CN109432050A - A kind of composition of natural killer cells excretion body and macromolecular dendritic - Google Patents

A kind of composition of natural killer cells excretion body and macromolecular dendritic Download PDF

Info

Publication number
CN109432050A
CN109432050A CN201811528078.5A CN201811528078A CN109432050A CN 109432050 A CN109432050 A CN 109432050A CN 201811528078 A CN201811528078 A CN 201811528078A CN 109432050 A CN109432050 A CN 109432050A
Authority
CN
China
Prior art keywords
dendritic
macromolecular
nkexos
nano particle
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201811528078.5A
Other languages
Chinese (zh)
Inventor
王国胜
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN201811528078.5A priority Critical patent/CN109432050A/en
Publication of CN109432050A publication Critical patent/CN109432050A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5107—Excipients; Inactive ingredients
    • A61K9/513—Organic macromolecular compounds; Dendrimers
    • A61K9/5146—Organic macromolecular compounds; Dendrimers obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyethylene glycol, polyamines, polyanhydrides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/17—Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5107—Excipients; Inactive ingredients
    • A61K9/5176—Compounds of unknown constitution, e.g. material from plants or animals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5192—Processes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/10—Antimycotics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Communicable Diseases (AREA)
  • Physics & Mathematics (AREA)
  • Nanotechnology (AREA)
  • Oncology (AREA)
  • Optics & Photonics (AREA)
  • Virology (AREA)
  • Zoology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Botany (AREA)
  • Hematology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Medicinal Preparation (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

This application involves the compositions of a kind of natural killer cells excretion body and macromolecular dendritic.More particularly to a kind of nano particle, it includes the kernels of the shell of natural killer cells excretion body (Exos) and polyamide-amide (PAMAM) dendritic；Kernel loads miRNA.A kind of pharmaceutical composition is specifically further related to, it includes nano particles and NKExos.The nano particle or the pharmaceutical composition are used for treating cancer or infection, provide new treatment thoughts and experiment basis for the clinical treatment of tumour or non-tumor disease.

