CN1094154C - PCR method for testing nucleic acid by fluoremtetry and its reagent box - Google Patents
PCR method for testing nucleic acid by fluoremtetry and its reagent box Download PDFInfo
- Publication number
- CN1094154C CN1094154C CN 99100669 CN99100669A CN1094154C CN 1094154 C CN1094154 C CN 1094154C CN 99100669 CN99100669 CN 99100669 CN 99100669 A CN99100669 A CN 99100669A CN 1094154 C CN1094154 C CN 1094154C
- Authority
- CN
- China
- Prior art keywords
- primer
- nucleic acid
- fluorescent
- test kit
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a fluorescent quantitation PCR method. The concentration of magnesium ions in a fluorescent PCR reaction system is 15 to 20mM, and the dosage of Taq enzymes is 8 to 10 units/reaction. A fluorescent value before a PCR reaction is measured, a fluorescent value after the PCR reaction is measured and a difference value of two fluorescent values is calculated. At the same time, the same steps are also carried out by a series positive mould plate and a series negative mould plate to make a standard curve. An initial copy number of nucleic acid in corresponding samples can be looked up on the standard curve by fluorescent increasing values of each sample. The present invention also provides a kit which is used for the fluorescent quantitation PCR method.
Description
The present invention relates to be used for the PCR (polymerase chain reaction, polymerase chain reaction) of detection of nucleic acids and the test kit that is used for this method.Specifically, the present invention relates to be used for the fluorescence quantifying PCR method and the test kit thereof of detection of nucleic acids.
Polymerase chain reaction (Polymerase Chain Reaction, PCR) be based on the method that DNA amplification in vitro technology detects trace, trace dna, the check and analysis and the genetics that have been widely used in nucleic acid are tested [referring to Bevan et.al, PCR methods andApplications, 1:222-228, (1992)].By the PCR process, can accurately detect in the clinical sample existence with the trace amount DNA/RNA of disease-related, clearly check out pathogenesis, thus guiding clinical diagnosis and treatment.Further quantitative PCR result, then can monitor in the clinical sample quantity and variation thereof in more detail with the trace amount DNA/RNA of disease-related, selection, efficacy assessment for clinical treatment have great directive significance, especially are fit to many detection and treatments that come from the disease of DNA/RNA number change.
It is raw material that PCR method adopts the oligonucleotide primer of a pair of synthetic and dNTPs, in the replication in vitro process of in-vitro simulated DNA, with resistant to elevated temperatures archaeal dna polymerase through repeatedly the circulation, amplification template DNA.Can be with the amount amplification 10 of target DNA
6～10
7Doubly, again with product electrophoresis on sepharose, the display result with ethidium bromide (EB) karyomit(e).This method have sensitivity, rapidly, accurately, characteristics such as convenient.But it also has corresponding deficiency, and mainly can be summed up as 3 points: (1) has only qualitative results, can't provide the quantitative result of clinical needs; (2) owing to adopt electrophoresis detection, easily cause the crossed contamination of PCR product, increased the possibility of false positive results; (3) the staining agent ethidium bromide of Cai Yonging is strong carcinogens, may endanger operator and contaminate environment.
Through studying and improving conventional PCR method, produced real-time quantitative fluorescence PCR method (referring to Kenneth J.Lival et al, U.S patent 5,538,848) again.This technology has been added a fluorescently-labeled probe on conventional PCR basis.When probe took place at no specific PCR, fluorescent signal did not change, and when the specific PCR amplification took place, probe can be cut off in the PCR process and cause the growth (see figure 1) of fluorescent signal.Fluorescent signal is accompanied by the carrying out of the process of PCR, the growth of PCR product and increasing.The real-time quantitative fluorescence PCR method is utilized this principle exactly, in the PCR process, and the continuously variation of the fluorescent signal in the detection reaction system.When signal is strengthened to a certain threshold value, the cycle index (Ct value) of this moment just goes on record, strict linear relationship is arranged [referring to Higuchi etal in this loop parameter and the PCR system between the logarithmic value of initiate dna amount, Biotechkology, 11:1026-1030 (1993)], just can accurately make the quantity of initiate dna according to loop parameter Ct value.During actual the use, be to contain fluorescent probe and the PCR reaction tubes of the nucleic acid samples that extracts from sample is put into PCR-fluoroscopic examination-computer for analysis integrated instrument, start PCR working cycle and fluorescence detection function, the latter sees through sample hose lid (Eppendoff manages lid) and realizes that directly stopped pipe detects in instrument.After reaction finishes, instrument will be analyzed the Ct value that detects sample automatically; The Ct value of the positive gradient standard substance of replicate(determination) is simultaneously made typical curve with these values, by the Ct value of sample, can find corresponding initiate dna amount on typical curve again.Present method has overcome 3 main drawbacks of aforementioned conventional PCR method fully owing to adopt fluorescence technique and the stopped pipe detection.But the needs for real-time continuous detects must adopt expensive PCR-fluoroscopic examination-computer for analysis integrated instrument in the technology, and as 7700 type Sequence Detector of U.S. Perkin Elmer company, price is up to 100,000 dollars.This situation has limited the large-scale application of real-time quantitative fluorescence PCR method in clinical diagnosis.
The objective of the invention is in order to overcome above-mentioned existing fluorescence PCR detecting method implementation cost height, use the shortcoming of instrument costliness, a kind of easy, inexpensive, quantitative fluorescence PCR test method that accuracy rate is high and the test kit that is used for this method are provided.
Fluorescence PCR method of the present invention comprises the steps:
A, according to the synthetic a pair of primer of the specific nucleic acid sequence of target gene to be detected.Primer is each other preferably at least at a distance of 30 bases;
B, according to the sequences Design between two primers in the specific nucleic acid sequence of target gene to be detected, synthetic fluorescent probe;
Primer among c, the use step a and the fluorescent probe among the step b and other PCR composition are formed the fluorescent PCR reaction system, and wherein the concentration of magnesium ion is 15-20mM, and the Taq enzyme dosage is 8-10 unit/reaction;
D, from sample to be measured, extract DNA, or extract RNA then reverse transcription become cDNA, add in the reaction system among the step c fluorescent value before the assaying reaction after centrifugal mixing;
E, reaction tubes is put into the PCR instrument carry out 20～50 round-robin PCR reaction; After finishing, reaction measures the fluorescent value in the primary first-order equation pipe again; The difference of twice measured value in front and back has promptly been represented the fluorescence increment of this tube reaction;
F, also carry out the nucleic acid extraction of steps d and PCR reaction with the serial positive and negative template simultaneously, record corresponding separately fluorescence increment,, make typical curve the natural logarithm value mapping of fluorescence increment with respect to the original nucleic acid amount of positive template;
G, with the increment of the fluorescence of each sample that obtains in the above-mentioned e step, can on typical curve, find the initial copy number of nucleic acid in the corresponding sample.
