CN109457038B - Primer and detection method for detecting lactococcus lactis BL19 - Google Patents
Primer and detection method for detecting lactococcus lactis BL19 Download PDFInfo
- Publication number
- CN109457038B CN109457038B CN201910044708.XA CN201910044708A CN109457038B CN 109457038 B CN109457038 B CN 109457038B CN 201910044708 A CN201910044708 A CN 201910044708A CN 109457038 B CN109457038 B CN 109457038B
- Authority
- CN
- China
- Prior art keywords
- primer
- lactococcus lactis
- sample
- seq
- detection method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer and a detection method for detecting lactococcus lactis BL19, belonging to the technical field of genetic engineering, wherein the primer comprises an upstream primer and a downstream primer; the upstream primer has a nucleotide sequence shown as SEQ ID No. 1; the downstream primer has a nucleotide sequence shown in SEQ ID No. 2. The primer provided by the invention has specificity to lactococcus lactis BL 19.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a primer and a detection method for detecting lactococcus lactis BL 19.
Background
Lactic Acid Bacteria (LAB) contain a variety of industrially important genera including Enterococcus (Enterococcus), Lactobacillus (Lactobacillus), Lactococcus (Lactococcus), Leuconostoc (Leuconostoc), Oenococcus (Oenococcus), Pediococcus (Pediococcus) and Streptococcus (Streptococcus). Lactococcus lactis, a typical lactic acid bacterium, has unique fermentation characteristics and proteolytic ability. Therefore, lactococcus lactis is usually used as a starter of fermented dairy products, and is usually used in the production process of fermented dairy products such as cheese and yogurt. Lactococcus lactis has extremely important economic value as a dairy product starter. However, as related industries of leavening agents in China are relatively laggard, most of leavening agents applied at present are imported, and leavening agent strains with independent intellectual property rights are lacked. However, the domestic leavening agents on the market in China usually have poor fermentation characteristics or obvious defects. Therefore, it is imperative to develop and protect starter strains.
Lactococcus lactis (Lactococcus lactis) BL19 is a starter strain which is separated from traditional fermented dairy yogurt of Russian British and has excellent fermentation characteristics, has good protein hydrolysis capacity and acid production characteristics, and generates unique cheese flavor in the fermentation process. Lactococcus lactis BL19 is therefore suitable as a starter for the production of fermented milk, but no specific primers for this strain are known.
Disclosure of Invention
The invention aims to provide a primer for detecting lactococcus lactis BL19, and the primer provided by the invention has specificity to lactococcus lactis BL 19.
The invention provides a primer for detecting lactococcus lactis BL19, which comprises an upstream primer and a downstream primer;
the upstream primer has a nucleotide sequence shown as SEQ ID No. 1;
the downstream primer has a nucleotide sequence shown in SEQ ID No. 2.
The invention provides a method for detecting lactococcus lactis BL19, which comprises the following steps: extracting the genome DNA of a sample to be detected, carrying out PCR amplification by using the primer in the technical scheme by using the genome DNA as a template to obtain an amplification product, wherein the sample to be detected contains lactococcus lactis BL19 when the fragment of the amplification product is 324 bp.
Preferably, the PCR amplification system comprises 10 XPCR mix10 uL of each 50 uL, 0.4 uL of each 10mol/L upstream and downstream primers, 100ng genomic DNA, ddH2O was supplemented to 50. mu.L.
Preferably, the procedure of PCR amplification comprises: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 deg.C for 1min, annealing at 60 deg.C for 45s, extension at 72 deg.C for 90s, and circulating for 30 times; finally, extension is carried out for 7min at 72 ℃ and storage is carried out at 4 ℃. .
Preferably, the sample to be tested comprises fermented yoghurt.
The invention provides a primer for detecting lactococcus lactis BL19, which comprises an upstream primer and a downstream primer; the upstream primer has a nucleotide sequence shown as SEQ ID No. 1; the downstream primer has a nucleotide sequence shown in SEQ ID No. 2. The primer provided by the invention has specificity to lactococcus lactis BL 19.
