homology analysis of the sequenced sequence and the gene sequence in GenBank was carried out by using BLAST (http:// BLAST. ncbi. nlm. nih. gov/BLAST. cgi) online analysis tool, and the analysis result shows that the amplified sequence has 98% similarity with the fusarium oxysporum CYP505 gene (fatty acid omega hydroxylase). It can be seen that the primer designed by the invention can specifically amplify the gene segment of fatty acid omega hydroxylase of fusarium oxysporum.

Example 2: real-time fluorescent quantitative PCR primer design and specificity analysis

Specific primers for real-time fluorescent quantitative PCR were designed based on the gene sequences in the above examples, and the nucleotide sequences of the upstream and downstream primers were designed to be 5 'CTCAAACAGTGGTACATGCGAGG 3' (Fo-QF) and 5 'CATCTAGGTCTTCCATCCACTTGA 3' (Fo-QR), respectively, and synthesis of the primers was entrusted to Kunming Shuoji Biotech, Inc.

The genomic DNA of several pathogenic fungi of example 1 was used as a template for Real-time PCR, and fluorescent quantitative PCR was performed according to the following system to detect the specificity of the primers of the present invention. The fluorescent quantitative PCR reaction system (20 μ L) comprises 7 μ L of nuclease-free water, 10 μ L of 2 XSSYBR Green Mix, 1 μ L of upstream primer Fo-QF (2 μ M), 1 μ L of downstream primer Fo-QR (2 μ M) and 1 μ L of template L, DNA; amplifying on a fluorescent quantitative PCR instrument, wherein the amplification spectrum is 95 ℃ for 2 min, then carrying out 45 cycles of reactions, wherein each cycle of reaction comprises measuring the fluorescence value at 95 ℃ for 1min, 62 ℃ for 30s, and 72 ℃ for 1min at 72 ℃, and automatically collecting and recording the fluorescence signal after each cycle is finished.

Each fungus DNA template is provided with 3 times of repetition, negative control (no template DNA is added, and nuclease-free water is used for replacing) is arranged for detecting whether template pollution exists or not and generating primer dimer, a specific amplification curve is shown in figure 2a, effective amplification is only generated in Real-time PCR reaction with fusarium oxysporum DNA as a template, three repetitions obtain three coincident amplification curves, Ct values of the three coincident amplification curves are 26.33, 26.37 and 26.48 respectively, and the Real-time PCR primer has good specificity and has no amplification in other pathogenic fungi and negative control. Furthermore, the melting curve chart (2b) also shows that the primer of the present invention has good specificity, no primer dimer is produced, and no mismatched PCR product is formed.

Example 3: establishment of real-time fluorescent quantitative PCR standard curve

Escherichia coli carrying zhib of the Fusarium oxysporum fatty acid omega hydroxylase gene fragment in example 1 was spread on a solid LB plate medium, inverted at 37 ℃ for overnight growth for 12 hours, then a single colony was picked from the LB plate with an autoclaved toothpick, inoculated into a liquid LB medium to which ampicillin was added, shake-cultured at 37 ℃ at 200 rpm/min for 12 hours, then plasmids were extracted with a SanPrep column type plasmid DNA miniprep kit (Shanghai Prov.), the concentration of the plasmids was determined with an ultraviolet spectrophotometer, and the extracted plasmids were placed at-80 ℃ for use.

Plasmid with determined concentration is used as a standard substance, 10 times of concentration gradient dilution is carried out, 5 gradients are set, 35 ng/mu L, 3.5 ng/mu L, 0.35 ng/mu L, 0.035 ng/mu L and 0.0035 ng/mu L are respectively arranged, and the dilution medium is nuclease-free water. The 5-gradient standards were subjected to real-time fluorescent quantitative PCR reactions, with 3 replicates per gradient setup. The fluorescent quantitative PCR reaction system (20 mu L) comprises 7 mu L of nuclease-free water, 10 mu L of 2 XSSYBR Green Mix fluorescent quantitative PCR reaction premix, 1 mu L of upstream primer Fo-QF (2 mu M), 1 mu L of downstream primer Fo-QR (2 mu M) and 1 mu L of DNA template, wherein the template is plasmid standard products with 5 mass concentration gradients. Amplifying on a fluorescent quantitative PCR instrument, wherein the amplification spectrum is 95 ℃ for 2 min, then carrying out 45 cyclic reactions, each cyclic reaction is 95 ℃ for 1min, 62 ℃ for 30s and 72 ℃ for 1min, measuring the fluorescence value at 72 ℃, and automatically collecting and recording the fluorescence signal after each cycle is finished;

the Real-time PCR amplification curve of the plasmid standard is shown in figure 3, the Ct value of the obtained Real-time PCR is shown in table 1, meanwhile, the plasmid mass logarithm value corresponding to each gradient concentration is taken as the ordinate, the Ct value is taken as the abscissa, a standard curve is generated in Excel software, and the linear regression equation of y = -0.2904x +4.3445 is obtained, R is R = -0.2904x +4.3445²=0.9983, standard curve is established as shown in fig. 4, the slope of the curve is-0.2904 (between-1 ~ 0), the correlation coefficient (R)²) Is 0.9983.

TABLE 1 Ct values of Fusarium oxysporum plasmid standards

；

In addition, further experimental results show that when the concentration of the template is lower than 0.35 pg/mu L, the Ct value and the template concentration (log value) do not have a linear relation any more, which indicates that the minimum template concentration of the real-time fluorescence quantitative PCR detection of the fusarium oxysporum established by the invention is 0.35 pg/mu L. Therefore, the real-time fluorescent quantitative PCR detection method established by the invention has high sensitivity.

