CN109439624A - A method of for identification or enrichment erythroblast - Google Patents
A method of for identification or enrichment erythroblast Download PDFInfo
- Publication number
- CN109439624A CN109439624A CN201811452001.4A CN201811452001A CN109439624A CN 109439624 A CN109439624 A CN 109439624A CN 201811452001 A CN201811452001 A CN 201811452001A CN 109439624 A CN109439624 A CN 109439624A
- Authority
- CN
- China
- Prior art keywords
- aptamer
- erythroblast
- enrichment
- added
- identification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0641—Erythrocytes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2509/00—Methods for the dissociation of cells, e.g. specific use of enzymes
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Hematology (AREA)
- Immunology (AREA)
- Cell Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides it is a kind of for identification or the method for enrichment erythroblast.Erythroblast is identified or is enriched with using the specificity of the erythroblast in specific aptamer and peripheral blood.Compared with prior art, method provided by the invention has remarkable advantage, is mainly manifested in: (1) providing capture or the enrichment method of the new erythroblast of one kind, be of great significance；(2) specific recognition or capture are carried out to erythroblast using aptamer, can effectively improve the identification or capture rate of target cell, it is significant for the correlative study of erythroblast；(3) Nucleic acid aptamer molecules amount is small, and preparation method is chemical synthesis, and with easily modification, stability is strong, is convenient for the advantages such as preservation.(4) aptamer is good to the specificity of erythroblast in identification process, and affinity is good, easy to operate, accuracy and high sensitivity.New method and approach are provided for disorder in screening or fetus pre-natal diagnosis.
Description
Technical field
The invention belongs to erythroblast detection technique fields, and in particular to it is a kind of for identification or enrichment erythroblast
Method.
Background technique
Erythroblast cannot be seen in normal adult's peripheral blood, birth 1 week within newborn's peripheral blood in can
It sees a small amount of.Occur erythroblast in adult peripheral blood and belongs to pathological phenomenon.It is found in: 1. hyperplastic anemia: being most commonly in
Various anaemias, acute posthemorrhagic anemia, megaloblastic anemia, serious hypochrosis microcytic anemia.To there is metarubricyte
Or rubricyte is common.Occurring erythroblast in peripheral blood indicates erythron obvious proliferation in marrow；2. red
Blood disease, erythroleukemia: erythroneocytosis paraplasm and being released into blood in marrow, is common with pronormoblast, early erythroblast；
3. extramedullary hematopoiesis: when myelofibrosis, the hematopoiesis function of the organized renewings embryonic stage such as spleen, liver, lymph node, these tissues are because lacking
The weary ability of regulation and control to haemocyte release, inmature haemocyte largely enter peripheral blood.The normoblast of each stage of development is all visible
It arrives, and visible immature granulocyte and megacaryocyte；4. other: such as metastatic carcinoma of bone marrow, severe depletion of oxygen.
In addition, erythroblast is stable in the presence of in gravid woman's peripheral blood, life cycle is short, and postpartum is in women periphery
It disappears quickly in blood, not by the interference of last time gestation when for pre-natal diagnosis.Except this, have under pathological state relatively more apparent
The characteristics of raising, this facilitates the noninvasive pre-natal diagnosis of pathological obstetrics.It is sent out in First Trimester fetus erythroid cells than white system's cell
Open up early, in yolk bag and liver hematopoiesis phase, fetal red blood cells and leucocyte are than about 1000:1, and theoretically First Trimester enters outside mother
The erythroblast of all blood is more than other kinds of fetal cell.Erythroblast contains the complete genome of fetus, can be used for
The analysis and research of fetal genetic disease, theoretically, an erythroblast can be carried out the analysis of fetal genetic disease
And diagnosis.Therefore, the erythroblast captured in mother's peripheral blood carries out pre-natal diagnosis or the various possible something lost to fetus
Biography disease, which makes analysis and research, will huge potentiality.
The method of capture now or enrichment erythroblast is mainly density gradient centrifugation, Magnetic activated cell sorting, fluorescence
Active cell sorting, micromanipulation partition method and micro fluidic device, wherein density gradient centrifugation and micromanipulation partition method are roots
According to the density and morphological feature of erythroblast itself, Magnetic activated cell sorting, fluorescence-activated cell sorting and micro fluidic device
It is the CD71 antigen expressed by erythroblast surface specific, the capture of specificity is carried out using the antibody for CD71.
The existing ligand that can capture CD71 includes that transferrins and CD71 antibody etc. have its corresponding defect.Transferrins and antibody
Preparation cost it is higher, the homogeneity in preparation process is poor, and is not easy to modify, and capture enrichment process it is complicated for operation.
Aptamer is Fas lignand system evolution technology (the systematic evolution of by external index concentration
Ligands by exponential enrichment, SELEX) screening obtain can high-affinity and high specific combine
The ssDNA or ssRNA of target molecules.For aptamer compared with antibody, Nucleic acid aptamer molecules amount is small (5-15kD), and preparation method is
Chemical synthesis is easily modified, and stability is strong, is convenient for the advantages such as preservation.
We have found that aptamer TY8 can identify CD71, which can be used as the efficient ligand of CD71, and
It can be identified in peripheral blood for medical diagnosis on disease, or the erythroblast that will be captured is used as research.
Summary of the invention
Primary and foremost purpose of the invention is to provide a kind of high sensitivity, high specificity, easy to operate, for identification or is enriched with
The method of nucleated red blood cell.
The purpose of the present invention is what is be implemented with the following technical solutions.