Drawings
FIG. 1 is a gel diagram of specific primer-verified electrophoresis;
FIG. 2 is an electrophoresis gel diagram of a sample to be tested using specific primers.
Detailed Description
The invention provides a primer for detecting lactococcus lactis BL19, which is characterized by comprising an upstream primer and a downstream primer; the upstream primer has a nucleotide sequence shown as SEQ ID No. 1; the downstream primer has a nucleotide sequence shown in SEQ ID No. 2.
In the invention, the upstream primer has a nucleotide sequence shown as SEQ ID No.1, and the specific sequence is as follows:
ATCATCGGATAGTCCTGCGTTTT；
the upstream primer has a nucleotide sequence shown as SEQ ID No.2, and the specific sequence is as follows:
TGTTGCTGTCATTTTAGGGTTAC。
in the invention, the primer is designed according to a section of specific fragment in the whole genome sequence of lactococcus lactis BL19, the specific fragment has a nucleotide sequence shown in SEQ ID No.3, and the specific sequence is as follows:
GTGCGTGAGGCAGTATTTGGGATTAGTCGAAGAAAAGTTTATACAACCGAAGTTTATGTCGGATTGAACCCCGAGTTTATGCTTAAAAGTCACCTGTTGTTGCCTGCTGCGTATGCCAACACCGTCTTAAATTACTTACTTGATTTCCAGCGGGAAACGACAGAATATCAAAAAATGTATGCTGAGTCTAAGCCATATCAGACCGGTGATTTATATGTATTTGGCGACCCAGACTGGCAACATCCGGATTATCCTAATGGTCTAGCACTCTTTGACCCTAAGCATAATGTTGCTGTCATTTTAGGGTTACGGTATTTTGGCGAGTATAAGAAGGCGACTTTGACTCTGGCTTGGGCGACAGCGCATGACAATAATTATATTGCTTGTCATGGTGGGATGAAACAGTACACCTTGAGTGATGGTAAAAAGTATACCATGGCGGCATTTGGTTTGTCGGGTTCAGGAAAGTCGACGATTACGCTAGCTAAGAATGATAGTAAATATCAAGTGACCTTCTTACATGATGATGCCTTTATTATTAATCATCAAGATGGCTCGACGACAGCTTTGGAGCCTGCTTATTTTGATAAAACGCAGGACTATCCGATGATGAGAGAAATGGTCAAATATTTCTTGACCTGTCAAAATGTTGGTGTCACGCTAGATGAAGTTGGGAAGAAAGTTATTGTTACAGAAGATATTCGAAATGGTAACGGTCGAACAGTCAAGTCTAAACTGGTCACGCCGAATCGTGTGGACCATATTAAAGAGAAAATCAATGCTGTTTACTGGATTATGCAAGATGAGAGTTTGCCACCAGTTGTCAAGGTCAGCGACCTTAATTTGGCATCTATTTTTGGTTTAACACTTGCGACCAAACGCTCAACGGCTGAAAATATCGTTGGGGATATTGATGTAAATGAAATTGTGATTGAATCTTTTGCTAATCCGTTTCGCTCATATGCACTGGGTGAAGATTTCACGGCCTTTAAAAAGTTGTTTGAGGATAAAGCGGTTGACTGTTATATACTGAATACGGGTTATTTTAATGGTGCAAAAATTAAGCCACACCATACACTAGGCGCGATTGAGACGATTATTGATGGTATTGGTAATTTTGTGCCTTTTGGACCAATTGAAGGTCTATCTTATCTGCCAATCAAACATCTCAATCCCGACTTTGAACATGAGGGTTATGTTGCATCCTTAAAAGCAAGTATGACAGAACGTTTACGGTTCATTGAGTCTAAAAAATTGGAAATGAATGCCTACCATGCCTTACCATTGGGGACAGAGGATGCTGTTAAAAAGATTTTAGCGGCGCTTGGCTAA。
the invention also provides a method for detecting lactococcus lactis BL19, which comprises the following steps: extracting the genome DNA of a sample to be detected, carrying out PCR amplification by using the primer in the technical scheme by using the genome DNA as a template to obtain an amplification product, wherein the sample to be detected contains lactococcus lactis BL19 when the fragment of the amplification product is 324 bp.