In the method for the invention, the specific nucleic acid sequence of target gene is meant the nucleotide sequence that exists only in this target gene.Be to have relation one to one between the existence of this nucleotide sequence and the existence of described target gene.
PCR reaction system of the inventive method and conventional PCR reaction system are similar, comprise pyro polymerase, nucleic acid extracting reagent, fluorescent PCR reaction solution, positive template series, negative template and insulating covering agent etc.Above-mentioned document referring to Bevan etc.
Pyro polymerase be meant have 3 ' → 5 ' dna polymerase activity, but 5 ' → 3 ' DNA exonuclease is active and the polysaccharase of withstand high temperatures.Described pyro polymerase is the pyro polymerase of 95 ℃ of transformation period＞45 minute preferably.
The fluorescent PCR reaction solution is to contain dNTPs, buffer system, the system of pcr amplification primer and fluorescent probe.
Described pcr amplification primer is that specificity is at the primer of the characteristic sequence of a certain determined nucleic acid sequence through design, length 15～40 bases (bases), preferably 18～25 bases (bases).
Described fluorescent probe has been the mark dna probe of two fluorophors, one of them is marked at 5 ' end of probe, another fluorogene and it at a distance of 7 bases or more than, both can constitute the transmission ofenergy structure, and promptly 5 ' the end fluorescence that fluorogene sent can be absorbed by another fluorogene or suppress.3 ' terminal hydroxy group of probe (OH) is removed or seals, do not have the extension ability; Length is 15～50bases; 18～35bases preferably.
Described buffer solution system is right by the stable buffering between pH=5.0～10.0, and Mg ion and other promote the ion of reaction to form, and the suitableeest selection of pH value is PH=7.0～9.0.
Positive template series is meant and gives the positive quality control standard substance of demarcating through quantity earlier.The clinical samples that preferably contains the dose known amounts goal gene of positive template; Another selection of positive template is through extraction, purifying, has measured the nucleic acid sample of quantity in advance; A selection again of positive template is through genetically engineered clone, purifying and quantitative goal gene.
Negative template is meant negative Quality Control system standard substance.The better selection of negative template is through the negative clinical samples of conclusive evidence; Another selection of negative template is through extraction, purifying and through proving conclusively negative nucleic acid sample; A selection again of negative template is pure H
2O.
The most handy insulating covering agent covers on reaction system.Insulating covering agent is meant and is used to be covered in the reaction system liquid level, avoids evaporating, with the immiscible oiliness insulating covering agent of water.Better selecting is solid or whiteruss.
Among the present invention, PCR reacts preferably two step method PCR, comprises sex change and annealing/two steps of extension.The temperature of sex change is 85 ℃～99 ℃, 10 seconds～300 seconds time; The temperature of annealing/extension is 37 ℃～75 ℃, and the time is 10 seconds～600 seconds, and cycle index is 15～60 times.Preferably denaturation temperature is 89 ℃～95 ℃, 20 seconds～120 seconds time; 50 ℃～70 ℃ of the temperature that annealing is extended, 30 seconds～200 seconds time, cycle index 30～50 times.
Among the present invention, the fluorescence laser light is to adopt monochromatic ray, and wavelength X=300～700nm detects wavelength X=350～800nm.Fluorescent exciting is wavelength X=450～600nm preferably, detects wavelength X=480～650nm.
Among the present invention, can the initial copy number scope of quantitative nucleic acid be 1～10
11Copy/ml.Can the initial copy number of quantitative nucleic acid preferably scope be 10
3～10
9Copy/ml.
The present invention also provides a kind of test kit that is used for fluorescence quantifying PCR method, it comprises archaeal dna polymerase, the fluorescent PCR reaction solution, positive template, negative template, and according to the PCR primer and the fluorescent primer of the specific sequence of determined nucleic acid design, wherein the concentration of magnesium ion is 15-20mM in this fluorescent PCR reaction solution, and the Taq enzyme dosage is 8-10 unit/reaction.
Another using method of test kit of the present invention, be from clinical samples, to extract nucleic acid (if RNA sample with nucleic acid extracting reagent, must change into cDNA through reverse transcription), add in the pipe fluorescent PCR reaction solution, add pyro polymerase again, insulating covering agents etc. after centrifugal mixing, are put into PCR-fluoroscopic examination-computer for analysis integrated instrument, beginning PCR process is also carried out real-time fluorescence and is detected, and measured signal reaches the loop parameter Ct that detects when setting threshold values; Be ordinate zou with the serial positive and negative template Ct measured value simultaneously, the natural logarithm value of the original nucleic acid amount of positive template is an X-coordinate, makes typical curve, can check in the initial copy number of sample from typical curve.
This test kit is the specificity design of carrying out at clinical disease, be according to known disease specific gene series, through gene pool retrieval, analysis and design, selected special, efficiently target gene fragment as the amplification, detected object, and selected one couple of PCR primers and a fluorescent probe therein, probe is between one couple of PCR primers.