A method of for identification or it being enriched with erythroblast, utilizes the erythroblast in aptamer and peripheral blood
Specific binding identify or be enriched with erythroblast, the aptamer sequence is as follows: 5 '-ACTCATAGGGTTAGG
GGCTGCTGGCCAGATACTCAGATGGTAGGGTTACTATGAGC-3 ', SEQ NO.1.
It is described for identification or the method for enrichment erythroblast, can also by increasing the aptamer or
Person deletes base or base replacement obtains aptamer with the same function.
The aptamer, can also be connected upper fluorescence by the method with enrichment erythroblast for identification
Substance, radioactive substance, therapeutic substance, biotin or enzyme marker matter obtain having identical combination with the aptamer
The nucleic acid aptamer derivative of erythroblast ability.
The method with enrichment erythroblast for identification, comprising the following steps:
(1), the pretreatment of peripheral blood: density gradient centrifugation obtains mononuclearcell layer；
(2), aptamer pre-processes: biotin in connection；
(3), enrichment process: aptamer and peripheral blood are incubated for, and washing removes extra aptamer, are then added and are repaired
The magnetic bead for having adornd Streptavidin is incubated for, and finally captures out erythroblast under the action of magnet.
Aptamer of the present invention is used to capture and be enriched with the detailed step of erythroblast:
1, peripheral blood blood sample is acquired, anticoagulant heparin vacuum blood collection tube is placed in, is sent to laboratory in 4h；
2, blood sample is diluted in equal volume with the DPBS containing 5%BSA and 4%EDTA；
3, then the ficoll lymphocyte separation medium that encryption degree is 1.077g/ml slowly adds blood into centrifuge tube
Enter to ficoll lymphocyte separation medium upper layer, and keeps interface clear；
4, centrifuge density gradient centrifugation, revolving speed 400rcf, time 30min, obtain the blood sample of layering: top layer is that yellow is clear
Clear serum, centre are the lymph separating liquids of white clear, and bottom is red mature erythrocyte sediment, obtain top layer in
White flock circular layer between interbed, the layer are mononuclear cell layer；
5, suitable DPBS, revolving speed 250rcf, time 10min is added, room temperature centrifugation obtains cell precipitation, repeats this step
Suddenly；
6, suitable TY8 with biotin labeling is taken, first 95 DEG C of heating 5min, are subsequently placed in 4 DEG C of cooling 10min；
7, cell is resuspended with Binding buffer, the aptamer TY8 of biotin labeling is added, be placed in 4 DEG C of shaking tables and be incubated for
40min makes aptamer identify the erythroblast in blood；
8, isometric Washing buffer is added, 250rcf, 5min, 4 DEG C of centrifugations, obtain cell precipitation after mixing,
It is primary according still further to this repeated washing；
9, the magnetic bead for having modified Streptavidin in right amount is added into cell precipitation, and is containing 0.1% tween
4 DEG C of incubation 20min, combine Streptavidin and biotin adequately in the solution environmental of Washing buffer；
10, system above is applied on magnet, stands 1 minute, adsorbs magnetic bead by magnet, remove solvent portions,
The Washing buffer containing 0.1% tween is added, repeated washing is primary；
11, the erythroblast captured is observed in the case where copolymerization is burnt.
After the above method captures erythroblast, erythroblast can be not only studied, can be also used for correlation
The research or diagnosis of disease can be used for fetus if it is capturing in gravid woman's peripheral blood after erythroblast
The research or disorder in screening of erythroblast.
A second object of the present invention is to provide the concrete applications of the above-mentioned aptamer referred to, comprising:
Application of the aptamer in the reagent of preparation identification or enrichment erythroblast.
The aptamer is preparing the application in the reagent in conjunction with the PROTEIN C D71 on erythroblast surface.
Compared with prior art, method provided by the invention has remarkable advantage, is mainly manifested in: (1) providing one kind
The capture of new erythroblast or enrichment method, are of great significance；(2) erythroblast is carried out using aptamer special
Opposite sex identification capture, can effectively improve the identification capture rate of target cell, have weight for the correlative study of erythroblast
Want meaning；(3) Nucleic acid aptamer molecules amount is small (5-15kD), and preparation method is chemical synthesis, has easily modification, stability by force, just
In advantages such as preservations；(4) aptamer is good to the specificity of erythroblast in acquisition procedure, and affinity is good, easy to operate,
Accuracy and high sensitivity.(5) new method and approach are provided for disorder in screening or fetus pre-natal diagnosis.
Detailed description of the invention
Fig. 1 is aptamer TY8 combination human erythroleukemia cell line；
Fig. 2 is the erythroblast of aptamer TY8 binding hematopoietic stem cells induction；
A is stream data, and B is total focus data；
Fig. 3 is the erythroblast in aptamer TY8 combination Cord blood；
Fig. 4 is the erythroblast in aptamer TY8 coupled bead capture peripheral blood；
Fig. 5 is aptamer TY8 combination cell memebrane protein；
Fig. 6 is the analysis of aptamer TY8 binding protein SDS-PAGE glue；
Fig. 7 is the antibody common location fluorescence co-focusing result of aptamer TY8 and CD71；
Fig. 8 is that prove aptamer TY8 combination is the western bloting result figure of CD71；
It is luminous picture of the transferring film later with CD71 antibody incubation in nethermost horizontal frame；
Fig. 9 is that the dissociation constant of aptamer TY8 combination CD71 albumen calculates.
Specific embodiment
It is intended to further illustrate the present invention with reference to embodiments, is not intended to limit the present invention.
The reagent prepared in the embodiment of the present invention:
Contain following substance: 5mM MgCl in Washing buffer:PBS solution2, 4.5g/L glucose；
Contain following substance: 5mM MgCl in Binding buffer:PBS solution2, 4.5g/L glucose, 0.1mg/mL
Yeast tRNA, 1mg/mL BSA and 20%FBS.