The method for extracting the genome DNA of the sample to be detected is not particularly limited, and a conventional extraction method is adopted.
In the present invention, the system used for PCR amplification preferably comprises 10 XPCR mix10 μ L per 50 μ L, 0.4 μ L each of 10mol/L upstream and downstream primers, 100ng of genomic DNA, ddH2O was supplemented to 50. mu.L.
In the present invention, the procedure of PCR amplification preferably includes: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 deg.C for 1min, annealing at 60 deg.C for 45s, extension at 72 deg.C for 90s, and circulating for 30 times; finally, extension is carried out for 7min at 72 ℃ and storage is carried out at 4 ℃.
In the present invention, the sample to be tested preferably comprises fermented yogurt.
The primer and the detection method for detecting lactococcus lactis BL19 according to the present invention are further described in detail with reference to the following specific examples, and the technical solutions of the present invention include, but are not limited to, the following examples.
Example 1
Lactococcus lactis (Lactococcus lactis) BL19 specific primer specificity test
1. Extracting metagenome DNA in the fermented dairy product sample:
washing 1.0g of sample, placing the washed thallus in a 1.5mL centrifuge tube, immediately placing the thallus in liquid nitrogen for complete freezing, taking out the thallus, placing the thallus in a 65 ℃ water bath for 5min, repeatedly freezing and thawing for 3 times, adding 0.1mL of SDS and 10.0 mu L of 10mg/mL proteinase K, shaking the thallus in a 37 ℃ constant temperature shaking table at 200r/min for 2h, centrifuging at the room temperature of 12000g for 10min, collecting supernatant, transferring the supernatant into another centrifuge tube, centrifuging the supernatant and isometric chloroform at 12000g for 10min, sucking the supernatant, transferring the supernatant into another centrifuge tube for phenol-chloroform extraction for 2 times, precipitating total DNA by 0.1 time volume of glacial propionic acid, then washing and precipitating twice by 70% ethanol, and dissolving back for standby.
2. Lactococcus lactis (Lactococcus lactis) BL19 specific primer specificity detection
Based on a specific fragment (SEQ ID No.3) in the whole genome sequence of Lactococcus lactis BL19, the following primer sequences are designed:
BL19R(SEQ ID No.2)：TGTTGCTGTCATTTTAGGGTTAC；
BL19F(SEQ IDNo.1)：ATCATCGGATAGTCCTGCGTTTT。
after designing a Lactococcus lactis BL19 specific primer, the specificity of the primer is verified, and a strain which has higher taxonomic position homology with Lactococcus lactis BL19, such as Lactococcus lactis subspT、Lactococcus lactis subsp.cremoris ATCC19257T、Lactococcus lactis subsp.tructae DSM2152T、Lactococcus lactis subsp.hordniae DSM20450T、Streptococcus thermophiles ATCC19258T、Streptococcus tigurinus DSM24864T、Streptococcus suis ATCC43765T、Streptococcus sobrinus ATCC33478T、Streptococcus sinensis DSM14990T、Streptococcus shiloi ATCC51499T、Streptococcus sanguinis ATCC10556T、Streptococcus saliviloxodontae JSM19288T、Streptococcus salivarius ATCC7073T、Streptococcus saccharolyticus ATCC43076T、Bacteroidesfragilis JCM 11019T、Bifidobacterium animalis DSM10140T、Bifidobacterium breve ATCC 15700、Bifidobacterium longumATCC15697、Enterococcus faecalis ATCC 19433T、Enterococcus faecium ATCC19434, Escherichia coli JCM 1649 and Lactobacillus acidophilus ATCC4356TIn total 22 strains were subjected to PCR amplification and alignment analysis.