The invention provides a kind of test kit that gonococcus detects that is used for, its PCR primer and fluorescent primer design according to following specific sequence:
1 GCTACGCATA?CCCGCGTTGC?TTTGCTGTTC?TCGACTGGGC?AATTTTCCAG
51 TGTCAAACCT?TTGGTCTTGG?TTTCCAACAG?GTCTAGGGTG?CGCTCTGCTT
101?CGGCTCTCTG?CTGTTTCAAG?TCGTCCAGCT?CGTTCTTGAC?GCTCCATATC
151?GCTATGAACA?GCCCTGCTAT?GACTATCAAC?CCTGCCGCCG?ATATACCTAG
201?CAAGCTCCAC?AGATAGGGCT?TGAATACTGC?CTTGCTCATG?CGTAACTGCC
251?GGGCGTTTAT?ATCGGCGGTT?ATTTTCTGCT?CGCTTTGCTT?CAATGCCTCG
301?TTGATATTTT?TCCGTAACGT?CTCTAAGTCT?GCTTTCGTTT?GTTGCTCTAT
351?GCTGGCGGCT?TCGGTGCGTG?ATGTCTGCTC?GAAGGTCTTC?G
Wherein, primer sequence is preferably: PNG1:5 ' GCT ACG CAT ACC CGC GTT GC 3 ' 20bpsPNG2:5 ' CGA AGA CCT TCG AGC AGA CA 3 ' 20bps
The fluorescent probe sequence is preferably: FPNG:5 ' CAA GTC GTC CAG CTC GTT CTT GAC 3 ' 24bps
The invention provides a kind of test kit that hepatitis B virus detects that is used for, its PCR primer and fluorescent primer design according to following specific sequence:
1 ATCCTGCTGC?TATGCCTCAT?CTTCTTGTTG?GTTCTTCTGG?ACTATCAAGG
51 TATGTTGCCC?GTTTGTCCTC?TAATTCCAGG?TACTTCAACA?ACCAGCACGG
101?GACCATGCAG?AACCTGCACG?ACTCCTGCTC?AAGGAACCTC?TATGTATCCC
151?TCCTGTTGCT?GTACCAAACC?TTCGGACGGA?AATTGCACCT?GTATTCCCAT
201?CCCATCATCT?TGGGCTTTCG?GAAAATTCCT?ATGGCAGTGG?GCCTCAGCCC
251?GTTTCTCCTG?GCTCAGTTTA?CTAGTGCCAT?TTGTTCAGTG?GTTCGTAGGG
301?CTTTCCCCCA?CTGT
Wherein, primer sequence is preferably: PHBV1:5 ' ATCCTGCTGCTATGCCTCATCTT 3 ', 23bpsPHBV2:5 ' ACAGTGGGGGAAAGCCCTACGAA 3 ', 23bps
The fluorescent probe sequence is preferably: FPHBV:5 ' TGGCTAGTTTACTAGTGCCATTTG 3 ', 25bps
The invention provides a kind of test kit that hepatitis C virus detects that is used for, its PCR primer and fluorescent primer design according to following specific sequence:
1 CTTCACGCAG?AAAGCGTCTA?GCCATGGCGT?TAGTATGAGT?GTCGTGCAGC
51 CTCCAGGACC?CCCCCTCCCG?GGAGAGCCAT?AGTGGTCTGC?GGAACCGGTG
101?AGTACACCGG?AATTGCCAGG?ACGACCGGGT?CCTTTCTTGG?ATCAACCCGC
151?TCAATGCCTG?GAGATTTGGG?CGTGCCCCCG?CGAGACTGCT?AGCCGAGTAG
201?TGTTGGGTCG?CGAAAGGCCT?TGTGGTACTG?CCTGATAGGG?TGCTTGCGAG
251?TGCCCCGGGA?GGTCTCGTAG?A
Wherein, primer sequence is preferably: PHCV1:5 ' CTTCACGCAGAAAGCGTCTAGC, 22bpsPHCV2:5 ' TCTACGAGACCTCCCGGGGCAC, 22bps
The fluorescent probe sequence is preferably: FPHCV:5 ' GAGAGCCATAGTGGTCTGCGGAAC, 24bps
The invention provides a kind of test kit that chlamydia trachomatis detects that is used for, its PCR primer and fluorescent primer design according to following specific sequence:
1 CGATGATTTG?AGCGTGTGTA?GCGCTGAAGA?AAATTTGAGC?AATTTCATTT
51 TCCGCTCGTT?TAATGAGTAC?AATGAAAATC?CATTGCGTAG?ATCTCCGTTT
101?CTATTGCTTG?AGCGTATAAA?GGGAAGGCTT?GATAGTGCTA?TAGCAAAGAC
151?TTTTTCTATT?CGCAGCGCTA?GAGGCCGGTC?TATTTATGAT?ATATTCTCAC
201?AGTCAGAAAT?TGGAGTGCTG?GCTCGTAT
Wherein, primer sequence is preferably: PCT1:5 ' CGA TGA TTT GAG CGT GTG TAG CG 3 ' 23bpsPCT2:5 ' ATA CGA GCC AGC ACT CCA ATT TC 3 ' 23bps
The fluorescent probe sequence is preferably: FPCT:5 ' TGA GCA ATT TCA TTT TCC GCT CG 3 ' 23bps
The invention provides a kind of test kit that Ureaplasma urealyticum detects that is used for, its PCR primer and fluorescent primer design according to following specific sequence:
1 TTTATAAGGA?GATAATGATT?ATATGTCAGG?ATCATCAAAT?CAATTCACTC
51?CAGGTAAATT?AGTACCAGGA?GCAATTAACT?TCGCTGAAGG?CGAAAATGTG
101?ATGAACGAAG?GTAGAGAAGC?AAAAGTAATC?AGCATTAAAA?ATACTGGTGA
151?CCGTCCTATC?CAAGTTGGAT?CACATTTGCA?CTTATTTGAA?ACAAATAGTG
201?CATTAGTATT?CTTTGATGAA?AAAGGAAACG?AAGACAAAGA?ACGTAAAGTT
251?GCTTATGGAC?GTCGTTTCGA?TATTCTC
Wherein, primer sequence is preferably: PUU1:5 ' TTATAAGGAGATAATGATTATGTG, 25bpsPUU2:5 ' GAGAATATCGAAACGACGTCCAT, 24bps
The fluorescent probe sequence is preferably: FPUU:5 ' GGTAGAGAAGCAAAAGTAATCAGCA, 25bps
The invention provides a kind of test kit that tubercule bacillus detects that is used for, its PCR primer and fluorescent primer design according to following specific sequence:
1 TCGCCCGTCT?ACTTGGTGTT?GCTGCGCGGA?GACGGTGCGT?AAGTGGGTGC
51 GCCAGGCGCA?GGTCGATGCC?GGCGCACGGC?CCGGGACCAC?GACCGAAGAA
101?TCCGCTGAGA?TAAAGCGCTT?GCGGCGGGAC?AACGCCGAAT?TGCGAAGGGC
151?GAACGCGATT?TTAAAGACCG?CGTCGGCTTT?CTTCGCGGCC?GAGCTCGACC
201?GGCCAGCACG?CTAATTACCC?GGTTCATCGC?CGATCATCAG?GGCCACCGCG
251?AGGGCCCCGA?TGGTTTGCGG?TGGGGTGTCG?AGTCGATCTG?CACACAGCTG
301?ACCGAGCTGG?GTGTGCCGAT?CGCCCCATCG?ACCTACTACG?ACCACATCA
Wherein, primer sequence is preferably: 3 ' 20 bases of 3 ' 20 base PTB2:5 ' TGATGTGGTCGTAGTAGGTC of PTB1:5 ' TCGCCCGTCTACTTGGTGTT
The fluorescent probe sequence is preferably: FPTB:5 ' ACA ACG CCG AAT TGC GAA GGG C 3 ' 22bps
The present invention is to use a cover through optimizing improved reagent, forms the PCR test kit.Through improved agent prescription, have stronger pcr amplification ability and the amplification efficiency of Geng Gao.(copy number 0-10 in the starting template concentration range of broad
9/ milliliter) amount of starting template and product can keep good dependency, helps realizing that PCR is quantitative accurately.This test kit can carry out specific amplification in vitro (PCR) to the purpose nucleotide sequence, amplifies purpose nucleic acid, until being detected.Simultaneously have detectable fluorescent signal again, can be used for nucleic acid quantification and qualitative detection; In addition, this test kit can use conventional fluorescence detector, before PCR reaction beginning and the PCR reaction finish respectively to measure afterwards first order fluorescence, can be as calculated, draw quantitatively or result qualitatively; This test kit also can use the PCR-fluoroscopic examination-computer for analysis integrated instrument of automatization, obtains quantitative result through detecting in real time continuously; Moreover this test kit system designs at clinical disease diagnosis, has special, sensitive, accurate, antipollution, characteristics such as quick.
Use the beneficial effect of this test kit to be, can detect the relevant specific nucleic acid sequence of clinical disease accurate, quick, special, easily.Accurately quantitatively scope is 0-10
9Copies/ml, error＜300%.Resistance to crocking is strong, to plant and instrument require lowly, be applicable in medical treatment at different levels, scientific research institution and apply.
Description of drawings:
Fig. 1 is the figure that shows the principle of fluorescent PCR, R: fluorescence report group; Q: fluorescent quenching group.Wherein:
(1) 5 ' → 3 ' exonuclease activity
The Taq enzyme that is used for quantitative fluorescent PCR not only has the activity (dna polymerase activity) of extended DNA primer, also has 5 ' → 3 ' exonuclease activity, can realize the chain replacement in the chain extension process, and the strand that is replaced is cut off.
(2) fluorescent dye primer
5 of this probe ' end and 3 ' end respectively mark a specific groups, the group of 5 ' end is called fluorescence indication group (R), the group of 3 ' end is called fluorescence and suppresses group (Q).When this probe is kept perfectly, the Q group will suppress the fluorescent signal of R group, in case probe is cut off, restraining effect disappears, and the fluorescent signal of R group just can be detected.(3) realization of fluorescent PCR reaction
Above-mentioned fluorescence labeling probe combines with the amplified production nucleotide sequence according to the base pairing principle.After the PCR reaction beginning, along with the extension of chain, the Taq enzyme moves to the fluorescence labeling probe binding site along dna profiling, brings into play its 5 ' → 3 ' exonuclease activity, and fluorescent probe is cut off, and discharges the fluorescent signal of R group.The quantity of the number of d/d free R group and PCR product is man-to-man relation, so the fluorescent signal of R group is strong and weak just proportional with PCR product quantity, measures the former and just can extrapolate the latter.The principle of Here it is quantitative fluorescent PCR.Fig. 2 is the fluorescent PCR quantitative criterion curve among the embodiment 1,1g (initial copy).
The composition of EXAMPLE Example 1-hepatitis B virus (HBV) fluorescence quantitative PCR detection and test kit 1 thereof, hepatitis B virus quantitative fluorescent PCR diagnostic kit
The primer of selecting for use and the conserved regions of fluorescent probe design in hepatitis B virus gene, only special and other species no cross reaction to hepatitis B virus.The zone of fluorescent probe between a pair of primer.Primer sequence is: PHBV1:5 ' ATCCTGCTGCTATGCCTCATCTT 3 ', and 23bpsPHBV2:5 ' ACAGTGGGGGAAAGCCCTACGAA 3 ', 23bps fluorescent probe sequence is: FPHBV:5 ' TGGCTAGTTTACTAGTGCCATTTG 3 ', 25bps
The dna sequence dna in pcr amplification district is positioned at HBV gene S district, is one section coding region.In the 412-725 position of the HBV of EMBL dna sequence dna, total length 314bps is the single copy gene sequence.
The process for preparation of test kit is as follows:
Preparation 5XPCR reaction solution (50mM Tris-HCl (pH8.0), 100mM MgCl
2250mM KCl, the 1mg/ml gelatin), be made into the HBV-PCR reaction solution again: everyone part reaction solution: primer PHBV1, each 0.4 μ l fluorescent probe FPHBV (20pmol/ μ l), 0.5 μ ldNTPs (2mM), 5 μ lTaq enzyme (10 unit) 5 μ l5 * PCR reaction buffer 10 μ lddH2O 29.1 μ l total amounts 50 μ l of PHBV2 (25pmol/ μ l)
Preparation dna cleavage liquid (50mM NaOH, 10mM Tris-HCl (pH8.0), 1%Triton X-100,1%NP-40,0.5mM EDTA (pH8.0))
The preparation of negative quality control standard product: get the negative blood donor's of HBV serum, through hepatitis B two double immunoassay, every index is all negative; Being HBV PCR with PHBV1 and PHBV2 checks also negative.
The preparation of positive quality control standard substance: adopt patient's HBV strong positive serum, obtain the positive quality control standard substance through definite value serum standard panel (100pg/ml) (Nat'l Pharmaceutical ﹠ Biological Products Control Institute) demarcation and serial dilution.2, use hepatitis B virus quantitative fluorescent PCR diagnostic kit to detect
Get serum specimen 40 μ l, add equivalent DNA extraction liquid and beat even.Boiling water bath 10 minutes goes to 4 ℃ and leaves standstill 24 hours to guarantee the abundant cracking of virion.10, centrifugal 5 minutes of 000rpm gets supernatant liquor 2 μ l and does the PCR reaction.Other gets positive each 10 μ l of the quantitatively quantitative quality control standard product of quality control standard product regulating YIN and YANG, the same processing.Fluoroscopic examination before the PCR reaction:
Get Taq enzyme one pipe, add PCR reaction solution 45 μ l, handle back sample or quantitative quality control standard product 2 μ l, mixing adds 30 μ l paraffin oils (as employed PCR instrument hot lid arrangement is arranged, can not add), the centrifugal several seconds.This pipe is put into fluorescence detector, read and write down reading A0.Fluorescence exciting wavelength is 487nm, and the detection wavelength is 525nm.Pcr amplification:
Each reaction tubes is put into the PCR instrument, increases by following condition:
Pre-sex change in 93 ℃ → 2 minutes, then by 93 ℃ 45 seconds → 55 ℃ 120 seconds, do 40 circulations altogether.PCR reaction back fluoroscopic examination detects:
After treating that each PCR pipe fully is cooled to room temperature, the reaction tubes after the amplification is put into fluorescence detector, read and write down reading A1.Fluorescence exciting wavelength is 487nm, and the detection wavelength is 525nm.Calculate: the AX=A1-A0 qualitative results is judged:
Sample Ax＞N*1.3 is judged to the positive, otherwise negative.Quantitative Analysis:
Adding 1 with the logarithmic value of the DNA quantity (fg) of quantitative positive quality control pipe is that (logarithm of routine 4fg/ μ l is lg4=0.602 to X-coordinate, and this pipe X-coordinate is 1+lg4=1.602; The X-coordinate of negative Quality Control pipe is decided to be 0), corresponding Ax is an ordinate zou, connects the data point of each quantitative positive quality control pipe with straight line, constitutes typical curve (Fig. 2).The Ax of sample if＜N*1.3, then be judged to feminine gender; Otherwise the Ax value with it is found corresponding abscissa value C on typical curve, the HBV dna content (fg/ml) of sample=1000*10 (C-1)
Sample is by making a definite diagnosis or suspecting among the patient of hepatitis B and take.Comprise emergency case's 172 examples, long-term carrier's 83 examples, treatment reconvalescent 102 examples were injected vaccine and were obtained immune's 31 examples, liver cancer patient 37 examples, asymptomatic examinee's 61 example and healthy blood donor 21 examples, other 25 example.Total case load reaches 532 examples.