Anticoagulant buffer: DPBS+0.5%BSA+0.4%EDTA.
Hypotonic buffer liquid: it takes the Washing buffer of 25.2mL in 50mL centrifuge tube, 3mL is added thereto respectively
The Tris-HCl of 10 × cocktail, 1.5mL 1M, 300 μ L 100 × PMSF, 4 DEG C of preservations after concussion mixes.
Memebrane protein lysate: taking the hypotonic buffer liquid of 5mL in the centrifuge tube of 15mL, is added 50 μ L's into pipe
Triton-X-100,4 DEG C of preservations.
The reagent of purchase:
ELISA kit is purchased from BD company, which includes: coating buffer (coating buffer), assay
Diluent (confining liquid), SAv-HRP (the coated HRP reagent of Streptavidin), (substrate is molten by substrate solution
Liquid), stop solution (stop bath) etc..
DPBS, BSA, EDTA, hydroxyethyl starch, the Ficoll lymphocyte separation medium of 1.077g/ml, cell factor:
IL3, scf, epo, fbs；Sfem culture medium, trypsase, Proteinase K, DNA confining liquid etc. are purchased from Sai Mofei company.
Cocktail, PMSF, Triton-X-100 are purchased from sigma company.
Loading buffer, acryloyl glue, Tris-HCl, SDS, APS, TEMED, bromophenol blue, coomassie brilliant blue staining
Liquid etc. is purchased from green skies company.
The coated Ago-Gel pearl of Streptavidin is purchased from GE company.
PL45 cell, Erythroleukemia cell line HEL are all from Shanghai cell bank.
The experiment of embodiment 1:TY8 combination Erythroleukemia cell line
(1) Erythroleukemia cell line HEL is cultivated, until logarithmic growth phase, is washed three times with DPBS；
(2) it counts, obtains 300,000 cells, be resuspended with the Binding buffer of 200 μ l；
(3) TY8 of cy5 fluorescent marker is added, makes final concentration of 250nM；
(4) on 4 DEG C, the shaking table of 80rpm, it is incubated for 40min；
(5) it is washed three times with 500 μ l Washing buffer, 1000rpm, 4 DEG C, 5min；
(6) it is resuspended with 500 μ l Washing buffer, up flow type analysis.
In order to determine whether TY8 combines erythroblast, Erythroleukemia cell line HEL is used first, by aptamer
It is incubated for then up flow type detection altogether with this cell line respectively with random library, it is red as a result to prove that TY8 is capable of specific combination
Leukemia Cell Lines are shown in that Fig. 1, the cell type of Erythroleukemia cell line are erythroblasts.
The erythroblast experiment of embodiment 2:TY8 binding hematopoietic stem cells induction differentiation
(1) Cord blood is taken, appropriate anticoagulant heparin is added, and handle in time.
(2) anticoagulant buffer is added in 1:1, and dilution mixes, then again with the Cord blood after dilution: anticoagulant buffer: 6% hydroxyl
6% hydroxyethyl starch is added in hydroxyethyl starch=2:2:1 ratio, is stored at room temperature 1h.
(3) Aspirate supernatant is into new centrifuge tube, about 40ml/ pipe.Centrifugation, 1500rpm, 10min remove supernatant.
(4) gained cell precipitation is resuspended in anticoagulant buffer, then takes 15ml centrifuge tube, is added 1.077g/ml's
Cell liquid, is added to the upper layer of Ficoll lymphocyte separation medium, about 7ml/ by Ficoll lymphocyte separation medium, about 3ml/ pipe
Pipe, centrifugation, 1800rpm, 30min.
(5) monocyte of the second layer is drawn into new centrifuge tube, anticoagulant buffer is added to full, 1500rpm,
Supernatant is removed in 15min, centrifugation.Anticoagulant buffer is added, cell is resuspended, cell count, then 1500rpm, 15min, centrifugation are gone
Clearly.
(6) the anticoagulant buffer of 300 μ l being added, cell is resuspended, 100 μ l confining liquids are then added, room temperature, which is protected from light, stands 5min,
Then appropriate magnetic bead is added, room temperature, which is protected from light, is incubated for 30min, and it then adds appropriate anticoagulant buffer and washs, 300rpm, 10min,
Supernatant is removed in centrifugation.
(7) cell is resuspended in again in anticoagulant buffer, splitter is placed on magnetic sheet, the anticoagulant buffering of 2ml is added
Liquid cleans splitter, and cell re-suspension liquid is then added, and adds the anticoagulant buffer washing splitter of 2ml, cell suspension when crossing column
It should be added dropwise along the wall of pillar.
(8) splitter is removed, new 15ml centrifuge tube is placed into, the anticoagulant buffer of 2ml is added, cell is blown down.
(9) it is then cultivated, is centrifuged again primary before cell culture, 300rpm, 10min discard anticoagulant buffer, with matching
Cell is resuspended in the culture medium made, is then added in culture dish, and culture medium is to contain IL3 10ng/ml, scf 50ng/ at this time
The sfem culture medium of ml, epo 1u/ml and 10%fbs, until the 6th day；Culture medium changes into containing 30%fbs, 3u/ at the 6th day
The sfem culture medium of ml epo was cultivated by the 14th day.
(10) it takes culture to the 8th day cell, suitable DPBS is added, 1000rpm 5min centrifuge washing twice, is added
The TY8 of cy5 is marked and the CD71 antibody of PE is marked, is protected from light is incubated for 40min on ice, the DPBS being pre-chilled in right amount is added,
1000rpm5min centrifuge washing is twice；
(11) by copolymerization coke and flow cytometer showed, it can be observed that aptamer TY8 and antibody CD71 can be lured in conjunction with this
The erythroblast led, and there are common locations.