Example 4: application of pseudo-ginseng root rot pathogen fusarium oxysporum Real-time PCR detection method

The pseudo-ginseng diseases of the pseudo-ginseng planting base are mainly root rot and black spot, pseudo-ginseng diseased plants with typical symptoms of root rot and black spot and pseudo-ginseng planting soil are collected in the main production area of pseudo-ginseng in Wenshan, and a plurality of samples are analyzed by applying the fusarium oxysporum specific Real-time PCR primer and the detection method thereof designed by the invention.

Numbering collected samples, wherein 1-2 is a healthy pseudo-ginseng leaf sample, 3-4 is a diseased leaf sample, 5-6 is a healthy pseudo-ginseng root sample, 7-10 is a root rot sample, 11-12 is a soil sample of a root rot diseased plant, 13-14 is a healthy pseudo-ginseng root soil sample, and 15 is a no-template negative control; extracting total DNA of each sample by using a CTAB method, wherein the DNA number is the same as that of the sample, and then performing fluorescent quantitative PCR reaction by using the DNA of the sample, wherein the amplification reaction system is 20 mu L and comprises 7 mu L of nuclease-free water, 10 mu L of 2 xSYBR Green Mix, 1 mu L of upstream primer Fo-QF (2 mu M) and 1 mu L of downstream primer Fo-QR (2 mu M) 1 mu L, DNA template; amplifying on a fluorescent quantitative PCR instrument, wherein the amplification spectrum is 95 ℃ for 2 min, then carrying out 45-cycle reactions, each cycle reaction is 95 ℃ for 1min, 62 ℃ for 30s and 72 ℃ for 1min, measuring the fluorescence value at 72 ℃, and automatically collecting and recording the fluorescence signal after each cycle is finished.

The resulting amplification curves are shown in FIG. 5, where it can be seen that samples Nos. 7-10 had amplification, and none of the remaining samples had amplification. From the table 2, it can be seen that the average Ct values of the samples 7-10 are 29.53, 32.20, 33.77 and 33.22, respectively, the content of fusarium oxysporum is above 10 pg/g sample, and the high content reaches 177 pg/g sample, which indicates that fusarium oxysporum exists in the panax notoginseng root rot disease strain sample. Because the quantity of the fusarium oxysporum carried in the soil is very small, the fusarium oxysporum is not detected in the soil sample of the root rot disease strain collected at this time. In addition, fusarium oxysporum was not detected in the healthy root of panax notoginseng, healthy leaves of panax notoginseng, melasma leaves, and healthy root soil of panax notoginseng.

The experimental results show that the primer and the real-time fluorescent quantitative PCR amplification detection method can accurately distinguish the root rot sample of panax notoginseng, and detect the minimum pathogenic bacteria DNA of 0.35 pg/mu L, so that the primer designed by the invention and the established real-time fluorescent quantitative PCR method have good specificity, sensitivity and reliability, and can achieve the purpose of specifically detecting the fusarium oxysporum of panax notoginseng.

Real-time fluorescent quantitative PCR (polymerase chain reaction) results of table 214 panax notoginseng and soil detection samples

。

Sequence listing

<110> university of Kunming science

<120> Real-time PCR detection primers and detection method for panax notoginseng root rot pathogenic bacteria fusarium oxysporum

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial sequence (Artificial)

<400> 1

catccaacgc cgcccacttt atc 23

<210> 2

<211> 23

<212> DNA

<213> Artificial sequence (Artificial)

<400> 2

cagcaaccac caacgcttct tcg 23

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence (Artificial)

<400> 3

ctcaaacagt ggtacatgcg agg 23

<210> 4

<211> 24

<212> DNA

<213> Artificial sequence (Artificial)

<400> 4

catctaggtc ttccatccac ttga 24

Claims

1. A method for detecting fusarium oxysporum, a pathogenic bacterium of root rot, in pseudo-ginseng is characterized by comprising the following steps:

(1) extracting DNA of a panax notoginseng detection sample or soil;

(2) performing real-time fluorescent quantitative PCR amplification by taking the extracted DNA as a template, wherein the amplification procedure is 95 ℃ for 2 min, then performing 45 cyclic reactions, each cyclic reaction is 95 ℃ for 1min, 62 ℃ for 30s and 72 ℃ for 1min, measuring the fluorescence value at 72 ℃, and collecting and recording the fluorescence signal after each cyclic reaction is finished;

(3) establishment of real-time fluorescent quantitative PCR standard curve

The recombinant plasmid pGEM-T-CYP505The solution is subjected to real-time fluorescent quantitative PCR reaction on solutions with different concentrations, the amplification procedure is the same as the step (2), the fluorescence value is measured at 72 ℃, the fluorescence signal is collected and recorded after each cycle reaction is finished, the plasmid mass logarithm value corresponding to each gradient concentration is taken as the ordinate, the Ct value is taken as the abscissa, a linear regression equation is obtained, and a standard curve is established;

(4) if a fluorescence signal appears, judging that the fusarium oxysporum of the pathogenic bacteria of the root rot exists in the detected sample, substituting the obtained Ct value into a standard curve of the fusarium oxysporum, and calculating to obtain the quality of the fusarium oxysporum in the detected sample;

the reaction system of the real-time fluorescent quantitative PCR is 20 mu L, and comprises 2 XSSYBR Green Mix 10 mu L, nuclease-free water 7 mu L, an upstream primer Fo-QF 1 mu L and a downstream primer Fo-QR 1 mu L, DNA template 1 mu L;

upstream primer Fo-QF:5 'CTCAAACAGTGGTACATGCGAGG 3'

The downstream primer Fo-QR:5 'CATCTAGGTCTTCCATCCACTTGA 3'.

2. The method of claim 1, wherein: the concentration of the upstream primer Fo-QF and the concentration of the downstream primer Fo-QR are both 2 mu mol/L.