Quantitative result adopts asks the method for several mean values of getting it right to calculate average copy number, meets negative findings, does not participate in the statistics of mean value.
The clinical application of hepatitis B virus fluorescent quantificationally PCR detecting kit is summarized as follows:
(1) the ELISA method detects HBsAg positive sample 317 examples altogether, and positive rate is 59.6%; It is positive that PCR detects 310 examples altogether, and positive rate is 58.3%.
(2) in the sample of 158 routine hepatitis B immune index great three positives (HBsAg+/HBeAg+/HBcAb+), the PCR total positives shows that the false negative rate that test kit is used for great three positive diagnosis is 0; In the complete negative sample of 107 routine hepatitis B immune indexs, the PCR total negative, the false positive rate that shows test kit is 0.
(3) in the sample of 98 routine hepatitis B immune index "small three positive"s (HBsAg+/HBeAb+/HBcAb+), positive 71 examples of PCR, positive rate 73%.Consistent with the hepatic tissue positive rates of biopsy (70%～80%) of domestic and international report, be much higher than 30% positive rate of regular-PCR.The sensitivity that proves this test kit is quite high.(4) in the sample of hepatitis B immune index great three positive (HBsAg+/HBeAg+/HBcAb+) (sign period of infection), the quantitative average copy number of PCR is 1.1 * 10
8(HBsAg+/HBeAg+/HBeAb+/HBcAb+) sample of (sign infects the later stage), average out to 2.8 * 10
7(HBsAg+/HBeAb+/HBcAb+) sample of (sign carries for a long time), average out to 8.6 * 10
5(HBsAb+/HBeAb+/HBcAb+) sample of (sign decubation), average out to 2.3 * 10
5Each the group between significant difference, show quantitative PCR can know the reflection hepatitis B patient course of disease changing conditions.And then can be used for clinical diagnosis, treatment plan is selected and the curative effect monitoring.Has very high clinical value.The preparation of human tubercule bacillus (TB) fluorescence PCR detection reagent kit of embodiment 2-test kit: primer sequence is: 3 ' 20 base fluorescent probe sequences of 3 ' 20 base PTB2:5 ' TGATGTGGTCGTAGTAGGTC of PTB1:5 ' TCGCCCGTCTACTTGGTGTT are: FPTB:5 ' ACA ACG CCG AAT TGC GAA GGG C 3 ' 22bps
The dna sequence dna in pcr amplification district is positioned at the IS986 gene regions of TB.In the 176-524 position of the MITS986 of EMBL sequence, total length 349bps is the multi-copy gene sequence.Other composition of test kit such as embodiment 1.
Sample is examined the sample of tuberculosis patient from clinical definite or plan, and total case load reaches 755 examples, and wherein 127 examples are that non-tuberculosis contrasts sample.
The contrast Case definition adopts improvement Luo Shi culture method and auramine fluorescence dye liquor plate coating checking method.
The clinical application of tubercule bacillus fluorescence PCR detection reagent kit is summarized as follows:
The positive rate of fluorescent PCR method is 72.3% (454/628), apparently higher than culture method 31.4% (126/401) and smear method 19.9% (125/628), and there were significant differences for statistical procedures (P (0.01).
Cultivate in the male sample in 126 examples, PCR total positives, the two coincidence rate are 100%; In 127 routine non-tuberculosis contrast samples, PCR and cultivation and smear total negative show that test kit false positive/false negative rate is 0.The preparation of embodiment 3-gonococcus (NG) fluorescence PCR detection reagent kit test kit: primer sequence is: PNG1:5 ' GCT ACG CAT ACC CGC GTT GC 3 ' 20bpsPNG2:5 ' CGA AGA CCT TCG AGC AGA CA 3 ' 20bps fluorescent probe sequence is: FPNG:5 ' CAA GTC GTC CAG CTC GTT CTT GAC 3 ' 24bps
The dna sequence dna in pcr amplification district is positioned at the cppB gene regions of NG.In the 3141-3531 position of the sequence of EMBL, total length 391bps is the multi-copy gene sequence.Other composition of test kit as
The sample that sample is examined the gonorrhoea patient from clinical definite or plan, total case load reaches 543 examples, wherein 20 routine gonorrhoea patient diagnosed's samples.
The contrast Case definition is a culture method: cultivate, separate, identify with blood agar culture-medium, and do oxidase test.
The clinical application of gonococcus fluorescence PCR detection reagent kit is summarized as follows:
(1) positive rate of fluorescent PCR method is 65.6% (343/523), apparently higher than culture method 40.7% (213/523)), there were significant differences for statistical procedures (P (0.01).
(2) make a definite diagnosis among the gonorrhoea patient in 20 examples, fluorescent PCR total positives, the two coincidence rate are 100%, and the culture method positive rate is 70% (14/20), and coincidence rate is 70%.The preparation of embodiment 4-chlamydia trachomatis (CT) fluorescence PCR detection reagent kit test kit: primer sequence is: PCT1:5 ' CGA TGA TTT GAG CGT GTG TAG CG 3 ' 23bpsPCT2:5 ' ATA CGA GCC AGC ACT CCA ATT TC 3 ' 23bps fluorescent probe sequence is preferably: FPCT:5 ' TGA GCA ATT TCA TTT TCC GCT CG 3 ' 23bps
The dna sequence dna in pcr amplification district is positioned at chlamydia trachomatis plasmid pCTT1 gene order (EMBLCTORF) 1900-2127 position, and fluorescent probe FPCT is positioned at the 1935-1957 position.Total length 228bps is the multi-copy gene sequence.Other is as embodiment 1.
Use the chlamydia trachomatis fluorescent PCR diagnostic kit that Zhongshan Medical Univ. reaches peace gene diagnosis center development, clinical samples to 132 routine chlamydia trachomatis patients carries out the fluorescent PCR detection, and carry out chlamydia trachomatis simultaneously and cultivate inspection, the result shows that the positive rate of fluorescent PCR detection method is 51.5% (68/132), and the positive rate of culture method is 24.2% (32/132).
Table: clinical samples chlamydia trachomatis detected result:
The positive routine number positive rate of example number
The PCR method detects 132 68 51.5%
CT cultivates 132 32 24.2%
Fluorescent PCR method and cultivation results compare: cultivate in the samples in 132 examples, the fluorescent PCR positive is 68 examples, and positive rate is 51.5%, and wherein 32 examples are cultivated the male samples, and fluorescent PCR is all positive, and the coincidence rate of the two is 100%.Cultivate in the negative sample positive 34 examples of fluorescent PCR method at 100 routine CT.
We repeat PCR detection 2 times to 10 parts of positive sample and 10 parts of negative sample, and repeatability reaches 100% as a result, indicate that the repeatability of test kit and stability are better.
Above presentation of results, fluorescent PCR detects chlamydia trachomatis in the clinical samples, and positive rate with clinical coincidence rate height, and has simple and rapid advantage apparently higher than culture method.The preparation of embodiment 5-Ureaplasma urealyticum (UU) fluorescence PCR detection reagent kit test kit: primer sequence is: PUU1:5 ' GCT ACG CAT ACC CGC GTT GC 3 ' 20bpsPUU2:5 ' CGA AGA CCT TCG AGC AGA CA 3 ' 20bps fluorescent probe sequence is: FPUU:5 ' CAA GTC GTC CAG CTC GTT CTT GAC 3 ' 24bps
The dna sequence dna in pcr amplification district is positioned at Ureaplasma urealyticum gene order (EMBL UULOCAB) 1-277 position, and fluorescent probe FPUU is positioned at the 135-159 position.Total length 277bps is the multi-copy gene sequence.Other is as embodiment 1.
Use Ureaplasma urealyticum (UU) the fluorescent PCR diagnostic kit that Zhongshan Medical Univ. reaches peace gene diagnosis center development, 128 I the Obstetric and Gynecologic Department out-patients of institute of example are carried out Ureaplasma urealyticum detect, cultivate with cell simultaneously, the result is as follows:
128 routine female genital tract UU examining reports
Total routine number number positive positive rate fluorescent PCR detects 128 51 39.9%UU and cultivates 128 21 16.4%
Ureaplasma urealyticum is the common pathogenic agent of female genital tract.To the detection of UU, WHO is recommended as cell cultures, but owing to the cultivation to UU needs certain condition and length consuming time, can not satisfy the early stage quick diagnosis to sexually transmitted disease (STD).We adopt Zhongshan Medical Univ. to reach the Ureaplasma urealyticum fluorescent PCR diagnostic kit of peace gene diagnosis center development, and to 128 routine high risk population's detected result promptings, the specificity and the susceptibility of Ureaplasma urealyticum fluorescent PCR diagnostic reagent all are higher than culture method.The composition of embodiment 6-hepatitis C virus (HCV) fluorescence PCR detection reagent kit hepatitis C virus fluorescent PCR diagnostic kit:
The primer of selecting for use and the conserved regions of fluorescent probe design in the hepatitis C virus gene, only special and other species no cross reaction to hepatitis C virus.The zone of fluorescent probe between a pair of primer.Primer sequence is: PHCV1:5 ' CTTCACGCAGAAAGCGTCTAGC, 22bpsPHCV2:5 ' TCTACGAGACCTCCCGGGGCAC, 22bps fluorescent probe sequence is preferably: FPHCV:5 ' GAGAGCCATAGTGGTCTGCGGAAC, the dna sequence dna of 24bpsPCR amplification region are positioned at HBV gene 5 ' non-translational region.In the 62-332 position of the HCV of EMBL dna sequence dna (EMBL S38204), total length 271bps is the single copy gene sequence.
Use the HCV fluorescent PCR diagnostic kit that Zhongshan Medical Univ. reaches peace gene diagnosis center development, 188 my out-patients of institute of example and inpatient are carried out HCV to be detected, detect HCV antigen/antibody combination with ELISA simultaneously and observe in contrast, PCR method positive rate is 25%, and ELISA method positive rate is 22%.The result is as follows:
Fluorescent PCR adds up to
+-ELISA+ 38 3 41ELISA-9 138 147 add up to 47 141 188
Claims (25)
1, a kind of fluorescent quantitative poly chain reaction method may further comprise the steps:
A, according to the synthetic a pair of primer of the specific nucleic acid sequence of target gene to be detected;
B, according to the sequences Design between two primers in the specific nucleic acid sequence of target gene to be detected, synthetic fluorescent probe;
Primer among c, the use step a and the fluorescent probe among the step b and other polymerase chain reaction composition are formed the fluorescent polyase chain reaction system, and wherein the concentration of magnesium ion is 15-20mM, and the Taq enzyme dosage is 8-10 unit/reaction;
D, from sample to be measured, extract DNA, or extract RNA then reverse transcription become cDNA, add in the reaction system among the step c fluorescent value before the assaying reaction after centrifugal mixing;
E, reaction tubes is put into the polymerase chain reaction instrument carry out the round-robin polymerase chain reaction 20～50 times; After finishing, reaction measures the fluorescent value in the primary first-order equation pipe again; The difference of twice measured value in front and back has promptly been represented the fluorescence increment of this tube reaction;
F, also carry out the nucleic acid extraction and the polymerase chain reaction of steps d with the serial positive and negative template simultaneously, record corresponding separately fluorescence increment,, make typical curve the natural logarithm value mapping of fluorescence increment with respect to the original nucleic acid amount of positive template;
G, with the increment of the fluorescence of each sample that obtains in the above-mentioned e step, can on typical curve, find the initial copy number of nucleic acid in the corresponding sample.
2, in accordance with the method for claim 1, it is characterized in that, between two primers described in the step a at a distance of 50～500 bases.
3, in accordance with the method for claim 1, it is characterized in that 30～50 circulations are carried out in the polymerase chain reaction described in the step e.
4, in accordance with the method for claim 1, it is characterized in that 40 circulations are carried out in the polymerase chain reaction described in the step e.
5, in accordance with the method for claim 1, it is characterized in that the length of the primer described in the step a is 16～25 bases.
6, in accordance with the method for claim 1, it is characterized in that the length of the fluorescent probe described in the step a is 18～35 bases.
7, a kind of test kit that is used for fluorescent quantitative poly chain reaction method, it comprises archaeal dna polymerase, fluorescent polyase chain reaction liquid, positive template, negative template, and according to the polymerase chain reaction primer and the fluorescent primer of the specific nucleic acid sequences Design of determined nucleic acid, it is characterized in that, the final concentration of magnesium ion is 15-20mM in this fluorescent polyase chain reaction liquid, and the Taq enzyme dosage is 8-10 unit/reaction.
According to the described test kit of claim 7, it is characterized in that 8, described determined nucleic acid is a gonococcus DNA, described specific nucleic acid sequence is:
1 GCTACGCATA?CCCGCGTTGC?TTTGCTGTTC?TCGACTGGGC?AATTTTCCAG
51 TGTCAAACCT?TTGGTCTTGG?TTTCCAACAG?GTCTAGGGTG?CGCTCTGCTT
101?CGGCTCTCTG?CTGTTTCAAG?TCGTCCAGCT?CGTTCTTGAC?GCTCCATATC
151?GCTATGAACA?GCCCTGCTAT?GACTATCAAC?CCTGCCGCCG?ATATACCTAG
201?CAAGCTCCAC?AGATAGGGCT?TGAATACTGC?CTTGCTCATG?CGTAACTGCC
251?GGGCGTTTAT?ATCGGCGGTT?ATTTTCTGCT?CGCTTTGCTT?CAATGCCTCG
301?TTGATATTTT?TCCGTAACGT?CTCTAAGTCT?GCTTTCGTTT?GTTGCTCTAT
351?GCTGGCGGCT?TCGGTGCGTG?ATGTCTGCTC?GAAGGTCTTC?G
According to the described test kit of claim 8, it is characterized in that 9, described primer sequence is:
Primer 1:5 ' GCT ACG CAT ACC CGC GTT GC 3 '
Primer 2: 5 ' CGA AGA CCT TCG AGC AGA CA 3 '
According to the described test kit of claim 8, it is characterized in that 10, the sequence of described fluorescent probe is:
5′CAA?GTC?GTC?CAG?CTC?GTT?CTT?GAC?3′。
According to the described test kit of claim 7, it is characterized in that 11, described determined nucleic acid is a hepatitis B virus DNA, described specific nucleic acid sequence is:
1 ATCCTGCTGC?TATGCCTCAT?CTTCTTGTTG?GTTCTTCTGG?ACTATCAAGG
51 TATGTTGCCC?GTTTGTCCTC?TAATTCCAGG?TACTTCAACA?ACCAGCACGG
101?GACCATGCAG?AACCTGCACG?ACTCCTGCTC?AAGGAACCTC?TATGTATCCC
151?TCCTGTTGCT?GTACCAAACC?TTCGGACGGA?AATTGCACCT?GTATTCCCAT
201?CCCATCATCT?TGGGCTTTCG?GAAAATTCCT?ATGGCAGTGG?GCCTCAGCCC
251?GTTTCTCCTG?GCTCAGTTTA?CTAGTGCCAT?TTGTTCAGTG?GTTCGTAGGG
301?CTTTCCCCCA?CTGT
According to the described test kit of claim 11, it is characterized in that 12, described primer sequence is:
Primer 1:5 ' ATCCTGCTGCTATGCCTCATCTT 3 ',
Primer 2: 5 ' ACAGTGGGGGAAAGCCCTACGAA 3 '.
According to the described test kit of claim 11, it is characterized in that 13, the sequence of described fluorescent probe is:
5′TGGCTAGTTTACTAGTGCCATTTG?3′。
According to the described test kit of claim 7, it is characterized in that 14, described determined nucleic acid is hepatitis C virus DNA, described specific nucleic acid sequence is:
1 CTTCACGCAG?AAAGCGTCTA?GCCATGGCGT?TAGTATGAGT?GTCGTGCAGC
51 CTCCAGGACC?CCCCCTCCCG?GGAGAGCCAT?AGTGGTCTGC?GGAACCGGTG
101?AGTACACCGG?AATTGCCAGG?ACGACCGGGT?CCTTTCTTGG?ATCAACCCGC
151?TCAATGCCTG?GAGATTTGGG?CGTGCCCCCG?CGAGACTGCT?AGCCGAGTAG
201?TGTTGGGTCG?CGAAAGGCCT?TGTGGTACTG?CCTGATAGGG?TGCTTGCGAG
251?TGCCCCGGGA?GGTCTCGTAG?A
According to the described test kit of claim 14, it is characterized in that 15, described primer sequence is:
Primer 1:5 ' CTTCACGCAGAAAGCGTCTAGC,
Primer 2: 5 ' TCTACGAGACCTCCCGGGGCAC.
According to the described test kit of claim 14, it is characterized in that 16, the sequence of described fluorescent probe is:
5’GAGAGCCATAGTGGTCTGCGGAAC。
According to the described test kit of claim 7, it is characterized in that 17, described determined nucleic acid is a Chlamydia Trachomatis DNA, described specific nucleic acid sequence is:
1 CGATGATTTG?AGCGTGTGTA?GCGCTGAAGA?AAATTTGAGC?AATTTCATTT
51 TCCGCTCGTT?TAATGAGTAC?AATGAAAATC?CATTGCGTAG?ATCTCCGTTT
101?CTATTGCTTG?AGCGTATAAA?GGGAAGGCTT?GATAGTGCTA?TAGCAAAGAC
151?TTTTTCTATT?CGCAGCGCTA?GAGGCCGGTC?TATTTATGAT?ATATTCTCAC
201?AGTCAGAAAT?TGGAGTGCTG?GCTCGTAT
According to the described test kit of claim 17, it is characterized in that 18, described primer sequence is:
Primer 1:5 ' CGA TGA TTT GAG CGT GTG TAG CG 3 ',
Primer 2: 5 ' ATA CGA GCC AGC ACT CCA ATT TC 3 '
According to the described test kit of claim 17, it is characterized in that 19, the sequence of described fluorescent probe is:
5’TGA?GCA?ATT?TCA?TTT?TCC?GCT?CG?3’。
According to the described test kit of claim 7, it is characterized in that 20, described determined nucleic acid is Ureaplasma urealyticum DNA, described specific nucleic acid sequence is:
1 TTTATAAGGA?GATAATGATT?ATATGTCAGG?ATCATCAAAT?CAATTCACTC
51 CAGGTAAATT?AGTACCAGGA?GCAATTAACT?TCGCTGAAGG?CGAAAATGTG
101?ATGAACGAAG?GTAGAGAAGC?AAAAGTAATC?AGCATTAAAA?ATACTGGTGA
151?CCGTCCTATC?CAAGTTGGAT?CACATTTGCA?CTTATTTGAA?ACAAATAGTG
201?CATTAGTATT?CTTTGATGAA?AAAGGAAACG?AAGACAAAGA?ACGTAAAGTT
251?GCTTATGGAC?GTCGTTTCGA?TATTCTC。
According to the described test kit of claim 20, it is characterized in that 21, described primer sequence is:
Primer 1:5 ' TTATAAGGAGATAATGATTATGTG,
Primer 2: 5 ' GAGAATATCGAAACGACGTCCAT.
According to the described test kit of claim 20, it is characterized in that 22, the sequence of described fluorescent probe is:
5’GGTAGAGAAGCAAAAGTAATCAGCA。
According to the described test kit of claim 7, it is characterized in that 23, described determined nucleic acid is a mycobacterium tuberculosis dna, described specific nucleic acid sequence is:
1 TCGCCCGTCT?ACTTGGTGTT?GCTGCGCGGA?GACGGTGCGT?AAGTGGGTGC
51 GCCAGGCGCA?GGTCGATGCC?GGCGCACGGC?CCGGGACCAC?GACCGAAGAA
101?TCCGCTGAGA?TAAAGCGCTT?GCGGCGGGAC?AACGCCGAAT?TGCGAAGGGC
151?GAACGCGATT?TTAAAGACCG?CGTCGGCTTT?CTTCGCGGCC?GAGCTCGACC
201?GGCCAGCACG?CTAATTACCC?GGTTCATCGC?CGATCATCAG?GGCCACCGCG
251?AGGGCCCCGA?TGGTTTGCGG?TGGGGTGTCG?AGTCGATCTG?CACACAGCTG
301?ACCGAGCTGG?GTGTGCCGAT?CGCCCCATCG?ACCTACTACG?ACCACATCA
According to the described test kit of claim 23, it is characterized in that 24, described primer sequence is:
Primer 1:5 ' TCGCCCGTCTACTTGGTGTT 3 ',
Primer 2: 5 ' TGATGTGGTCGTAGTAGGTC 3 '
According to the described test kit of claim 23, it is characterized in that 25, the sequence of described fluorescent probe is:
5′ACA?ACG?CCG?AAT?TGC?GAA?GGG?C?3′
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 99100669 CN1094154C (en) | 1999-02-12 | 1999-02-12 | PCR method for testing nucleic acid by fluoremtetry and its reagent box |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 99100669 CN1094154C (en) | 1999-02-12 | 1999-02-12 | PCR method for testing nucleic acid by fluoremtetry and its reagent box |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1238456A CN1238456A (en) | 1999-12-15 |
| CN1094154C true CN1094154C (en) | 2002-11-13 |
Family
ID=5270139
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 99100669 Expired - Lifetime CN1094154C (en) | 1999-02-12 | 1999-02-12 | PCR method for testing nucleic acid by fluoremtetry and its reagent box |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1094154C (en) |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1236804A1 (en) * | 2001-03-02 | 2002-09-04 | Boehringer Mannheim Gmbh | A method for determination of a nucleic acid using a control |
| CN1316036C (en) * | 2003-01-06 | 2007-05-16 | 徐定邦 | Gene quantitation method by using PCR as basis |
| CN100424183C (en) * | 2003-09-17 | 2008-10-08 | 中山大学达安基因股份有限公司 | Method and its kit for early testing SARS virus infection |
| CN1661359B (en) * | 2004-02-25 | 2013-06-12 | 陕西西大北美基因股份有限公司 | Method for measuring isothermal amplification of nucleic acid quantificationally |
| CN100458419C (en) * | 2005-04-26 | 2009-02-04 | 浙江大学 | Mitochondria DNA11778 point mutation detecting method and reagent case thereof |
| CN100427927C (en) * | 2005-12-08 | 2008-10-22 | 中国农业科学院作物科学研究所 | Green smut bug real-time fluorescent quantitative PCR test kit and its use |
| CN100453653C (en) * | 2006-05-19 | 2009-01-21 | 上海申友生物技术有限责任公司 | Gene sequencing method combined with fluorescent quantitative PCR |
| BRPI0816274A2 (en) * | 2007-09-07 | 2019-09-10 | Third Wave Tech Inc | method and applications for target quantification |
| CN103571938B (en) * | 2013-02-25 | 2016-04-20 | 哈尔滨医科大学 | The reverse transcription PCR method of tubercle bacillus affection is detected from clinical samples |
| CN107227370A (en) * | 2017-07-24 | 2017-10-03 | 胡松 | Chromogene primer pair and probe combinations and chromosomal nucleic acid detection kit |
| CN108588286B (en) * | 2018-06-04 | 2022-03-04 | 张鹏 | Kit for jointly detecting HIV-1 and HCV based on fluorescence PCR method, and preparation method and detection method thereof |
-
1999
- 1999-02-12 CN CN 99100669 patent/CN1094154C/en not_active Expired - Lifetime
Also Published As
| Publication number | Publication date |
|---|---|
| CN1238456A (en) | 1999-12-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108300808A (en) | A kind of African hog cholera virus fluorescent PCR detection kit, preparation method and application method | |
| CN1094154C (en) | PCR method for testing nucleic acid by fluoremtetry and its reagent box | |
| CN1526022A (en) | Testing endosymbiont cellular organelles and compounds identifiable therewith | |
| CN102146466A (en) | Reagent for detecting brucella and complex probe fluorescence quantitative PCR (polymerase chain reaction) brucella detection method | |
| CN110724741B (en) | Primer, probe and kit for detecting minimal residual leukemia related fusion gene | |
| CN112063747B (en) | Primer probe group and kit for rapidly and efficiently detecting candida otophylla based on fluorescence PCR technology and application of primer probe group and kit | |
| CN112226538A (en) | Primer-probe combination, kit and method for detecting novel coronavirus | |
| KR20100116954A (en) | A method for detecting hbv using real time pcr | |
| CN111876502A (en) | Method for identifying Brucella S2 vaccine strain by dual real-time fluorescent quantitative PCR and kit used by same | |
| CN109680056A (en) | A kind of kit, detection method and its application detecting MCR gene | |
| CN107723384A (en) | A kind of PCR kit for detecting human papilloma virus and preparation method thereof | |
| JP2024026825A (en) | Brain infarction risk evaluation method | |
| CN113943822B (en) | LAMP-LFD-based helicobacter pylori POCT detection kit and method | |
| CN107119110A (en) | The primer of the TaqMan probe real-time PCR detection of human genome DNA's sry gene in trace sample | |
| KR101498704B1 (en) | Diagnostic primer for the heatitis b virus, probe, kit including same, and method for diagnosing the hepatitis b virus using the kit | |
| CN112725431B (en) | Primer, probe and kit for detecting polymorphic sites of APOE and SLCO1B1 genes | |
| RU2645262C1 (en) | Method of detecting dna of african swine fever virus by real-time polymerase chain reaction | |
| CN113755620B (en) | Nucleic acid detection kit for rapidly detecting two leishmanias and application thereof | |
| CN115948575A (en) | Echinococcosis rrnS gene specific primer, probe combination, kit and application | |
| CN106048051B (en) | A kind of candida krusei fluorescence PCR detection reagent kit | |
| CN113913547A (en) | Method and kit for rapidly detecting drug resistance of aspergillus fumigatus azole drugs | |
| KR20120103387A (en) | Method of providing information for diagnosis of tuberculosis using quantitative realtime pcr and diagnostic kit comprising thereof | |
| CN113718020A (en) | Primer-probe combination and kit for detecting internal tandem repeat mutation of human leukemia FLT3 gene and application of primer-probe combination and kit | |
| KR102278402B1 (en) | Primers and probes for Measles virus and Measles virus vaccine strain and detection method using them | |
| CN103882149A (en) | Dual real-time fluorescence PCR detection method of type I and type II of porcine torque teno virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C06 | Publication | ||
| PB01 | Publication | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C56 | Change in the name or address of the patentee |
Owner name: DA'AN GENE COMPANY, ZHONGSHAN UNIVERSITY Free format text: FORMER NAME OR ADDRESS: ZHONGSHAN MEDICAL UNIVERSITY DAAN GENE CO.,LTD. |
|
| CP01 | Change in the name or title of a patent holder |
Patentee after: Daan Gene Co., Ltd., Zhongshan Univ. Patentee before: Da'an Gene Co. Ltd., Zhongshan Medical Univ. |
|
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: WD Ref document number: 1023403 Country of ref document: HK |
|
| CX01 | Expiry of patent term | ||
| CX01 | Expiry of patent term |
Granted publication date: 20021113 |