Description

A kind of composition of natural killer cells excretion body and macromolecular dendritic
Technical field
The present invention relates to field of biomedicine, the group of specific natural killer cells excretion body and macromolecular dendritic Close object.
Background technique
Targeted drug delivery system use for cancer treatment is due to its high delivery efficiency and minimal side effect, gradually by wide General concern.In the recent period studies have found that a kind of biomembrane camouflage strategy, and think it in cancer treatment and have very big latent Power.The strategy is related to being coated with the nano-carrier of natural biological film component, makes it surface-functionalized.Many similar films by with In manufacturing bionical core-shell nano, including from red blood cell (RBC), blood platelet, bacterium, leucocyte (WBC), cancer cell Film.However, bar none, the manufacture of core-shell nanoparticles needs to extract film material by cell cracking and film purifying. This process substantially increases pollution and destroys the risk of functional surface albumen.The former causes immunogenicity to increase, the latter Lead to the function reduction of material.Therefore, for its clinical application, functional and high degree of biocompatibility material is obtained extremely It closes important.
Excretion body (exosomes or Evs) is the outer double-layer of lipoid vesica of nanoscale cell, diameter range be 30nm extremely 150nm, almost all of cell all secrete them.Natural kill (NK) cell, it is known that crucial make is played in tumor immunology With the excretion body surface of secretion is related to the targeting cytotoxicity to kinds of tumors up to killing albumen, including FASL and perforin.Have Research has shown that NK cell excretion body (NKExos) is accumulated with tumour-specific, and normal tissue does not have cytotoxic activity.Meanwhile Acid tumor microenvironment can also promote the accumulation of this nanoparticle.Therefore, NKExos can execute promote cancer target and The dual function of direct antitumor agent.In addition, NKExos is easily handled, because they are stable vesicas, can be protected at -80 DEG C Hold its bioactivity at least 2 years.Importantly, the therapy based on NK cell can be applied in the scene of allogeneic, no Cause graft versus host disease(GVH disease) (GvHD).Therefore, in the synthesis process, excessive free NKExos will not cause side effect, but Due to their own property and have antitumor action.In addition, using the NKExos of integration rather than broken film is as receiving The shell of rice grain also avoids immunogenic substance and is contaminated, such as point of the functional protein during traditional film preparation Solution.Therefore, NKExos is furtherd investigate, helps to provide new treatment think of for the clinical treatment of tumour or non-tumor disease Road and experiment basis.
Summary of the invention
In order to solve the problems in the prior art, the present invention have studied a kind of natural killer cells excretion body (NKExos) and The composition of macromolecular dendritic, specifically a kind of novel bionical core-shell polymer and a kind of bionical nucleocapsid are poly- Close the composition of object and NKExos.
The present invention provides a kind of nano particles, and it includes excretion body (Exos) and macromolecular dendritics.
In an aspect, the nano particle has nucleocapsid structure；Preferably, the Exos is as nano particle Shell, kernel of the macromolecular dendritic as nano particle.
In an aspect, the macromolecular dendritic is selected from the macromolecular dendroid polymerization of tyrosine coupling Object；Preferably, the macromolecular dendritic is selected from polyamide-amide (PAMAM) dendritic.
In an aspect, the Exos is selected from immunocyte excretion body；Preferably, it is thin to be selected from natural kill by the Exos It is extracellular to secrete body (NKExos).
In an aspect, the mass ratio of the Exos and the macromolecular dendritic is 4:1~1:4.
In an aspect, the kernel further loads gene therapeutic agents；Preferably, the gene therapeutic agents are selected from core Acid fragment；It is furthermore preferred that the nucleic acid fragment is selected from DNA, RNA.
In an aspect, the nucleic acid fragment is selected from miRNA；Preferably, the nucleotide sequence of the miRNA such as SEQ Shown in ID NO:1.
The present invention provides a kind of pharmaceutical composition, it includes the nano particle of the foregoing description and the foregoing description NKExos, and optional, pharmaceutically acceptable carrier.
In an aspect, the mass ratio of the rice grain and the NKExos are 4:1~1:4.
The present invention provides a kind of preparation methods of the pharmaceutical composition of foregoing description, include the following steps:
(1) certain density nucleic acid fragment is added in suitable buffer；
(2) a certain amount of macromolecular dendritic is added, is sufficiently mixed reaction；
(3) centrifugation removes excessive nucleic acid fragment, collects precipitating, and the macromolecular dendroid for obtaining being loaded with nucleic acid fragment is resuspended Polymer；
(4) a certain amount of natural killer cells excretion body (NKExos) is added, is incubated for；
(5) described pharmaceutical composition is obtained.
In an aspect, the macromolecular dendritic is selected from is coupled with tyrosine；Preferably, the macromolecular Dendritic is selected from polyamide-amide (PAMAM) dendritic.
In an aspect, the mass ratio of the NKExos and the macromolecular dendritic is 4:1~1:4.
In an aspect, the nucleic acid fragment is selected from DNA, RNA；Preferably, the nucleic acid fragment is selected from miRNA；More Preferably, the nucleotide sequence of the miRNA is as shown in SEQ ID NO:1.
The present invention provides the pharmaceutical compositions of a kind of nano particle of foregoing description or the foregoing description to be used in preparation Purposes in treating cancer or the drug of infection.