Whether erythroblast is combined in order to further determine TY8, using having by the induction differentiation of CD34 positive cell
The erythroblast of differentiation is carried out the label of CD71 antibody and the label of aptamer TY8 by nucleated red blood cell, it can be observed that stream
The consistency of formula result, and the common location effect of focusing results altogether, are shown in Fig. 2.
Erythroblast experiment in embodiment 3:TY8 combination Cord blood
(1) Cord blood is acquired, anticoagulant heparin vacuum blood collection tube is placed in, is sent to laboratory in 4 hours；
(2) blood sample is diluted in equal volume with anticoagulant buffer, add the ficoll lymphocyte point that 4ml density is 1.077g/ml
Then blood is slowly added into the centrifuge tube by chaotropic into the centrifuge tube of 15ml cleaning, keep interface clear；
(3) 400rcf, 30min density gradient centrifugation, obtain the blood sample of layering: top layer is the clear serum of yellow, intermediate
It is the lymph separating liquid of white clear, bottom is red mature erythrocyte sediment, draws top layer and middle layer with pipette
Between white flock circular layer, be placed in new 15ml centrifuge tube, which is mononuclear cell layer；
(4) suitable DPBS is added in the cell of mononuclear cell layer, it is heavy that the centrifugation of 250rcf, 10min room temperature obtains cell
It forms sediment, suitable DPBS is then added and is resuspended, 250rcf, 10min room temperature centrifugation again obtains cell precipitation；
(5) it is resuspended with suitable Binding buffer, and corresponding CD71 antibody, GPA antibody and cy5 fluorescence mark is added
The TY8 aptamer of note is incubated for, and is marked, 4 DEG C of incubation 40min；
(6) isometric Washing buffer is added, 250rcf, 5min, 4 DEG C of centrifugations, obtain cell precipitation after mixing,
Repeating according still further to this washed once；
(7) it is finally resuspended with suitable Washing buffer, up flow type detection, the cell for obtaining double Yangxins number is to have
Nucleated red blood cell, and aptamer TY8 has been analyzed in this group of cell markings.
The investigation that TY8 combination fetal nucleated red blood is carried out using clinical sample Cord blood, first to Cord blood density level bands
Degree centrifugation obtains mononuclear cell layer, and the antibody fluorescence for carrying out erythroblast marker CD71 and GPA to it marks, simultaneously respectively
It is incubated for TY8, random library, then carries out flow cytometer showed, in the erythroblast group of sun bis- for CD71 and GPA, TY8
Can specificity identification, see Fig. 3.
Embodiment 4:TY8 coupled bead captures erythroblast experiment
(1) peripheral blood blood sample is acquired, anticoagulant heparin vacuum blood collection tube is placed in, is sent to laboratory in 4 hours；
(2) blood sample is diluted in equal volume with the DPBS containing 5%BSA and 4%EDTA, adding 4ml density is 1.077g/ml's
Then blood is slowly added into the centrifuge tube into the centrifuge tube of 15ml cleaning, makes boundary by ficoll lymphocyte separation medium
Face is clear；
(3) 400rcf, 30min density gradient centrifugation, obtain the blood sample of layering: top layer is the clear serum of yellow, intermediate
It is the lymph separating liquid of white clear, bottom is red mature erythrocyte sediment, draws top layer and middle layer with pipette
Between white flock circular layer, be placed in new 15ml centrifuge tube, which is mononuclear cell layer；
(4) suitable DPBS is added in the cell of mononuclear cell layer, it is heavy that the centrifugation of 250rcf, 10min room temperature obtains cell
It forms sediment, suitable DPBS is then added and is resuspended, 250rcf, 10min room temperature centrifugation again obtains cell precipitation；
(5) cell is resuspended with Binding buffer, is added on appropriate label and has the CD71 antibody of PE dyestuff, and has
The aptamer TY8 of biotin, is placed in 40min on ice, and aptamer is made to identify the erythroblast in blood；
(6) isometric Washing buffer is added, 250rcf, 5min, 4 DEG C of centrifugations, obtain cell precipitation after mixing,
Repeating according still further to this washed once；
(7) it is added and the magnetic bead and core dyestuff hoechst33342 of Streptavidin is marked in right amount, and containing 0.1%
Tween Washing buffer solution environmental in 4 DEG C of incubation 20min, tie Streptavidin and biotin adequately
It closes；
(8) system above is applied on magnet, stands 1 minute, adsorbs magnetic bead by magnet, remove solvent portions,
The Washing buffer washing containing 0.1% tween is added, in triplicate；
(9) it is finally resuspended with the Washing buffer of 0.1% tween, and observes in the case where copolymerization is burnt magnetic capture to having
Nucleated red blood cell is shown in Fig. 4.
Embodiment 5: the type identification test of aptamer TY8 combination target
Experimental procedure is as follows:
(1) preparation of ssDNA: taking aptamer TY8 and random library chain, 95 DEG C of denaturation 5min, after renaturation on ice
10min is centrifuged 4 DEG C of 5000rpm, 3min, and the Binding buffer that pre-cooling is added makes DNA concentration 250nM, be placed on ice to
With.
(2) preparation of cell: the PL45 cell of four wares of culture, until logarithmic growth phase, discards culture medium, with 2mL DPBS
It washes twice, two wares are separately added into 200 μ l, 0.25% trypsase thereto and 200 μ l 0.1mg/ml Proteinase K room temperatures disappear
Change 10min, other two ware is separately added into 0.2% EDTA equal conditions digestion, and 500 μ l complete mediums are then added and terminate
Digestion is centrifuged 800rpm 4min, inhales and abandons supernatant.It is washed twice with Washing buffer, cell counting board counts, and makes every group thin
Born of the same parents' number is 3 × 105It is a.
(3) incubation of ssDNA and cell: in the cell for taking 200 μ l to EDTA to digest on above-mentioned random library chain, by TY8
In the cell for taking 200 μ l to digest to other three kinds of modes respectively, cell being resuspended and gently blows and beats mixing, 4 DEG C of shaking tables, which are protected from light, is incubated for 1h,
After being incubated for, be added Washing buffer centrifuge washing twice, be added 500 μ l Washing buffer, by it is ready to
Sample crosses film, it is made to be dispersed into individual cells, the fluorescence intensity of flow cytomery cell.As a result as shown in figure 5, TY8
The PL45 cell that can be handled with targets identification through EDTA, and cannot identify the PL45 cell of Proteinase K and trypsin treatment, it says
The target type that bright TY8 is combined is albumen.
Embodiment 6: aptamer target Mass Spectrometric Identification experiment
(1) epicyte protein is extracted
(1) culture PL45 (pancreatic carcinoma) inhales to logarithmic growth phase and abandons old culture medium, DPBS is cleaned twice, is added
The digestion of EDTA room temperature, collects cell, twice with Washing buffer centrifuge washing；
(2) suitable hypotonic buffer liquid is added, in 4 DEG C of shaking table 30min after concussion mixing；After be centrifuged, 4000rpm,
10min abandons supernatant；It is washed 3 times with hypotonic buffer liquid again；
(3) appropriate memebrane protein lysate is added into centrifuge tube, at 4 DEG C after concussion mixing, cracks 30min, rear centrifugation is protected
Stay supernatant, 4000rpm, 4 DEG C, 10min.Supernatant, that is, protein example of reservation is placed on -80 DEG C of preservations.
(2) preparation of PAGE glue protein sample
(1) closing of the coated Ago-Gel pearl of Streptavidin: three 1.5ml EP pipes are taken, are added 100 μ l's
Ago-Gel pearl is centrifuged 2500rpm 3min, is respectively labeled as blank sample, library sample, TY8 sample.It is added into each EP pipe
5% BSA of 1mL, concussion mix, and close 1h in 4 DEG C of shaking tables.
(2) closing of memebrane protein: the DNA confining liquid of 3ml is added into the protein sample of collection and is incubated at 4 DEG C after concussion is even
1h is educated, after having closed, takes out and gives over to holoprotein sample sets in right amount.
(3) it after Ago-Gel pearl and memebrane protein have been closed, is washed 5 times with Washing buffer, 2500rpm 4
DEG C, 3min is placed in stand-by on ice.
(4) Ago-Gel pearl, library, aptamer and memebrane protein are incubated for: the memebrane protein after closing is uniformly divided into 3
Group is simultaneously respectively added in the EP pipe of 3 Ago-Gel pearls closed, and is separately added by respective markers and has modified biology
The random library and TY8 of element.Concussion, which mixes, is put into 4 DEG C of shaking tables incubation 1h.
(5) it after being incubated for, Washing buffer washing centrifugation 5 times, 2500rpm, 4 DEG C, 3min, abandons after centrifugation
Clearly.
(6) 2 × loading buffer isometric with Ago-Gel pearl, 100 DEG C of denaturation protein denaturation: are added
10min is placed in 10min on ice, -80 DEG C of preservations.
(3) SDS-PAGE
(1) preparation of PAGE glue: 8% separation gel and 5% concentration glue 10%SDS-PAGE Protein Separation glue (5mL): small
In beaker, it is sequentially added into 2mL ddH2O, 1.6mL30% acryloyl glue, 1.25mL 1.5M Tris-HCl (pH8.8),
0.05mL10%SDS, 0.05mL10%APS, 0.002mLTEMED are mixed well and are added in offset plate.It is placed at room temperature for, it is solid wait be gelled
5%SDS-PAGE protein concentration glue is added afterwards.3.4mL ddH is drawn in order230% acrylamide of O, 0.85mL,
0.625mL1.0M Tris-HCl (pH6.8), 0.05mL10%SDS, 0.05mL10%APS, 0.005mLTEMED.
(2) electrophoresis: configured SDS-PAGE glue is correctly fitted into electrophoresis tank, enters 1 × electrophoresis liquid (one piece of glue dosage
750mL), by the sample having had been prepared for by marker, blank pearl sample, library group pearl sample, aptamer pearl sample sequence
60V voltage in sample adding hole is subjected to electrophoresis, after bromophenol blue band migration to lower layer's separation gel, increases voltage to 120V
Continue electrophoresis, until bromophenol blue band migration completes electrophoresis to glue bottom product.
(3) proteopexy: taking out SDS-PAGE glue, and separation gel is put into 2h in fixer, afterwards with ultrapure by removal concentration glue
Water rinses 3 times, each 15min.
(4) PAGE glue is transferred in coomassie brilliant blue staining liquid overnight, is contaminated with milli-Q water Coomassie brilliant blue dye liquor
Good glue washs 4 times, each 15min.Protein band is high-visible on to glue.
(5) scanner scanning SDS-PAGE glue, as a result as shown in Figure 6.
(4) it cuts glue and does mass spectral analysis
In order to identify the differential protein shown in SDS-PAGE glue, its digestion is extracted, carries out Mass Spectrometric Identification.As a result such as
It is 2088.63 that CD71 highest scoring, which makes number one, shown in table 1, in the protein that detects altogether in differential band, much high
In come deputy albumen keratin Keratin (the common albumen from hair and skin, occur may be due to
Operation process is improper to be caused), and band coverage rate has reached 70.13%.In view of CD71 is a kind of transmembrane protein, we
Speculate that CD71 albumen is likely to the target of TY8 combination.
The protein-bonded mass spectrometry results of table 1:TY8
The common location of embodiment 7:TY8 and CD71 antibody is tested
(1) preparation of FITC-TY8 and PE-antiCD71: taking 95 DEG C of TY8 that have modified FITC and be denaturalized 5 minutes, cold on ice
But 10 minutes, the DNA solution that Binding buffer is configured to 250nM is added.The CD71 antibody that 10 μ l have modified PE is taken out, is added
Enter 190 μ l Binding buffer to be placed on ice for use.
(2) preparation of cell: PL45 cell inoculation is cultivated into optics culture dish.Culture medium is discarded, it is clear that DPBS is added
Wash cell twice, for use.
(3) incubation of TY8 and CD71 antibody and cell: the TY8 and 200 μ l for taking 200 μ l to modify FITC have modified PE's
CD71 antibody is added in the optics culture dish of the same PL45 cell, is mixed gently, and 4 DEG C are protected from light shaking table and are incubated for 1h.
(4) after being incubated for, Washing buffer clean twice, after in optics culture dish be added 1mL Washing
Buffer takes pictures under laser confocal microscope, and there are common locations with CD71 antibody by TY8 as shown in Figure 7.
Embodiment 8:aptamer-pull down experiment
(1) epicyte protein is extracted
(1) culture PL45 inhales to logarithmic growth phase and abandons old culture medium, DPBS is cleaned twice, and the digestion of EDTA room temperature is added, receives
Collect cell, twice with Washing buffer centrifuge washing；
(2) suitable hypotonic buffer liquid is added, in 4 DEG C of shaking table 30min after concussion mixing；After be centrifuged, 4000rpm,
10min abandons supernatant；It is washed 3 times with hypotonic buffer liquid again；
(3) appropriate memebrane protein lysate is added into centrifuge tube, at 4 DEG C after concussion mixing, cracks 30min, rear centrifugation is protected
Stay supernatant, 4000rpm, 4 DEG C, 10min.Supernatant, that is, protein example of reservation is placed on -80 DEG C of preservations.
(2) preparation of PAGE glue protein sample
(1) closing of the coated Ago-Gel pearl of Streptavidin: three 1.5ml EP pipes are taken, are added 100 μ l's
Ago-Gel pearl is centrifuged 2500rpm 3min, is respectively labeled as blank sample, library sample, TY8 sample.It is added into each EP pipe
5% BSA of 1mL, concussion mix, and close 1h in 4 DEG C of shaking tables.
(2) closing of memebrane protein: the DNA confining liquid of 3ml is added into the protein sample of collection and is incubated at 4 DEG C after concussion is even
1h is educated, after having closed, takes out and gives over to holoprotein sample sets in right amount.
(3) it after Ago-Gel pearl and memebrane protein have been closed, is washed 5 times with Washing buffer, 2500rpm 4
DEG C, 3min is placed in stand-by on ice.
(4) Ago-Gel pearl, library, aptamer and memebrane protein are incubated for: the memebrane protein after closing is uniformly divided into 3
Group is simultaneously respectively added in the EP pipe of 3 Ago-Gel pearls closed, and is separately added by respective markers and has modified biology
The random library and TY8 of element.Concussion, which mixes, is put into 4 DEG C of shaking tables incubation 1h.
(5) it after being incubated for, Washing buffer washing centrifugation 5 times, 2500rpm, 4 DEG C, 3min, abandons after centrifugation
Clearly.
(6) 2 × loading buffer isometric with Ago-Gel pearl, 100 DEG C of denaturation protein denaturation: are added
10min is placed in 10min on ice, -80 DEG C of preservations.
(3) SDS-PAGE
(1) preparation of PAGE glue: 8% separation gel and 5% concentration glue 10%SDS-PAGE Protein Separation glue (5mL): small
In beaker, it is sequentially added into 2ml ddH230% acryloyl glue of O, 1.6ml, 1.25mL 1.5M Tris-HCL (pH8.8),
0.05ml 10%SDS, 0.05ml 10%APS, 0.002ml TEMED is mixed well and is added in offset plate.It is placed at room temperature for, to glue
5%SDS-PAGE protein concentration glue is added after solidification.3.4ml ddH is drawn in order230% acrylamide of O, 0.85mL,
0.625ml 1.0M Tris-HCl (pH6.8), 0.05ml 10%SDS, 0.05ml 10%APS, 0.005ml TEMED.
(2) electrophoresis: configured SDS-PAGE glue is correctly fitted into electrophoresis tank, enters 1 × electrophoresis liquid (one piece of glue dosage
750mL), by the sample having had been prepared for by marker, blank pearl sample, library group pearl sample, aptamer pearl sample sequence
60V voltage in sample adding hole is subjected to electrophoresis, after bromophenol blue band migration to lower layer's separation gel, increases voltage to 120V
Continue electrophoresis, until bromophenol blue band migration completes electrophoresis to glue bottom product.
(3) proteopexy: taking out SDS-PAGE glue, and separation gel is put into 2h in fixer, afterwards with ultrapure by removal concentration glue
Water rinses 3 times, each 15min.
(4) PAGE glue is transferred in coomassie brilliant blue staining liquid overnight, is contaminated with milli-Q water Coomassie brilliant blue dye liquor
Good glue washs 4 times, each 15min.Protein band is high-visible on to glue.
(4) transferring film shines
(1) improvement film buffer is configured in advance, places 4 DEG C for use.
(2) after SDS-PAGE electrophoresis, glue is taken out, removal upper layer be concentrated glue, according to positive clamping plate, sponge, filter paper,
The sequence assembling of NC film, glue, filter paper, sponge, clamping plate, is put into transferring film slot, transferring film 300mA, 90min.It is needed when transferring film by transferring film
Slot is placed in ice.
(3) NC film is taken out, is dyed with Ponceaux dye liquor, by CD71 albumen and GAPDH albumen (reference protein) position
It cuts, closes 1h. with 5% milk room temperature
(4) by protein band and respective primary antibody antibody incubation, 4 DEG C overnight.
(5) protein band is cleaned 3 times with TBST, each 10min.
(6) by protein band and corresponding secondary antibody antibody incubation room temperature 1h, after cleaned 3 times with TBST, each 10min.
(7) luminescent solution is prepared, luminescent solution will be uniformly added into above protein band, is placed in gel imager and is imaged.
As a result see Fig. 8, it was demonstrated that aptamer TY8 is combined is CD71.
Embodiment: 9:ELISA experiment
(1) elisa plate is taken, altogether octal.Coating buffer is added in new 1.5ml EP pipe, rear addition CD71 is pure
Albumen, final concentration of 0.3 μM.After be even added in the hole elisa, 4 DEG C of shaking tables are incubated overnight.
(2) coating buffer is sucked out in next day, is cleaned three times with Washing buffer.
(3) 250 μ l assay diluent are added in every hole, and room temperature shaker is incubated for 1h.
(4) it inhales and abandons solution, washed three times with Washing buffer.
(5) according to experimental measuring, in advance by 95 DEG C of denaturation 5min of aptamer TY8, renaturation 10min on ice.With
The biotin-TY8 of Binding buffer preparation various concentration:
5 '-biotin-TTTTTTACTCATAGGGTTAGGGGCTGCTGGCCAGATACTCAGATGGTAG GGTTACTAT
GAGC-3 ', SEQ NO.2, making every hole concentration is respectively 0,0.025,0.05,0.1,0.15,0.25,0.5,0.75 μM, is prepared not
With concentration aptamer when prepared using gradually dilution method, 4 DEG C of shaking tables are incubated for 1h.
(6) it inhales and abandons solution, Washing buffer is washed four times.
(7) 100 μ l SAv-HRP are added in every hole, are incubated at room temperature 1h.
(8) it inhales and abandons solution, Washing buffer is washed five times.
(9) 100 μ l substrate solution are added in every hole, and room temperature shaker, which is protected from light, is incubated for 30min.
(10) 50 μ l stop solution are added in every hole.
(11) absorption value of microplate reader detection A450nm and A570nm acquires difference, pays attention to being protected from light operation in detection process.
(12) according to surveyed absorption value, Graphpad software development Kd curve is utilized.
TY8 has been investigated to the affinity of TfR 1 (CD71 albumen), GraphPad software is utilized and calculates core
The dissociation constant of sour aptamer and target (see Fig. 9).The nucleic acid for indicating biotin-TY8 of CD71 pure protein and various concentration is fitted
Body is directly incubated for, and SAv-HRP is added afterwards, and the dissociation constant of TY8 combination CD71 pure protein is calculated after detecting using microplate reader
Kd=50.48nM.For Kd value in nM rank, this result, which demonstrates TY8, has very strong affinity to CD71 albumen.
Sequence table
<110>Hunan University
<120>it is a kind of for identification or the method for enrichment erythroblast
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 56
<212> DNA
<213>unknown (Unknown)
<400> 1
actcataggg ttaggggctg ctggccagat actcagatgg tagggttact atgagc 56
<210> 2
<211> 62
<212> DNA
<213>unknown (Unknown)
<400> 2
ttttttactc atagggttag gggctgctgg ccagatactc agatggtagg gttactatga 60
gc 62
Claims (10)
1. it is a kind of for identification or the method for enrichment erythroblast, which is characterized in that using in aptamer and peripheral blood
The specific binding of erythroblast identifies or is enriched with erythroblast, and the aptamer sequence is as follows: 5 '-ACTCA
TAGGGTTAGGGGCTGCTGGCCAGATACTCAGATGGTAGGGTTACTATGAGC-3 '.
2. it is according to claim 1 for identification or enrichment erythroblast method, which is characterized in that by described
Aptamer increase perhaps delete base or base replacement obtains aptamer with the same function.
3. it is according to claim 1 or 2 for identification or enrichment erythroblast method, which is characterized in that it is described
Aptamer connects upper fluorescent material, radioactive substance, therapeutic substance, biotin or enzyme marker matter, obtains and the core
Sour aptamer has the nucleic acid aptamer derivative of identical combination erythroblast ability.
4. it is according to claim 1 or 2 or 3 for identification or enrichment erythroblast method, which is characterized in that including
Following steps:
(1), the pretreatment of peripheral blood: density gradient centrifugation obtains mononuclearcell layer；
(2), aptamer pre-processes: biotin in connection；
(3), enrichment process: aptamer and peripheral blood are incubated for, and washing removes extra aptamer, are then added and are modified
The magnetic bead of Streptavidin is incubated for, and finally captures out erythroblast under the action of magnet.
5. a kind of application of aptamer in the reagent of preparation identification or enrichment erythroblast, which is characterized in that described
Aptamer sequence is as follows:
- 3 ' of 5 '-ACTCATAGGGTTAGGGGCTGCTGGCCAGATACTCAGATGGTAGGGTTACTATGAGC.
6. application according to claim 5, which is characterized in that by increasing the aptamer or deleting alkali
Base or base replacement obtain aptamer with the same function.
7. application according to claim 5 or 6, which is characterized in that the aptamer connects upper fluorescent material, radiation
Property substance, therapeutic substance, biotin or enzyme marker matter, obtain that there is identical combination to have core red thin with the aptamer
The nucleic acid aptamer derivative of born of the same parents' ability.
8. a kind of aptamer exists preparing the application in reagent in conjunction with the PROTEIN C D71 on erythroblast surface, feature
In the aptamer sequence is as follows:
- 3 ' of 5 '-ACTCATAGGGTTAGGGGCTGCTGGCCAGATACTCAGATGGTAGGGTTACTATGAGC.
9. application according to claim 8, which is characterized in that by increasing the aptamer or deleting alkali
Base or base replacement obtain aptamer with the same function.
10. application according to claim 8 or claim 9, which is characterized in that the aptamer connects upper fluorescent material, puts
Penetrating property substance, therapeutic substance, biotin or enzyme marker matter obtain having identical combination CD71 egg with the aptamer
The nucleic acid aptamer derivative of Bai Nengli.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811452001.4A CN109439624B (en) | 2018-11-30 | 2018-11-30 | Method for identifying or enriching nucleated red blood cells |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811452001.4A CN109439624B (en) | 2018-11-30 | 2018-11-30 | Method for identifying or enriching nucleated red blood cells |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109439624A true CN109439624A (en) | 2019-03-08 |
| CN109439624B CN109439624B (en) | 2020-12-04 |
Family
ID=65555422
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811452001.4A Active CN109439624B (en) | 2018-11-30 | 2018-11-30 | Method for identifying or enriching nucleated red blood cells |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109439624B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115109780A (en) * | 2022-06-22 | 2022-09-27 | 湖南大学 | Aptamer capable of specifically recognizing and combining with circulating fetal nucleated red blood cells, complementary sequence and application of aptamer and complementary sequence |
| CN115786350A (en) * | 2022-08-16 | 2023-03-14 | 湖南大学 | Aptamer capable of specifically recognizing and combining peripheral blood T lymphocytes, complementary sequence and application of aptamer and complementary sequence |
-
2018
- 2018-11-30 CN CN201811452001.4A patent/CN109439624B/en active Active
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115109780A (en) * | 2022-06-22 | 2022-09-27 | 湖南大学 | Aptamer capable of specifically recognizing and combining with circulating fetal nucleated red blood cells, complementary sequence and application of aptamer and complementary sequence |
| CN115786350A (en) * | 2022-08-16 | 2023-03-14 | 湖南大学 | Aptamer capable of specifically recognizing and combining peripheral blood T lymphocytes, complementary sequence and application of aptamer and complementary sequence |
| CN115786350B (en) * | 2022-08-16 | 2023-08-25 | 湖南大学 | Aptamer capable of specifically recognizing and combining peripheral blood T lymphocytes, complementary sequence and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109439624B (en) | 2020-12-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104007257B (en) | Method for detecting non-humoral rare karyotes, and kit thereof | |
| JP2000508171A (en) | How to enrich rare cells | |
| US20110195413A1 (en) | Integrated Method for Enriching and Detecting Rare Cells from Biological Body Fluid Sample | |
| WO2020107495A1 (en) | Preparation method for lymphocyte sample for flow cytometry analysis | |
| Widemann et al. | CD146‐based immunomagnetic enrichment followed by multiparameter flow cytometry: a new approach to counting circulating endothelial cells | |
| CN104977284B (en) | A kind of capture of fetal nucleated red blood and identification method | |
| CN106635995A (en) | Circulating tumor cell negative enrichment method | |
| CN112552407B (en) | Antibody composition and application thereof in detecting acute B lymphocyte leukemia | |
| JP2011508892A (en) | Method for isolation and enumeration of cells from a composite sample matrix | |
| US20210389225A1 (en) | A flow cytometric detection method for lymphocyte in immune cells | |
| US20100159506A1 (en) | Methods and systems for genetic analysis of fetal nucleated red blood cells | |
| CN107402296A (en) | The immunofluorescence dyeing and interpretation method of a kind of circulating tumor cell | |
| CN106771185A (en) | A kind of nasopharyngeal carcinoma circulating tumor cell detection kit | |
| WO2019129178A1 (en) | Composition containing anti-cd45 monoclonal antibody, and method for using same | |
| CN110095599B (en) | Micro-immunofluorescence detection method without cell loss | |
| CN106970225B (en) | A kind of kit and its application for combining 8 probe identification circulating tumor cells of CEP using CD45 immunofluorescences | |
| CN106980018B (en) | A kind of kit and its application using CD45 immunofluorescences joint CEP17 probe identification circulating tumor cells | |
| CN109439624A (en) | A method of for identification or enrichment erythroblast | |
| CN109439732A (en) | A kind of kit early sieved for three-dimensional noninvasive tumour | |
| CN110174519B (en) | Confluent-detection type erythrocyte blood type irregular antibody detection kit based on solid-phase agglutination technology and preparation method thereof | |
| CN115166252A (en) | Lymphocyte subset grouping and quantitative detection kit, detection method and application thereof | |
| Terstappen et al. | Flowcytometry‐Principles and Feasibility in Transfusion Medicine. Enumeration of Epithelial Derived Tumor Cells in Peripheral Blood | |
| CN110333358A (en) | A kind of method for building up of mice with acute lung injury lungs panimmunity cell characteristic map | |
| US9632086B2 (en) | Method and kit for determining-antibody sensitivity and clone cell strain | |
| CN111351937A (en) | MMR protein expression deletion detection kit and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |