CN109439681A - A kind of recombinant plasmid can be used for showing a large amount of foreign proteins and construction method and application - Google Patents
A kind of recombinant plasmid can be used for showing a large amount of foreign proteins and construction method and application Download PDFInfo
- Publication number
- CN109439681A CN109439681A CN201810553912.XA CN201810553912A CN109439681A CN 109439681 A CN109439681 A CN 109439681A CN 201810553912 A CN201810553912 A CN 201810553912A CN 109439681 A CN109439681 A CN 109439681A
- Authority
- CN
- China
- Prior art keywords
- plasmid
- gene
- recombinant plasmid
- pet24a
- carrier
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1037—Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Peptides Or Proteins (AREA)
- Virology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to field of biotechnology can expand application of the T7 phage display system in terms of Cell surface display more particularly to a kind of recombinant plasmid that can be used for showing a large amount of foreign proteins and construction method and application；It is the corresponding nucleotide sequence of amino acid shown in SEQ ID NO.1 to be inserted into its open reading frame, and in the nucleotide sequence for being inserted into restriction enzyme site and terminator codon shown in SEQ ID NO.2 behind the nucleotide sequence based on pET24a plasmid.
Description
Technical field
The present invention relates to field of biotechnology, more particularly to a kind of recombinant plasmid that can be used for showing a large amount of foreign proteins
And construction method and application.
Background technique
It is well known that cell display technology is to be operated using expressing the albumen in cell surface as carrier by genetic engineering
Gene to be presented is merged with the expressing gene of cell surface protein, using the coding translation system of cell itself by outer rim egg
White displaying is in bacterium or yeast surface, to assign cell with new function.Currently, cell display technology has been applied successfully
In numerous areas such as vaccine preparation, the screening in peptide library and antibody library, antibody producings.In terms of the building of antibody library, pCANTAB-
5E carrier is using most common carrier.But the optimum temperature of SfiI, NotI endonuclease is different, caused by substep digestion
Digesting efficiency is low and complex steps are influences one of the important factor in order of constructed library storage capacity.
T7 phage display system can be used in efficiently showing the small peptide from length 6-20 amino acid residue to greatly to 300aa
Albumen；T7 is virulent phage, can crack completely host strain in 1-2h, can quickly and easily be received through the sedimentation of PEG/NaCl method
Collection.It was shown in the past using T7 bacteriophage, under the 10B encoding gene for needing first to be connected to foreign gene T7 genomic DNA
Trip, then gene T7 coat protein is packed, could form complete T7 bacteriophage.It is longer in view of T7 genomic DNA, no
It is easy to operate, and T7 coat protein is at high price, it voluntarily prepares and needs Ultracentrifuge and activity is difficult to ensure, so answering
The difficulty for carrying out library construction with T7 bacteriophage is very big.
Based on the deficiency that Cell surface display extensive use and T7 phage display system remain, constructing one kind can
Method to show a large amount of foreign proteins is very necessary.
Summary of the invention
In order to solve the above technical problems, it is an object of that present invention to provide one kind can expand T7 phage display system thin
The recombinant plasmid that can be used for showing a large amount of foreign proteins of application in terms of cellular surface display technique.
The second object of the present invention is the provision of the preparation of the recombinant plasmid that can be used for showing a large amount of foreign proteins
Method.
The third object of the present invention can be used for showing the recombinant plasmid of a large amount of foreign proteins in phagocytosis described in being the provision of
Application in terms of body display.
A kind of recombinant plasmid can be used for showing a large amount of foreign proteins of the invention, be based on pET24a plasmid,
The corresponding nucleotide sequence of amino acid shown in insertion SEQ ID NO.1 in its open reading frame, and after the nucleotide sequence
The nucleotide sequence of restriction enzyme site and terminator codon shown in SEQ ID NO.2 is inserted into face.
A kind of recombinant plasmid can be used for showing a large amount of foreign proteins of the invention, amino shown in the SEQ ID NO.1
The corresponding nucleotides sequence of acid is classified as 10B protein sequence shown in SEQ ID NO.3.
A kind of recombinant plasmid can be used for showing a large amount of foreign proteins of the invention, construction method the following steps are included:
(1) acquisition of bacteriophage coat protein 10B gene: using T7select415-1b phage DNA as template, at 5 ' ends
The gene order of PCR amplification coding 10B albumen under the action of primer and 3 ' end primers；
(2) construction recombination plasmid: respectively with NdeI, XhoI digestion 10B gene and pET24a carrier, connect in target gene
After entering pET24a, the correct carrier of digestion verification, and it is named as pET24a-10B-carrier；
(3) the expression verifying of recombinant plasmid: gfp gene, 6 × his-tag and flag-tag gene are inserted into respectively
The 10B gene 3 ' for stating recombinant plasmid is held, and is respectively labeled as pET-10B-GFP, pET-10B-his and pET-10B-
Flag after recombinant plasmid is transferred to e. coli bl21 (DE3), is expressed through IPTG or lactose inducible protein, Western Blot mirror
Determine protein expression situation；
(4) application of the recombinant plasmid in phage display field: the expression bacterium that will be obtained in step (3), in IPTG or cream
After sugar induction 2h, fresh T7-10-3b bacteriophage is added into bacterium solution, continues shaking table culture 1-1.5h, becomes to bacterium solution and clarifies,
Bacteriophage, Dot hybridization confirmation are collected using PEG/NaCl sedimentation, phage surface has corresponding target protein or peptide fragment
It shows, is followed successively by GFP albumen, His label and Flag label.
A kind of recombinant plasmid can be used for showing a large amount of foreign proteins of the invention is by by bacteriophage coat protein 10B table
It is connected to the 3 ' ends of pET24a up to gene, and adds restriction enzyme site behind, obtaining can show that target is small by experimental design
The prokaryotic expression carrier pET24a-10B-carrier of peptide (or albumen) experiences empty plasmid Transformed E .coli BL21 (DE3)
State cell, the cell can express 10B albumen after inducer acts on, and recombinant plasmid pET24a-10B-carrier can be by peptide fragment
Or small molecular protein shows in T7 bacteriophage coat protein 10B c-terminus and shows in phage surface.With prior art phase
Than the present invention has the following advantages and effects:
1, of the present invention is only common prokaryotic expression plasmid pET24a, and the experimental technique of application is conventional building
Double digestion, connection when plasmid etc. are not related to the operation such as digestion, recombination of T7 genome, easy to operate, are easy to grasp；
2, the present invention is that the displaying of respective objects molecule is carried out based on escherichia coli prokaryotic expression, is not related to T7 genome and changes
Phage packaging process after making, the acquisition in view of packaging protein during phage packaging need ultracentrifugation, acquisition cost
High, packaging process the disadvantages of time-consuming, the present invention successfully compensates for above-mentioned deficiency, can more easily be used for T7 phage display system
System.
Detailed description of the invention
Fig. 1 is pET24a-10B-carrier recombinant plasmid open reading frame schematic diagram；
Fig. 2 is the electrophoretogram for obtaining 10B gene.M1: nucleic acid molecular weight standard, DL2000；
Fig. 3 is the digestion verification result of construction of recombinant plasmid；
Fig. 4 is the protein expression knot that pET-10B-carrier, pET-10B-GFP are transferred to after e. coli bl21 (DE3)
Fruit.10B albumen 344aa, about 37.8kDa；The coded sequence of GFP is more than 700 bp, encodes the albumen of 238 amino acid,
Protein molecular weight 26.9kDa；10B-GFP fusion protein molecule amount is about 65kDa；M1: protein molecular weight standard,
Fermentas SM04431；
Fig. 5 is that pET-10B-his, pET-10B-flag are transferred to e. coli bl21 (DE3) respective expression albumen afterwards
Western Blot verification result；
Fig. 6 is the obtained bacteriophage using recombinant plasmid displaying GFP, his-tag, flag-tag after T7 phage surface
Dot blot as a result,The bacteriophage that carrier plasmid obtains；T7-10-3b bacteriophage；
Specific embodiment
With reference to embodiment, the embodiment of the present invention is furthur described in detail.Following embodiment is used for
Illustrate the present invention, but is not intended to limit the scope of the invention.
Technical solution of the present invention is if not otherwise specified the conventional scheme of this field. pET24a,pET24a-
10B-carrier is respectively negative control (empty plasmid), blank control (not showing exogenous peptide).
Embodiment 1:
A kind of building for the recombinant plasmid can be used for showing a large amount of foreign proteins:
(1) acquisition of bacteriophage coat protein 10B gene
Using T7select415-1b phage DNA as template, with the high base for guaranteeing nucleic acid amplification enzymatic amplification coding 10B albumen
Because of sequence, 5 ' end primers are 10B-F (SEQ ID NO.4): cgCATATGgctagcatgactg, and 3 ' end primers are 10B-R
(SEQ ID NO.5): cgGAATTCtattaAAGCTTttccactttaaagacc.PCR reaction condition are as follows: 94 DEG C of initial denaturations
5min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 1min are a circulation, carry out 30 circulations altogether；72 DEG C are finally prolonged
Stretch 10min, subsequent 16 DEG C of heat preservations.
After nucleic acid electrophoresis verifying, target gene is recycled using Ago-Gel QIAquick Gel Extraction Kit.The target gene 5 ' end has
There are tri- restriction enzyme sites of EcoRI, HindIII, XhoI and two terminator codon taa in NdeI restriction enzyme site, 3 ' ends.
(2) construction recombination plasmid
NdeI, XhoI digestion 10B gene and pET24a carrier, after target gene is connected into pET24a, digestion verification are used respectively
Correct carrier is named as pET24a-10B-carrier, recombinant plasmid as of the invention.
Embodiment 2:
After recombinant plasmid pET24a-10B-carrier is transferred to Escherichia coli, through chemical induction, phage ghost is obtained
The solubility expression of protein 10 B.
100ng recombinant plasmid is taken, Transformed E .coli BL21 (DE3) competent cell is coated on LB solid medium later
Plate (contains 50 μ g/mL Kana), 37 DEG C of culture 16h.It is cloned on the plate that picking is incubated overnight, accesses LBK fluid nutrient medium
In, for shaking table culture to OD600 about 0.6, IPTG, which is then added, makes its final concentration of 0.5 μm of ol/L under the conditions of 37 DEG C of 220rpm,
Continue shaking table culture 4h；Each 1mL of inoculum of induction front and back is collected, electrophoresis observes the expression of 10B albumen；Collection lures
Bacterium after leading, after ultrasonication, separation supernatant, precipitating, SDS-PAGE method observe the content (Fig. 1) of destination protein in sample.
SDS-PAGE the result shows that, the bacterium after recombinant plasmid transformed can stablize and solubility expression T7 phage ghost
Protein 10 B shows that the plasmid application prospect can the phase.
Embodiment 3:
Foreign protein is shown in T7 phage surface using recombinant plasmid pET24a-10B-carrier:
(1) acquisition of green fluorescence protein gene
With reference to pIRES2-EGFP sequence information, design primer egfpF (SEQ ID NO.6):
GAAGCTTtctagagtgagcaag and egfpR (SEQ ID NO.7): gGAATTCttacttgtacagctcgtc, with
PIRES-EGFP2 plasmid is template, expands egfp sequence, amplification condition are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s, 55
DEG C annealing 30s, 72 DEG C of extensions 1min are a circulation, carry out 30 altogether and recycle；72 DEG C of last extension 10min, subsequent 16 DEG C of guarantors
Temperature.The nucleotide sequence 5 ' end is added to HindIII restriction enzyme site, and 3 ' ends are added to EcoRI restriction enzyme site and terminator codon,
To be inserted into carrier carrier.
(2) building of pET-10B-GFP carrier and the expression of 10B-GFP fusion protein
Above-mentioned PCR product and vector plasmid pET24a-10B-carrier, after HindIII, EcoRI double digestion, recycling
Respective digestion products simultaneously connect, and connection product converts bacillus coli DH 5 alpha competent cell, are coated on LBK solid plate.
Monoclonal is chosen from the plate being incubated overnight, the vector plasmid of insertion egfp gene is filtered out, it is converted into Escherichia coli again
BL21 (DE3) competent cell and the expression that destination protein is induced with IPTG.
Apparent green is presented in the thallus being collected by centrifugation；SDS-PAGE coloration result shows the 10B base carried on carrier
Because with egfp gene tandem amalgamation and expression and in solubility expression (Fig. 2).
(3) pET-10B-GFP assists T7 bacteriophage to complete assembly
It induces two bottles of bacteriums (200mL/1000mL conical flask), after IPTG induces 3h, is added respectively into bacterium solution
T7select415-1b (No. 1) and T7select10-3b bacteriophage (No. 2) continue shaking table shaken cultivation, observe bacterium solution turbidity
Variation and the time.
Before bacteriophage is added, two bottles of OD600 is respectively 0.641 and 0.603；Respective bacteriophage is added and continues shaken cultivation
After 1h, two bottles of bacterium solution OD600 are respectively 0.124 and 0.252, and headpin bacterium solution becomes clarification, with the presence of apparent filiform；Continue
After shaken cultivation 0.5h, two bottles of bacterium solution OD600 are respectively 0.098 and 0.112, and No. 2 bottle bacterium solutions also become clarification.The result shows that taking
Recombinant plasmid with egfp gene can be by 10B albumen and GFP amalgamation and expression, and the 10B subunit of fusion protein can be as weight
Want assembled part that T7select10-3b bacteriophage is assisted to complete assembling process.
(4) verifying of GFP albumen bacteriophage is shown in step 3
1, No. 2 bottle pnagus medius lysate, 4 DEG C of 10000rpm are centrifuged 15min；Transfer centrifugation supernatant is in a clean cone
In shape bottle, the PEG/NaCl of the pre-cooling of 1/5 volume, after gently shaking up, 4 DEG C of standing 30min is added；4 DEG C of 10000rpm centrifugations
15min is gently overturned and is discarded centrifugation supernatant, and after being inverted 2min, centrifugation is resuspended with 1mL PBS buffer solution, sufficiently after piping and druming,
4 DEG C of 3000rpm are centrifuged 5min, shift supernatant to a sterile collection tube to get the bacteriophage after amplification.
Embodiment 4:
Using recombinant plasmid pET24a-10B-carrier by 6 × His label display in T7 phage surface:
(1) pET-10B-his recombinant plasmid is constructed
It utilizes primer 10B-kpn-F (SEQ ID NO.8): ctGGTACgctcgtgagggcac and 10B-his-R (SEQ
ID NO.9): gAAGCTT catcaccatcatcaccatttccactttaaagacc, with pET24a-10B-carrier plasmid
For template, PCR obtains 10B gene 3 ' and holds, and 3 ' ends contain the 6 × His-tag nucleotide sequence for needing to be inserted into.PCR reaction
Condition are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 45s are a circulation, carry out 30 altogether
A circulation；72 DEG C of last extension 10min, subsequent 16 DEG C of heat preservations.Underscore part in primer sequence is restriction enzyme site.
PCR product and vector plasmid pET24a-10B-carrier are recycled respective after KpnI, HindIII double digestion
Digestion products simultaneously connect, and connection product converts bacillus coli DH 5 alpha competent cell, are coated on LBK solid plate.From overnight
Monoclonal is chosen on the plate of culture, filters out the recombinant plasmid of insertion His label.
(2) prokaryotic expression of 10B-his albumen
Successful plasmid conversion e. coli bl21 (DE3) competent cell will be constructed, with 0.5mmol/L final concentration
IPTG induces 3h, and the bacterium of bacterium solution after 1mL induction, after bacterium is resuspended in 80 μ L PBS, addition 5 × go back at raw sample is collected by centrifugation
Liquid processing is managed, 10min is boiled, is centrifuged；Protein expression situation is analyzed through SDS-PAGE；It is carried out with His-tag tag antibody
Western Blot identification, to determine the expression of His label.With BL21 (DE3) bacterium containing pET24a-10B-carrier
As a control group.
(3) utilize recombinant vector by His label display in T7 phage surface
Culture contains pET-10B-his plasmid (His group) and pET24a-10B-carrier (carrier group) respectively
One bottle every kind (200mL/1000mL conical flask), when about 0.6 bacterium solution OD600, final concentration is added in BL21 (DE3) bacterium
After 0.5mmol/L IPTG induces 3h, T7select415-1b bacteriophage is then added into bacterium solution respectively, continues shaking table oscillation
(37 DEG C of 220rpm) 1h or so is cultivated, until bacterium solution becomes clarification.
Two bottles of pnagus medius lysates are respectively transferred in 250mL centrifugal bottle, 4 DEG C of 10000rpm are centrifuged 15min；Clearly
In a clean conical flask PEG/NaCl of the pre-cooling of 1/5 volume is added, after gently shaking up, 4 DEG C quiet in transfer centrifugation supernatant
Set 30min；4 DEG C of 10000rpm are centrifuged 15min, gently overturn and discard centrifugation supernatant, after being inverted 2min, are buffered with 1mL PBS
Centrifugation is resuspended in liquid, and sufficiently after piping and druming, 4 DEG C of 3000rpm are centrifuged 5min, shifts supernatant to a sterile collection tube to get amplification
Bacteriophage afterwards.
The bacteriophage for respectively obtaining His group and carrier group and T7select415-1b bacteriophage (control group) progress
Dot blot experiment, to determine His label in the displaying of phage surface.One piece of nitrocellulose filter (NC film) is taken, uses lead in advance
Pen draws three circles on film, takes the corresponding bacteriophage drop of 10 μ L in circles mark region respectively, after drying, then is added dropwise primary；It dries in the air
It is dry, with 5%BSA adequate closure NC film；After closing, the anti-His-tag of mouse with antibody diluent dilution HRP label is anti-
Body, each marked region drip antibody working solution 50 μ L, 37 DEG C of incubation 1.5h；After incubation, washing film with PBST, (5min/ times altogether
3 times), the DAB developing solution of Fresh is then added dropwise to marked region, room temperature is carried out in the dark colour developing.His group is visible apparent brown
The color of color, carrier group and control group does not have significant change.Thus judge, successful presentation is utilizing pET- to His label
The surface of the bacteriophage of 10B-His plasmid preparation.
Embodiment 5:
Flag-tag is shown in T7 phage surface using recombinant plasmid pET24a-10B-carrier:
(1) pET-10B-flag recombinant plasmid is constructed
It utilizes primer 10B-kpn-F (SEQ ID NO.8): ctGGTACgctcgtgagggcac and 10B-flag-R (SEQ
ID NO.10): gAAGCTT gattataaagatgatgacgataaattccactttaaagacc, with pET24a-10B-
Carrier plasmid is template, and PCR obtains 10B gene 3 ' and holds, and 3 ' ends contain the Flag-tag nucleotides sequence for needing to be inserted into
Column.PCR reaction condition are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 45s are one and follow
Ring carries out 30 circulations altogether；72 DEG C of last extension 10min, subsequent 16 DEG C of heat preservations.Underscore part in primer sequence is digestion
Site.
PCR product and vector plasmid pET24a-10B-carrier are recycled respective after KpnI, HindIII double digestion
Digestion products simultaneously connect, and connection product converts bacillus coli DH 5 alpha competent cell, are coated on LBK solid plate.From overnight
Monoclonal is chosen on the plate of culture, filters out the recombinant plasmid of insertion Flag label.
(2) prokaryotic expression of 10B-flag albumen
Successful plasmid conversion e. coli bl21 (DE3) competent cell will be constructed, with 0.5mmol/L final concentration
IPTG induces 3h, and the bacterium of bacterium solution after 1mL induction, after bacterium is resuspended in 80 μ L PBS, addition 5 × go back at raw sample is collected by centrifugation
Liquid processing is managed, 10min is boiled, is centrifuged；Protein expression situation is analyzed through SDS-PAGE；It is carried out with Flag-tag tag antibody
Western Blot identification, to determine the expression of Flag label.It is thin with the BL21 (DE3) containing pET24a-10B-carrier
Bacterium is as a control group.
(3) utilize recombinant vector by Flag label display in T7 phage surface
Culture contains pET-10B-Flag plasmid (Flag group) and pET24a-10B-carrier (carrier group) respectively
BL21 (DE3) bacterium, one bottle every kind (200mL/1000mL conical flask), when about 0.6 bacterium solution OD600, be added final concentration
After 0.5mmol/L IPTG induces 3h, T7select415-1b bacteriophage is then added into bacterium solution respectively, continues shaking table oscillation
(37 DEG C of 220rpm) 1h or so is cultivated, until bacterium solution becomes clarification.
Two bottles of pnagus medius lysates are respectively transferred in 250mL centrifugal bottle, 4 DEG C of 10000rpm are centrifuged 15min；Clearly
In a clean conical flask PEG/NaCl of the pre-cooling of 1/5 volume is added, after gently shaking up, 4 DEG C quiet in transfer centrifugation supernatant
Set 30min；4 DEG C of 10000rpm are centrifuged 15min, gently overturn and discard centrifugation supernatant, after being inverted 2min, are buffered with 1mL PBS
Centrifugation is resuspended in liquid, and sufficiently after piping and druming, 4 DEG C of 3000rpm are centrifuged 5min, shifts supernatant to a sterile collection tube to get amplification
Bacteriophage afterwards.
The bacteriophage for respectively obtaining Flag group and carrier group and T7select415-1b bacteriophage (control group) progress
Dot blot experiment, to determine Flag label in the displaying of phage surface.One piece of nitrocellulose filter (NC film) is taken, uses lead in advance
Pen draws three circles on film, takes the corresponding bacteriophage drop of 10 μ L in circles mark region respectively, after drying, then is added dropwise primary；It dries in the air
It is dry, with 5%BSA adequate closure NC film；After closing, the anti-Flag-tag of mouse with antibody diluent dilution HRP label is anti-
Body, each marked region drip antibody working solution 50 μ L, 37 DEG C of incubation 1.5h；After incubation, washed film (5min/ times totally 3 with PBST
It is secondary), the DAB developing solution of Fresh is then added dropwise to marked region, room temperature is carried out in the dark colour developing.Flag group is visible apparent brown
The color of color, carrier group and control group does not have significant change.Thus judge, successful presentation is utilizing Flag label
The surface of the bacteriophage of pET-10B-Flag plasmid preparation.
A kind of application of recombinant plasmid that can be used for showing a large amount of foreign proteins of the invention in terms of phage display, packet
It includes using plasmid linking objective peptide fragment, the target gene perhaps random peptide library construction recombination plasmid or library, expresses target
Albumen or random peptide library are used for protein display or library construction in conjunction with corresponding bacteriophage.
Of the present invention is only common prokaryotic expression plasmid pET24a, and the experimental technique of application is conventional building matter
Double digestion, connection etc. when grain are not related to the operation such as digestion, recombination of T7 genome, easy to operate, are easy to grasp.
The present invention is that the displaying of respective objects molecule is carried out based on escherichia coli prokaryotic expression, is not related to T7 genome manipulation
Phage packaging process afterwards, in view of packaging protein during phage packaging acquisition need ultracentrifugation, obtain it is at high cost,
Packaging process the disadvantages of time-consuming, the present invention successfully compensates for above-mentioned deficiency, can more easily be used for T7 phage display system.
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, without departing from the technical principles of the invention, several improvements and modifications, these improvements and modifications can also be made
Also it should be regarded as protection scope of the present invention.
Claims (3)
1. a kind of recombinant plasmid that can be used for showing a large amount of foreign proteins, which is characterized in that be based on pET24a plasmid,
The corresponding nucleotide sequence of amino acid shown in insertion SEQ ID NO.1 in its open reading frame, and after the nucleotide sequence
The nucleotide sequence of restriction enzyme site and terminator codon shown in SEQ ID NO.2 is inserted into face.
2. a kind of recombinant plasmid that can be used for showing a large amount of foreign proteins as described in claim 1, which is characterized in that described
The corresponding nucleotides sequence of amino acid shown in SEQ ID NO.1 is classified as 10B protein sequence shown in SEQ ID NO.3.
3. a kind of recombinant plasmid that can be used for showing a large amount of foreign proteins as described in claim 1, which is characterized in that it is constructed
Method the following steps are included:
(1) acquisition of bacteriophage coat protein 10B gene: using T7select415-1b phage DNA as template, primer is held 5 '
With the gene order of PCR amplification coding 10B albumen under the action of 3 ' end primers；
(2) it construction recombination plasmid: respectively with NdeI, XhoI digestion 10B gene and pET24a carrier, is connected into target gene
After pET24a, the correct carrier of digestion verification, and it is named as pET24a-10B-carrier；
(3) the expression verifying of recombinant plasmid: gfp gene, 6 × his-tag and flag-tag gene are inserted into respectively above-mentioned heavy
The 10B gene 3 ' of group plasmid is held, and is respectively labeled as pET-10B-GFP, pET-10B-his and pET-10B-flag, weight
It after group plasmid is transferred to e. coli bl21 (DE3), is expressed through IPTG or lactose inducible protein, Western Blot identifies albumen table
Up to situation；
(4) application of the recombinant plasmid in phage display field: the expression bacterium that will be obtained in step (3) lures in IPTG or lactose
After leading 2h, fresh T7-10-3b bacteriophage is added into bacterium solution, continues shaking table culture 1-1.5h, becomes to bacterium solution and clarifies, utilizes
PEG/NaCl sedimentation collects bacteriophage, Dot hybridization confirmation, and phage surface has corresponding target protein or peptide fragment to show,
It is followed successively by GFP albumen, His label and Flag label.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810553912.XA CN109439681A (en) | 2018-06-01 | 2018-06-01 | A kind of recombinant plasmid can be used for showing a large amount of foreign proteins and construction method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810553912.XA CN109439681A (en) | 2018-06-01 | 2018-06-01 | A kind of recombinant plasmid can be used for showing a large amount of foreign proteins and construction method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109439681A true CN109439681A (en) | 2019-03-08 |
Family
ID=65533035
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810553912.XA Pending CN109439681A (en) | 2018-06-01 | 2018-06-01 | A kind of recombinant plasmid can be used for showing a large amount of foreign proteins and construction method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109439681A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5766905A (en) * | 1996-06-14 | 1998-06-16 | Associated Universities Inc. | Cytoplasmic bacteriophage display system |
| US20030134352A1 (en) * | 2002-01-04 | 2003-07-17 | Freimuth Paul I. | Facilitating protein folding and solubility by use of peptide extensions |
| WO2003097796A2 (en) * | 2002-05-14 | 2003-11-27 | Alexion Pharmaceuticals, Inc. | T7 bacteriophage display of fabs |
| CN101434960A (en) * | 2008-12-23 | 2009-05-20 | 华中农业大学 | Protective antigen mutant of Bacillus anthracis |
| CN103540605A (en) * | 2013-09-22 | 2014-01-29 | 重庆市畜牧科学院 | Capsid protein phage display particle of recombinant II porcine circovirus as well as preparation method and application thereof |
-
2018
- 2018-06-01 CN CN201810553912.XA patent/CN109439681A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5766905A (en) * | 1996-06-14 | 1998-06-16 | Associated Universities Inc. | Cytoplasmic bacteriophage display system |
| US20030134352A1 (en) * | 2002-01-04 | 2003-07-17 | Freimuth Paul I. | Facilitating protein folding and solubility by use of peptide extensions |
| WO2003097796A2 (en) * | 2002-05-14 | 2003-11-27 | Alexion Pharmaceuticals, Inc. | T7 bacteriophage display of fabs |
| CN101434960A (en) * | 2008-12-23 | 2009-05-20 | 华中农业大学 | Protective antigen mutant of Bacillus anthracis |
| CN103540605A (en) * | 2013-09-22 | 2014-01-29 | 重庆市畜牧科学院 | Capsid protein phage display particle of recombinant II porcine circovirus as well as preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Rout et al. | A distinct nuclear import pathway used by ribosomal proteins | |
| Waadt et al. | In planta visualization of protein interactions using bimolecular fluorescence complementation (BiFC) | |
| Rajendran et al. | Characterization of the RNA-binding domains in the replicase proteins of tomato bushy stunt virus | |
| CN111499765A (en) | Coronavirus fusion protein and preparation method and application thereof | |
| CN104725517A (en) | Method for enhancing target protein display quantity on yeast cell surface | |
| Weinthal et al. | Characterization of nuclear localization signals in the type III effectors HsvG and HsvB of the gall-forming bacterium Pantoea agglomerans | |
| CN104250288B (en) | Amphiphilicα-helix self-assembling peptides and its application | |
| Sharma et al. | Characterization of signals that dictate nuclear/nucleolar and cytoplasmic shuttling of the capsid protein of Tomato leaf curl Java virus associated with DNAβ satellite | |
| Kalnciema et al. | Potato virus M-like nanoparticles: Construction and characterization | |
| CN109439681A (en) | A kind of recombinant plasmid can be used for showing a large amount of foreign proteins and construction method and application | |
| Bittner et al. | Multiple groESL operons are not key targets of RpoH1 and RpoH2 in Sinorhizobium meliloti | |
| Špakova et al. | vB_EcoS_NBD2 bacteriophage-originated polytubes as a carrier for the presentation of foreign sequences | |
| CN103923902B (en) | A kind of pulmonary cancer diagnosis biological reagent, preparation method and application | |
| CN110568189B (en) | Dog adenovirus type 1 antibody ELISA detection kit and application thereof | |
| CN106834324A (en) | A kind of recombinant expression carrier that can promote solubility expression of protein and improve expression quantity | |
| CN111019926B (en) | TEV protease variants, fusion proteins thereof, and methods of making and using | |
| CN113234133B (en) | Method for prokaryotic expression of liriomyza trifoliata heat shock transcription factor protein | |
| Rockberg et al. | Epitope mapping using gram‐positive surface display | |
| CN109055416A (en) | A kind of preparation method of soluble recombinant protein | |
| CN111087477B (en) | GBM-7S (alpha 1) -NC1 (alpha 3) fusion protein and preparation method thereof | |
| Larkin et al. | Fabrication of tobacco mosaic virus-like nanorods for peptide display | |
| CN103045614B (en) | Mutant phage E gene, punching plasmid vector containing gene and application thereof in preparation of vaccine | |
| CN111983238A (en) | Probe for dynamically detecting protein O-GlcNAc glycosylation and preparation method and application thereof | |
| CN109777808A (en) | A kind of polypeptide and its in nucleus and chloroplaset localization and expression foreign protein application | |
| US20230119241A1 (en) | Method for soluble expression and purification of hydrophobin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190308 |
|
| RJ01 | Rejection of invention patent application after publication |