In an aspect, the cancer is selected from lung cancer, gastric cancer, cancer of pancreas, colon cancer, kidney, oophoroma or melanin Tumor；The infection is selected from virus infection, bacterium infection or fungal infection.
The present invention reports a kind of by raw after simple incubation NKExos and the dendritic macromole of tyrosine coupling for the first time At containing excretion body camouflage core shell nanoparticles (NNs) and NKExos nanoparticle compositions.
NNs in composition is a kind of bionical core-shell polymer (Fig. 1), by being self-assembly of for two kinds of components: (1) being based on The kernel portion of polyamide-amide (PAMAM) dendritic, for loading gene therapeutic agents；(2) based on the shell of NKExos With cancer target and directly antitumor dual function.NKExos is guided NNs by endocytosis/fusion or FasL/Fas It interacts to tumour and with the plasma membrane of target cell, the two also assists in NKExos cytotoxicity.It is internalized by by target cell Then after acidic endosomes escape, therapeutic miRNA is released to the transcript profile batch or gene in cytoplasm and adjusting cell, Its antitumor action combined with NKExos performance.
Detailed description of the invention
Fig. 1: the electromicroscopic photograph of nano particle.
Fig. 2: the preparation flow figure of nano particle and natural killer cells excretion body (NKExos).
Fig. 3: proliferation of human gastric cancer cell by natural killer cells excretion body NKExos, be loaded with the PAMAM dendroid of purpose miRNA The shadow of the composition (NNs-NKExos) of polymer (PAMAM-miRNA), the core shell nanoparticles of excretion body camouflage and NKExos Ring (note: each group experimental data has significant difference).
Fig. 4: proliferation of lung cancer cells by natural killer cells excretion body NKExos, be loaded with the PAMAM dendroid of purpose miRNA The shadow of the composition (NNs-NKExos) of polymer (PAMAM-miRNA), the core shell nanoparticles of excretion body camouflage and NKExos Ring (note: each group experimental data has significant difference).
Fig. 5: melanoma cells are proliferated the PAMAM tree for by natural killer cells excretion body NKExos, being loaded with purpose miRNA The composition (NNs-NKExos) of dendritic polymer (PAMAM-miRNA), the core shell nanoparticles of excretion body camouflage and NKExos Influence (note: each group experimental data have significant difference).
Specific embodiment
Experimental material used in following experimental methods can be obtained easily from commercial company unless otherwise instructed.? In the case where spirit of that invention, those skilled in the art combine well-known technique, and many modifications can be made to the present invention, Such modification is also fallen within protection scope of the present invention.
Embodiment 1, preparation natural killer cells excretion body (NKExos)
One, experimental material
NK cells of human beings system NK92-MI, DMEM culture medium (contains 10% fetal calf serum), in 37 DEG C, 5%CO2Under the conditions of cultivate, It is spare.
Two, experimental procedure
1, cultivate NK92-MI cell 3 days or more, collect supernatant.
2, supernatant discards precipitating through 10,000g, 4 DEG C, centrifugation 30 minutes.
3, supernatant retains filtrate through 0.22 μm of membrane filtration.
4, filtrate retains precipitating through 100,000g, 4 DEG C, centrifugation 70 minutes.
5, precipitating is cleaned several times through PBS solution, obtains NKExos, spare.
The composition of core shell nanoparticles (NNs) and NKExos that embodiment 2, preparation excretion body pretend
One, experimental material
MiRNA let7a, sequence: UGAGGUAGUAGGUUGUAUAGUU (SEQ ID NO:1)
The polyamide-amide dendritic (PAMAM G5) of tyrosine coupling
Two, experimental procedure
1,100 μ 1 × PBS buffer solution of L are added in the purpose miRNA of 10mL concentration 1mM.
2, the PAMAM dendritic of the tyrosine coupling of 4mL (5.44mg) is added, is sufficiently mixed, reacts 15 at 4 DEG C Minute.
3,10,000rpm, centrifugation 30 minutes, discard excessive miRNA, collect precipitating, and resuspension obtains being loaded with purpose miRNA PAMAM dendritic.
4, the NKExos of above-mentioned 10mg is added, is incubated for 24 hours at 4 DEG C.
5, NNs-NKExos composition is obtained.
The influence of embodiment 3, NNs-NKExos composition to tumour cell
One, experimental material
Natural killer cells excretion body NKExos is prepared in batches respectively, the PAMAM dendroid for being loaded with purpose miRNA is poly- It closes object (PAMAM-miRNA), the core shell nanoparticles of excretion body camouflage and the composition (NNs-NKExos) of NKExos.
Gastric carcinoma cell lines SNU484, lung cancer cell line NCI-H460, K-1735 A375, DMEM culture medium (contain 10% fetal calf serum), in 37 DEG C, 5%CO2Under the conditions of cultivate, it is spare.
Two, experimental group
1 group: blank control
2 groups: NKExos
3 groups: PAMAM-miRNA
4 groups: NNs-NKExos composition
Three, experimental method
1, tumour cell is digested through pancreatin, and cell is collected in centrifugation.
2, cell is suspended through DMEM culture medium (containing 10% fetal calf serum), by 1 × 1056 orifice plates are added in/mL cell density In.
3, it is added without any reagent for 1 group, 10 μ g NKExos are added in 2 groups of every holes, and 20 μ g PAMAM- are added in 3 groups of every holes MiRNA, 4 groups of 30 μ g NNs-NKExos compositions of addition.
4, each experimental group is cultivated 24,48,72 hours respectively.
5, after cultivating, 20 μ L CCK-8 reagents are added in every hole, continue to be incubated for 3 hours.
6, CCK-8 method detects cell survival rate.
Four, experimental result
Fig. 3-5 respectively illustrate stomach cancer cell, lung carcinoma cell, melanoma cells proliferation by NKExos, PAMAM- The influence of miRNA, NNs-NKExos.By in figure it is found that NKExos, PAMAM-miRNA, NNs-NKExos three can inhibit swollen The characteristics of proliferation of oncocyte, wherein NNs-NKExos obviously combines both NKExos and PAMAM-miRNA, to tumour cell The influence of proliferation is more significant.

Claims (10)

1. a kind of nano particle, it includes excretion body (Exos) and macromolecular dendritics；Preferably, the nano particle With nucleocapsid structure；Preferably, shell of the Exos as nano particle, the macromolecular dendritic are used as and receive The kernel of rice grain.
2. nano particle as described in claim 1, the macromolecular dendritic is selected from the macromolecular of tyrosine coupling Dendritic；Preferably, the macromolecular dendritic is selected from polyamide-amide (PAMAM) dendritic； And/or
The Exos is selected from immunocyte excretion body；Preferably, the Exos is selected from natural killer cells excretion body (NKExos).
3. the mass ratio of nano particle as claimed in claim 1 or 2, the Exos and the macromolecular dendritic is 4:1~1:4.
4. nano particle as described in any one of claims 1-3, the kernel further loads gene therapeutic agents；Preferably, The gene therapeutic agents are selected from nucleic acid fragment；It is furthermore preferred that the nucleic acid fragment is selected from DNA, RNA.
5. nano particle as claimed in claim 4, the nucleic acid fragment is selected from miRNA；Preferably, the nucleosides of the miRNA Acid sequence is as shown in SEQ ID NO:1.
6. a kind of pharmaceutical composition, it includes nano particles as described in any one in claim 1-5, and such as claim 1-5 NKExos described in any one, and optional, pharmaceutically acceptable carrier；Preferably, the rice grain with it is described The mass ratio of NKExos is 4:1~1:4.
7. a kind of preparation method of pharmaceutical composition as claimed in claim 6, includes the following steps:
(1) certain density nucleic acid fragment is added in suitable buffer；
(2) a certain amount of macromolecular dendritic is added, is sufficiently mixed reaction；
(3) centrifugation removes excessive nucleic acid fragment, collects precipitating, and the macromolecular dendroid polymerization for obtaining being loaded with nucleic acid fragment is resuspended Object；
(4) a certain amount of natural killer cells excretion body (NKExos) is added, is incubated for；
(5) described pharmaceutical composition is obtained.
8. preparation method as claimed in claim 7, the macromolecular dendritic is selected to be coupled with tyrosine；It is preferred that , the macromolecular dendritic is selected from polyamide-amide (PAMAM) dendritic；It is furthermore preferred that the NKExos Mass ratio with the macromolecular dendritic is 4:1~1:4.
9. preparation method as claimed in claim 7 or 8, the nucleic acid fragment is selected from DNA, RNA；Preferably, the nucleic acid piece Section is selected from miRNA；It is furthermore preferred that the nucleotide sequence of the miRNA is as shown in SEQ ID NO:1.
10. prepared by nano particle as described in any one in claim 1-5 or pharmaceutical composition as claimed in claim 6 For the purposes in treating cancer or the drug of infection；Preferably, the cancer be selected from lung cancer, gastric cancer, cancer of pancreas, colon cancer, Kidney, oophoroma or melanoma；The infection is selected from virus infection, bacterium infection or fungal infection.
CN201811528078.5A 2018-12-13 2018-12-13 A kind of composition of natural killer cells excretion body and macromolecular dendritic Pending CN109432050A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811528078.5A CN109432050A (en) 2018-12-13 2018-12-13 A kind of composition of natural killer cells excretion body and macromolecular dendritic

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811528078.5A CN109432050A (en) 2018-12-13 2018-12-13 A kind of composition of natural killer cells excretion body and macromolecular dendritic

Publications (1)

Publication Number Publication Date
CN109432050A true CN109432050A (en) 2019-03-08

Family

ID=65559107

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811528078.5A Pending CN109432050A (en) 2018-12-13 2018-12-13 A kind of composition of natural killer cells excretion body and macromolecular dendritic

Country Status (1)

Country Link
CN (1) CN109432050A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115521914A (en) * 2022-10-12 2022-12-27 西北工业大学 Human primary natural killer cell in-vitro amplification system and method

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101361978A (en) * 2008-09-02 2009-02-11 浙江大学 Anti-cancer medicine release system using cellular membrane biomimetic modification polyamide-amide as carrier and preparation method thereof
WO2017079537A1 (en) * 2015-11-04 2017-05-11 Duke University Polycationic polymers for use in treating and detecting cancer
CN107913408A (en) * 2017-11-16 2018-04-17 中南大学 Composite drug-loaded system of a kind of excretion body aptamer liposome and its preparation method and application
CN107998149A (en) * 2017-12-11 2018-05-08 浙江大学 NK cell excretion bodies and correlation miRNA antibacterial and it is antitumor in application
WO2018107061A1 (en) * 2016-12-09 2018-06-14 Board Of Regents, The University Of Texas System Hybrid exosomal-polymeric (hexpo) nano-platform for delivery of rnai therapeutics

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101361978A (en) * 2008-09-02 2009-02-11 浙江大学 Anti-cancer medicine release system using cellular membrane biomimetic modification polyamide-amide as carrier and preparation method thereof
WO2017079537A1 (en) * 2015-11-04 2017-05-11 Duke University Polycationic polymers for use in treating and detecting cancer
WO2018107061A1 (en) * 2016-12-09 2018-06-14 Board Of Regents, The University Of Texas System Hybrid exosomal-polymeric (hexpo) nano-platform for delivery of rnai therapeutics
CN107913408A (en) * 2017-11-16 2018-04-17 中南大学 Composite drug-loaded system of a kind of excretion body aptamer liposome and its preparation method and application
CN107998149A (en) * 2017-12-11 2018-05-08 浙江大学 NK cell excretion bodies and correlation miRNA antibacterial and it is antitumor in application

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115521914A (en) * 2022-10-12 2022-12-27 西北工业大学 Human primary natural killer cell in-vitro amplification system and method
CN115521914B (en) * 2022-10-12 2024-04-19 西北工业大学 In-vitro amplification system and method for human primary natural killer cells

Similar Documents

Publication Publication Date Title
Li et al. Cell‐based delivery systems: emerging carriers for immunotherapy
US11186825B2 (en) Compositions and methods for evaluating and modulating immune responses by detecting and targeting POU2AF1
Gan et al. Producing anti-inflammatory macrophages by nanoparticle-triggered clustering of mannose receptors
EP3368689B1 (en) Composition for modulating immune responses by use of immune cell gene signature
US11180730B2 (en) Compositions and methods for evaluating and modulating immune responses by detecting and targeting GATA3
CN109837306A (en) Contain the excretion body and its preparation method and application of miRNA-204-5p
JP2000512271A (en) Devices and methods for encapsulated gene therapy
CN111954535A (en) Compositions and methods for organ protective expression and regulation of coding ribonucleic acids
EP2098589A2 (en) Immune cell modification method and cell modification device
CN106574241A (en) Cancer immunotherapy compositions and methods
Ma et al. Inhalable GSH-triggered nanoparticles to treat commensal bacterial infection in in situ lung tumors
CN114404571A (en) Chemotherapy drug loaded and TIGIT over-expressed engineered drug loaded cell membrane vesicle, and preparation method and application thereof
CN105722504A (en) Amorphous magnesium-substituted calcium phosphate compositions and their uses
CN117384859B (en) Preparation method and application of exosome from dendritic cells
Chen et al. Advances in CAR‐Engineered Immune Cell Generation: Engineering Approaches and Sourcing Strategies
CN109432050A (en) A kind of composition of natural killer cells excretion body and macromolecular dendritic
CN111748523B (en) Preparation method and application of immune regulation small extracellular vesicle
Lin et al. Immunostimulatory gene therapy combined with checkpoint blockade reshapes tumor microenvironment and enhances ovarian cancer immunotherapy
Basak et al. Immunocyte derived exosomes: insight into the potential chemo-immunotherapeutic nanocarrier targeting the tumor microenvironment
CN114191539B (en) Exosome nano particle for compositely co-carrying small molecule nucleic acid and active protein, and preparation method and application thereof
KR20130127525A (en) Compositions and methods for separating, characterizing and administering soluble selenoglycoproteins
CN115957336A (en) Bacterial cell membrane/DNA tetrahedral compound and preparation method and application thereof
CN106474471B (en) Composite antibody containing interferon alpha/tumor antibody/graphene oxide, preparation method and application
CN108619528A (en) A kind of cyclodextrin-mesoporous silicon multifunctional nano load medicine particle
Yu et al. Combined application of nanotechnology and multiple therapies with tumor immune checkpoints

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20190308