An amplification system:
reaction system 50 μ L: 10 XPCRmix 10 μ L, 10mol/L upstream and downstream primers 0.4 μ L each, DNA template 100ng, ddH2O is supplemented to 50 mu L;
amplification conditions:
pre-denaturation at 95 deg.C for 5min3 min; denaturation at 95 deg.C for 1min, annealing at 60 deg.C for 45s, extension at 72 deg.C for 1min for 90s, and circulating for 30 times; finally, extension is carried out for 7min at 72 ℃ and storage is carried out at 4 ℃.
Agarose gel electrophoresis
Performing electrophoresis on the PCR product and 1% agarose gel at a voltage of 5V/cm for 20-30min, dyeing, performing ultraviolet photography, and detecting the amplification effect; the specificity of the Lactococcus lactis BL19 specific primer is determined to be good or not according to whether an expected characteristic band appears at 324bp or not by taking Lactococcus lactis BL19 strain DNA containing a target amplified fragment as a positive control of a template and sterile water as a negative control of the template.
As shown in FIG. 1, the primer amplified only Lactococcus lactis BL19, but did not amplify the remaining 22 strains. The comparison amplification experiment shows that the primer designed by the invention has good specificity.
Example 2
Qualitative detection of Lactococcus lactis (Lactococcus lactis) BL19
1. Extraction of metagenomic DNA from fermented dairy product (or feces) sample
A sample of yogurt fermented with Lactococcus lactis (Lactococcus lactis) BL19 was collected as sample 1, and feces of volunteers who took Lactococcus lactis (Lactococcus lactis) BL19 fermented yogurt samples were collected as sample 2. Adopting a liquid nitrogen freeze thawing-CTAB method: washing 1.0g of sample, putting the eluted thallus into a 1.5mL centrifuge tube, immediately putting the centrifuge tube into liquid nitrogen for complete freezing, taking out the thallus, putting the thallus into a 65 ℃ water bath for thawing (about 5min), repeatedly freezing and thawing for 3 times, adding 0.1mL 10% SDS and 10.0 mu L10 mg/mL proteinase K, shaking for 2h at 200r/min in a constant temperature shaking table at 37 ℃, centrifuging for 10min at 10000g at room temperature, and collecting supernatant and transferring the supernatant into another centrifuge tube. Centrifuging the supernatant with equal volume of chloroform at 10000g for 10min (to separate the precipitate, aqueous phase and organic phase), sucking the supernatant and transferring to another centrifuge tube to perform phenol chloroform extraction for 2 times, precipitating total DNA with 0.1 times volume of sodium acetate and 1 time volume of ice isopropanol, washing the precipitate with 70% ethanol for 2 times, and re-dissolving for later use.
2. Specific amplification of Lactococcus lactis (Lactococcus lactis) BL19 specific primers
An amplification system:
reaction system 50 μ L: 10 XPCRmix 10 μ L, 10mol/L upstream and downstream primers 0.4 μ L each, DNA template 100ng, ddH2O is supplemented to 50 mu L;
amplification conditions:
pre-denaturation at 95 ℃ for 3 min; denaturation at 95 deg.C for 1min, annealing at 60 deg.C for 45s, extension at 72 deg.C for 90s, and circulating for 30 times; finally, extension is carried out for 7min at 72 ℃ and storage is carried out at 4 ℃.
The primer sequence is as follows:
BL19R(SEQ ID No.2)：TGTTGCTGTCATTTTAGGGTTAC；
BL19F(SEQ IDNo.1)：ATCATCGGATAGTCCTGCGTTTT。
agarose gel electrophoresis
Performing electrophoresis on the PCR product and 1% agarose gel at a voltage of 5V/cm for 20-30min, dyeing, performing ultraviolet photography, and detecting the amplification effect; the positive control of the template is Lactococcus lactis BL19 strain DNA containing the target amplified fragment, the negative control of the template is sterile water, and whether the sample contains Lactococcus lactis BL19 is determined according to whether an expected characteristic band appears at 324 bp.
The amplification effect is shown in FIG. 2, sample 1 is an unknown sample, sample BL19 is a positive control using the strain DNA containing the target amplified fragment as a template, sample 2 is a negative control using sterilized water as a template, and sample 3 is an unknown sample for detection. As can be seen from the figure, the positive control can amplify the target band with clear and bright band, while the negative control has no corresponding amplification product. While sample 1 contained Lactococcus lactis (Lactococcus lactis) BL19, sample 3 did not contain Lactococcus lactis (Lactococcus lactis) BL 19.
From the above examples, it can be seen that the primers provided by the present invention are specific to lactococcus lactis BL 19.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> university of inner Mongolia agriculture
<120> primer for detecting lactococcus lactis BL19 and detection method
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atcatcggat agtcctgcgt ttt 23
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tgttgctgtc attttagggt tac 23
<210> 3
<211> 1332
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gtgcgtgagg cagtatttgg gattagtcga agaaaagttt atacaaccga agtttatgtc 60
ggattgaacc ccgagtttat gcttaaaagt cacctgttgt tgcctgctgc gtatgccaac 120
accgtcttaa attacttact tgatttccag cgggaaacga cagaatatca aaaaatgtat 180
gctgagtcta agccatatca gaccggtgat ttatatgtat ttggcgaccc agactggcaa 240
catccggatt atcctaatgg tctagcactc tttgacccta agcataatgt tgctgtcatt 300
ttagggttac ggtattttgg cgagtataag aaggcgactt tgactctggc ttgggcgaca 360
gcgcatgaca ataattatat tgcttgtcat ggtgggatga aacagtacac cttgagtgat 420
ggtaaaaagt ataccatggc ggcatttggt ttgtcgggtt caggaaagtc gacgattacg 480
ctagctaaga atgatagtaa atatcaagtg accttcttac atgatgatgc ctttattatt 540
aatcatcaag atggctcgac gacagctttg gagcctgctt attttgataa aacgcaggac 600
tatccgatga tgagagaaat ggtcaaatat ttcttgacct gtcaaaatgt tggtgtcacg 660
ctagatgaag ttgggaagaa agttattgtt acagaagata ttcgaaatgg taacggtcga 720
acagtcaagt ctaaactggt cacgccgaat cgtgtggacc atattaaaga gaaaatcaat 780
gctgtttact ggattatgca agatgagagt ttgccaccag ttgtcaaggt cagcgacctt 840
aatttggcat ctatttttgg tttaacactt gcgaccaaac gctcaacggc tgaaaatatc 900
gttggggata ttgatgtaaa tgaaattgtg attgaatctt ttgctaatcc gtttcgctca 960
tatgcactgg gtgaagattt cacggccttt aaaaagttgt ttgaggataa agcggttgac 1020
tgttatatac tgaatacggg ttattttaat ggtgcaaaaa ttaagccaca ccatacacta 1080
ggcgcgattg agacgattat tgatggtatt ggtaattttg tgccttttgg accaattgaa 1140
ggtctatctt atctgccaat caaacatctc aatcccgact ttgaacatga gggttatgtt 1200
gcatccttaa aagcaagtat gacagaacgt ttacggttca ttgagtctaa aaaattggaa 1260
atgaatgcct accatgcctt accattgggg acagaggatg ctgttaaaaa gattttagcg 1320
gcgcttggct aa 1332
Claims (4)
1. A method of detecting lactococcus lactis BL19, comprising: extracting genome DNA of a sample to be detected, performing PCR amplification by using the genome DNA as a template and a primer to obtain an amplification product, wherein the sample to be detected contains lactococcus lactis BL19 when the fragment of the amplification product is 324 bp;
the primers comprise an upstream primer and a downstream primer;
the upstream primer has a nucleotide sequence shown as SEQ ID No. 1;
the downstream primer has a nucleotide sequence shown as SEQ ID No. 2.
2. The detection method according to claim 1, wherein the PCR amplification system comprises 10 XPCRmix 10. mu.L of 10mol/L of upstream and downstream primers, 0.4. mu.L of genomic DNA100ng, ddH, and a total of 50. mu.L2O was supplemented to 50. mu.L.
3. The detection method according to claim 1 or 2, wherein the PCR amplification procedure comprises: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 deg.C for 1min, annealing at 60 deg.C for 45s, extension at 72 deg.C for 90s, and circulating for 30 times; finally, extension is carried out for 7min at 72 ℃ and storage is carried out at 4 ℃.
4. The assay of claim 1, wherein the sample to be assayed comprises fermented yogurt.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910044708.XA CN109457038B (en) | 2019-01-17 | 2019-01-17 | Primer and detection method for detecting lactococcus lactis BL19 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910044708.XA CN109457038B (en) | 2019-01-17 | 2019-01-17 | Primer and detection method for detecting lactococcus lactis BL19 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109457038A CN109457038A (en) | 2019-03-12 |
| CN109457038B true CN109457038B (en) | 2021-08-10 |
Family
ID=65616321
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910044708.XA Active CN109457038B (en) | 2019-01-17 | 2019-01-17 | Primer and detection method for detecting lactococcus lactis BL19 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109457038B (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2007244348A (en) * | 2006-03-20 | 2007-09-27 | Fujicco Co Ltd | Primer set for detecting lactococcus lactis subsp. cremoris fc strain, and method for molecularly identifying lactococcus lactis subsp. cremoris fc strain by using the primer set |
| CN101717828A (en) * | 2009-12-14 | 2010-06-02 | 内蒙古农业大学 | Method for rapidly detecting kinds of lactobacillus in fermented dairy product |
| JP2011217734A (en) * | 2010-03-23 | 2011-11-04 | Morinaga Milk Ind Co Ltd | Method for identifying lactococcus strain |
| CN104480203A (en) * | 2014-12-08 | 2015-04-01 | 上海理工大学 | Primer, method and kit for rapidly detecting lactococcus lactis |
| CN106480214A (en) * | 2016-10-28 | 2017-03-08 | 保龄宝生物股份有限公司 | A kind of PCR quick detection special primer of Lactobacillus helveticus and method |
| CN107937581A (en) * | 2017-12-28 | 2018-04-20 | 内蒙古农业大学 | Amplimer for lactic acid bacteria sequencing is to, lactic acid bacteria kind identification method and application |
| CN109022330A (en) * | 2018-09-12 | 2018-12-18 | 内蒙古农业大学 | One plant has high proteolytic ability and produces Lactococcus lactis BL19 and its application of junket fragrance |
-
2019
- 2019-01-17 CN CN201910044708.XA patent/CN109457038B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2007244348A (en) * | 2006-03-20 | 2007-09-27 | Fujicco Co Ltd | Primer set for detecting lactococcus lactis subsp. cremoris fc strain, and method for molecularly identifying lactococcus lactis subsp. cremoris fc strain by using the primer set |
| CN101717828A (en) * | 2009-12-14 | 2010-06-02 | 内蒙古农业大学 | Method for rapidly detecting kinds of lactobacillus in fermented dairy product |
| JP2011217734A (en) * | 2010-03-23 | 2011-11-04 | Morinaga Milk Ind Co Ltd | Method for identifying lactococcus strain |
| CN104480203A (en) * | 2014-12-08 | 2015-04-01 | 上海理工大学 | Primer, method and kit for rapidly detecting lactococcus lactis |
| CN106480214A (en) * | 2016-10-28 | 2017-03-08 | 保龄宝生物股份有限公司 | A kind of PCR quick detection special primer of Lactobacillus helveticus and method |
| CN107937581A (en) * | 2017-12-28 | 2018-04-20 | 内蒙古农业大学 | Amplimer for lactic acid bacteria sequencing is to, lactic acid bacteria kind identification method and application |
| CN109022330A (en) * | 2018-09-12 | 2018-12-18 | 内蒙古农业大学 | One plant has high proteolytic ability and produces Lactococcus lactis BL19 and its application of junket fragrance |
Non-Patent Citations (1)
| Title |
|---|
| MH678636.1;Genbank;《Genbank》;20190114;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109457038A (en) | 2019-03-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| El-Baradei et al. | Bacterial biodiversity of traditional Zabady fermented milk | |
| Motato et al. | Bacterial diversity of the Colombian fermented milk “Suero Costeño” assessed by culturing and high-throughput sequencing and DGGE analysis of 16S rRNA gene amplicons | |
| Rantsiou et al. | Microflora of Feta cheese from four Greek manufacturers | |
| EP2018441B1 (en) | Tagged microorganisms and methods of tagging | |
| Lafarge et al. | Raw cow milk bacterial population shifts attributable to refrigeration | |
| Schmidt et al. | Basic features of the stress response in three species of bifidobacteria: B. longum, B. adolescentis, and B. breve | |
| Wegmann et al. | Molecular characterization and structural instability of the industrially important composite metabolic plasmid pLP712 | |
| US6242194B1 (en) | Acid-inducible promoters for gene expression | |
| Machielsen et al. | Molecular description and industrial potential of Tn 6098 conjugative transfer conferring alpha-Galactoside metabolism in Lactococcus lactis | |
| Desfossés-Foucault et al. | Transcription profiling of interactions between Lactococcus lactis subsp. cremoris SK11 and Lactobacillus paracasei ATCC 334 during Cheddar cheese simulation | |
| CN109468397B (en) | Gene for specifically detecting lactococcus lactis strain IMAU11823 and primer pair, kit and method for amplification of gene | |
| Alimolaei et al. | An efficient DNA extraction method for Lactobacillus casei, a difficult-to-lyse bacterium | |
| Martín-Platero et al. | Polyphasic approach to bacterial dynamics during the ripening of Spanish farmhouse cheese, using culture-dependent and-independent methods | |
| Rossi et al. | Genus-and species-specific PCR-based detection of dairy propionibacteria in environmental samples by using primers targeted to the genes encoding 16S rRNA | |
| Bassi et al. | TaqMan real time-quantitative PCR targeting the phosphotransacetylase gene for Clostridium tyrobutyricum quantification in animal feed, faeces, milk and cheese | |
| Ho et al. | Stability of active prophages in industrial Lactococcus lactis strains in the presence of heat, acid, osmotic, oxidative and antibiotic stressors | |
| Zaburlin et al. | A fast PCR-based method for the characterization of prophage profiles in strains of the Lactobacillus casei group | |
| Wang et al. | Gene expression profile of probiotic Lactobacillus casei Zhang during the late stage of milk fermentation | |
| Ferreira et al. | Increased expression of clp genes in Lactobacillus delbrueckii UFV H2b20 exposed to acid stress and bile salts | |
| Niwa et al. | Lytic enzyme, labiase for a broad range of Gram-positive bacteria and its application to analyze functional DNA/RNA | |
| Østlie et al. | Characterisation of the microflora during ripening of a Norwegian semi-hard cheese with adjunct culture of propionic acid bacteria | |
| Güley et al. | Identification of Streptococcus infantarius subsp. infantarius as the species primarily responsible for acid production in Izmir Brined Tulum Cheese from the Aegean Region of Türkiye | |
| CN109457038B (en) | Primer and detection method for detecting lactococcus lactis BL19 | |
| Suokko et al. | Characterization of a mobile clpL gene from Lactobacillus rhamnosus | |
| Miyamoto et al. | Denaturing gradient gel electrophoresis analysis of lactic acid bacteria and yeasts in traditional Mongolian fermented milk |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhong Zhi Inventor after: Sun Zhihong Inventor after: Li Jianli Inventor after: Ren Min Inventor after: Li Weicheng Inventor before: Zhong Zhi Inventor before: Sun Zhihong Inventor before: Zhang Heping Inventor before: Ren Min Inventor before: Li Weicheng |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |