CN109402261A - It is a kind of for detecting the kit of EGFR genetic mutation - Google Patents
It is a kind of for detecting the kit of EGFR genetic mutation Download PDFInfo
- Publication number
- CN109402261A CN109402261A CN201811454633.4A CN201811454633A CN109402261A CN 109402261 A CN109402261 A CN 109402261A CN 201811454633 A CN201811454633 A CN 201811454633A CN 109402261 A CN109402261 A CN 109402261A
- Authority
- CN
- China
- Prior art keywords
- del
- detection
- kit
- detecting
- mutation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
It is a kind of for detecting the kit of EGFR gene that the present invention relates to this, including the detection reagent for detecting the mutation of 19 exon of EGFR gene.High-throughput detection can be carried out to 20 mutation relevant to ear EGFR gene simultaneously under the same reaction condition using kit of the invention.The high specificity of detection, high sensitivity, lowest detection are limited to 1ng/ μ L, and the used time is short, can complete within 2 hours from specimen transfer to obtaining a result.
Description
Technical field
The present invention relates to oncogene detection fields, more specifically it relates to a kind of for detecting the examination of EGFR genetic mutation
Agent box.
Background technique
International cancer research institution (LARC) discloses global epidemiology of cancer in 2012 on December 12nd, 2013 most
New data: lung cancer is disease incidence in world wide (new hair patients with lung cancer 1,820,000 accounts for the 13% of all new hair tumor cases) and extremely
Die rate (dead patients with lung cancer 1,600,000 accounts for the 19.4% of all dead tumor cases) highest malignant tumour.In China, lung cancer
Morbidity and mortality occupy the first places of all malignant tumours.The new hair patients with lung cancer about 65.3 ten thousand of China in 2012, it is dead
Patient about 59.7 ten thousand.In China in recent years as the exacerbation of urban air pollution, especially PM2.5 content persistently remain high
Position, the morbidity and mortality of lung cancer obviously rise.Estimate that China's lung cancer year death toll in 2025, will be at up to 1,000,000
For the first big country of lung cancer.According to lung cancer biological property, non-small cell lung cancer NSnon-small cell lung cancerCLC
The 80%~85% of all lung cancer is accounted for, the disease incidence of adenocarcinoma of lung has been more than adeno-squamous carcinoma.
EGFR is a kind of transmembrane tyrosine kinase receptor, the phase of the activation of this receptor kinase domain to cancer cell multiplication, growth
OFF signal transmitting is of great significance.Two kinds of EGFR gene most important to sport outside 19 Exon deletions (accounting for about 45%) and 21
Sub- L858R mutation (accounting for about 40%) is shown, the two can lead to tyrosine kinase domain activation, and be the quick of EGFR-TKIs
Perception mutation.Patients with lung adenocarcinoma EGFR gene sensitizing mutation positive rate is but about 10% in Caucasian, in asian ancestry crowd and I
State is 50% or so.
Between more than ten years in past, EGFR-TKIs has been increasingly becoming the line mark of the advanced NSCLC patients of EGFR genetic mutation
Quasi- treatment.With milestone significance it is random, control, the IPASS clinical test of III phase of large sample show one line of Gefitinib for the first time
Progression free survival time, Tumor response rate and the quality of life for treating EGFR genetic mutation advanced NSCLC patients are superior to standard
Chemotherapy, and there is good safety.The perspective III phase clinic examination carried out subsequently, based on EGFR genetic mutation positive patient
(NEJ002, WJOG3405, OPTIMAL, EURTAC and LUX-Lung3/LUX-Lung6) is tested, by filling compared with standard chemotherapeutic
Divide the important target spot and key predicting marker for demonstrating that EGFR genetic mutation is line EGFR-TKIs treatment.On the other hand,
The clinical researches such as GTONG0806 and meta-analysis are shown, in the patients with lung cancer that EGFR gene does not mutate, because that cannot reduce disease
Disease progression or mortality risk should not use EGFR targeted therapy.Therefore, EGFR genetic mutation is carried out with tissue and cytologic specimen
Detection becomes the clinical practice of standard for instructing NSCLC patient EGFR-TKIs treatment to build consensus in the whole world.
The main method of EGFR detection at this stage includes the sequencing of two generations, Sanger sequencing, fluorescent PCR etc..These methods or
Time-consuming, complicated for operation, or has higher requirements to operator and experimental site or testing cost is higher, or is difficult to detect simultaneously
The different mutational sites of multiple genes.Therefore, it is necessary to establish a kind of high throughput, high efficiency, the detection method of low cost and production
Product, to realize quickly detection.
Microflow control technique is micro-volume reaction to be realized with micro-processing technology, and can realize that high pass quantitative response makes manual operations
It is greatly reduced with testing cost, significantly improves efficiency.
The main method to EGFR genetic mutation detection clinical at this stage include direct Sequencing, genetic chip, genescan,
PCR- electrophoresis, fluorescent PCR, digital pcr etc..These methods or time-consuming, it is complicated for operation, or to operator and experimental site have compared with
High request or testing cost are higher, or are difficult to detect the different mutational sites of multiple genes simultaneously.Therefore, it is necessary to establish one
The detection method of gene mutation and product of kind high throughput, high efficiency, low cost, to realize clinical quickly detection.
Summary of the invention
In order to solve the above problem, the present invention provides a kind of for detecting the kit of EGFR gene, including for detecting
The detection reagent of 19 exon of EGFR gene mutation.
In a preferred embodiment, the detection reagent includes for expanding the mutational site for covering the gene
Primer pair, and the probe in the detection mutational site.
In a preferred embodiment, 19 exon of EGFR gene mutation include 2235-2249 del 15,
2236-2250 del 15、2240-2257 del 18、2235-2252>AAT del 18、2237-2251 del 15、2238-
2255 del 18、2238-2248>GC del 11、2238-2252>GCA del 15、2239-2247 del 9、2239-
2253 del 15、2239-2256 del 18、2239-2248>C del 10、2239-2258>CA del 20、2240-2251
del 12、2240-2254 del 15、2239-2251>C del 13、2236-2253 del 18、2237-2254 del 18、
One of 2237-2255 > T del and T790M or a variety of.
In a preferred embodiment, in the mutation of the EGFR gene,
For detecting 2235-2249 del 15, the 2236-2250 del 15,2240-2257 of 19 exons missing
del 18、2235-2252>AAT del 18、2237-2251 del 15、2238-2255 del 18、2238-2248>GC
del 11、2238-2252>GCA del 15、2239-2247 del 9、2239-2253 del 15、2239-2256 del
18、2239-2248>C del 10、2239-2258>CA del 20、2240-2251 del 12、2240-2254 del 15、
2239-2251 > C del 13,2236-2253 del 18,2237-2254 del 18,2237-2255 > T de primer pair such as
Shown in SEQ ID NO 1 and 2, probe is as shown in SEQ ID NO 3.
In a preferred embodiment, for detecting the upstream primer of T790M, the upstream and downstream of wild type are drawn
Object, respectively as shown in SEQ ID NO 04,05 and 06, corresponding saltant type probe and the blocking probe such as institute of SEQ ID NO 7 and 8
Show.
It can be under the same reaction condition simultaneously to 20 and EGFR gene related locus using kit of the invention
Mutation carries out high-throughput detection.The high specificity of detection, high sensitivity, lowest detection are limited to 1ng/ μ L, and the used time is short, send from sample
It examines and obtains a result and can be completed within 2 hours.Suitable for the detection and screening to tumor patient EGFR genetic mutation.
Detailed description of the invention
Fig. 1 is the scatter plot of the 19del Locus Analysis in Shoots result detected using the kit in embodiment.
Specific embodiment
The principle and features of the present invention will be described below with reference to the accompanying drawings, and the given examples are served only to explain the present invention, and
It is non-to be used to limit the scope of the invention.
1. the detection in mutational site
1.1 detection techniques and instrument
In order to fast high-flux detect these mutation, we use microflow control technique, including micro-fluidic chip and
Two parts of microfluidic platform.
Micro-fluidic chip is integrated in microfluidic channel, valve and reaction warehouse on one chip, and air pressure, temperature control are passed through
System processed and system of fluorescence analysis are automatically performed reaction system mixing, realize up to 9216 PCR reactions.Greatly reduce craft
The step of sample-adding and time complete whole process about 2 hours.
It is all accurate on micro-fluidic chip to be provided with many microchannels (sample, reagent, control liquid channel) and micro- reaction warehouse, in advance
It first is separately added into reagent, sample and control liquid in injection port, the different valve switch on chip can be realized by pressure control, essence
Quasi- control solution flows in chip channel, mixes in reaction warehouse, 9216 nL grades of PCR reaction warehouse at most may be implemented,
Carry out real-time fluorescence quantitative PCR reaction.
The microfluidic platform that we use (corresponds to Fluidigm's by the micro-fluidic nucleic acid augmentative instrument of Ascend MF600 type
Juno it) is formed with the micro-fluidic detection of nucleic acids instrument of Ascend MF800 type (Biomark of corresponding Fluidigm).
The difference of the micro-fluidic nucleic acid augmentative instrument of Ascend MF600 type (Juno) PCR and common amplification instrument essentially consists in miniflow
Control technology, principle are as follows:
Microfluidic channel, valve and reaction warehouse are integrated on a chip by micro-fluidic nucleic acid augmentative instrument using chip,
Reaction system mixing and PCR reaction are automatically performed by micro-fluidic nucleic acid augmentative instrument pneumatic control system and temperature control system.
The performance of micro-fluidic nucleic acid augmentative instrument built-in PC control system adjustable and monitoring instrument, identification and memorization COMS clip
Bar code.Using touch LCD display, customized and selection needs test procedures.Instrument use chip by microfluidic channel,
Valve and reaction warehouse are integrated on a chip, by pneumatic control system control sample and reagent micro-fluidic chip each
The indoor accurate flowing of small reaction and mixing, temperature control module realize quick, accurate, uniform heating/drop during PCR
Temperature realizes micro-fluidic PCR reaction on chip.Replace manual operation completely, realize reaction system mixing and PCR reaction it is complete from
Dynamicization.Micro-fluidic nucleic acid augmentative instrument includes pneumatic control system and temperature control control module, and pneumatic control system passes through vacuum pump
Accurate flowing of the pressure control liquid in micro-fluidic chip can be used as chip sample and reagent pretreatment controller, embedded
The performance of PC adjustable and monitoring instrument；Temperature control module controls quick, accurate, uniform heating/cooling during PCR.User
Using touch LCD display, customized and selection needs test procedures.
Micro-fluidic detection of nucleic acids instrument principle is similar to real-time fluorescence quantitative PCR instrument.Principle is as follows: micro-fluidic detection of nucleic acids instrument
Microfluidic channel, valve and reaction warehouse are integrated on a chip by institute using chip, can be automatically performed PCR reaction and result point
Analysis.When PCR reacts just beginning, amount of reagent is sufficient, and the concentration of template and product is all sufficiently low, and product is not competed with primer, expands
Increasing is increased with constant exponential rate.Late phase reaction rate is no longer exponentially increased, and amplification increases in variable linear, into linear
Rise period.In plateau, rate of amplification levels off to zero.
1.2 detection primers and probe design
High-throughput quickly detection can be achieved in the combination of micro-fluidic chip and platform.It is all anti-but on a chip
It answers the reaction condition of system to be consistent, needs to be comprehensively considered in terms of primer and probe, realize that all 20 kinds of detections are anti-
Effective and accurate testing result should be able to be obtained under the same reaction condition.This brings to disposably detecting different sites
Great difficulty.
We have spent the plenty of time to study and experimental verification, and it is disposable right to realize to devise following primer and probe
Above-mentioned 20 sites effectively accurately detect.Primer and probe it is as shown in table 1.
1 detection primer of table and probe
| Number | Title | Sequence |
| SEQ ID NO 01 | 19del upstream primer | GCCCGTCGCTATCAAAACATCTCCG |
| SEQ ID NO 02 | 19del downstream primer | AGGTTCAGAGCCATGGACCCCCACACAGCA |
| SEQ ID NO 03 | 19del saltant type probe | GAAAGCCAACAAGGAAATCCTCGATGTGAGTT-BHQ1 |
| SEQ ID NO 04 | T790M wild type upstream primer | CTCACCTCCACCGTGCAGCTCATCAC |
| SEQ ID NO 05 | T790M saltant type upstream primer | CTCACCTCCACCGTGCAGCTCATCAT |
| SEQ ID NO 06 | T790M downstream primer | TATCTCCCTTCCCTGATTACCTT |
| SEQ ID NO 07 | T790M saltant type probe | VIC-CCCTTCGGCTGCCTCCTGGACT-BHQ1 |
| SEQ ID NO 08 | T790M wild-type probe | CCTCACCTCCACCGTGCARCTCATCACCA-MGB |
2.3 reaction systems composition and reaction condition.
The template can for tissue specimen (fresh, paraffin-embedded tissue slice, liquid nitrogen cryopreservation, alcohol fixation and
The various operation samples that RNAlater is saved)；Or the sample that the various modes of aspiration biopsy save.
Reaction condition is as shown in table 2.
2 reaction condition of table
3 specific detection examples
2 pairs of primers and 2 pairs of probes are synthesized by Invitrogen；192.24 chip is purchased from Fluidigm company；ROX reference dye
Purchased from Life company；Specific PCR reaction solution is purchased from Applied Biosystems company.
Instrument: micro-fluidic nucleic acid augmentative instrument (Juno), micro-fluidic detection of nucleic acids instrument (Biomark), 2720 type PCR amplifications
Instrument, turbula shaker, centrifuge.
This kit is used to have confirmed that total 28 tissue samples of type, 4 positive quality controls (plasmid), 2 with clinic
Negative Quality Control (NTC) is template, the reaction system that micro-fluidic fluorescent PCR detects 20 EGFR genetic mutations is established, finally to follow
The standard that scatter plot judges as a result after ring.
Primed probe mix X is prepared, wherein X indicates number 1-2, respectively represents the mixing of the first to the second group primed probe
Liquid.Prepare the primed probe mix of 2 groups of primers respectively according to table 3.By primed probe mix X according to preparation 10 shown in table 4 × examination
Agent is respectively labeled as Assay 1-2.Sample premixed liquid is prepared by table 5, is then configured to sample premixed liquid and template final anti-
Answer system (table 6).
The preparation of 3 primed probe mix of table
The preparation of 4 10 × reagent of table
The preparation of 5 sample premixed liquid of table
The preparation of 6 end reaction system of table
| Component | Reaction volume (μ L) |
| DNA | 1.6 |
| Sample premixed liquid | 2.4 |
| Total volume | 4.0 |
Reaction system is uploaded on micro-fluidic chip, carries out carrying out fluorescent PCR detection reaction in microfluidic platform, instead
Answer condition as shown in table 2.
Fig. 1 is the amplification figure of T790M Locus Analysis in Shoots result.Such as table 7 after statistics.The results show that kit of the invention is examined
Survey result be actually consistent.
7 T790M site primer result of table statistics
The foregoing is merely presently preferred embodiments of the present invention, is not intended to limit the invention, it is all in spirit of the invention and
Within principle, any modification, equivalent replacement, improvement and so on be should all be included in the protection scope of the present invention.
Sequence table
<110>Guangdong rapid development Gene science limited liability company
<120>a kind of for detecting the kit of EGFR genetic mutation
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gcccgtcgct atcaaaacat ctccg 25
<210> 2
<211> 30
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
aggttcagag ccatggaccc ccacacagca 30
<210> 3
<211> 32
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
gaaagccaac aaggaaatcc tcgatgtgag tt 32
<210> 4
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
ctcacctcca ccgtgcagct catcac 26
<210> 5
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
ctcacctcca ccgtgcagct catcat 26
<210> 6
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
tatctccctt ccctgattac ctt 23
<210> 7
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
cccttcggct gcctcctgga ct 22
<210> 8
<211> 29
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
cctcacctcc accgtgcarc tcatcacca 29
Claims (5)
1. a kind of for detecting the kit of EGFR genetic mutation, which is characterized in that including for detecting 19 extra of EGFR gene
The detection reagent of aobvious son mutation.
2. kit according to claim 1, which is characterized in that the detection reagent includes covering the base for expanding
The primer pair in the mutational site of cause, and the probe in the detection mutational site.
3. kit according to claim 1, which is characterized in that 19 exon of EGFR gene, which is mutated, includes
2235-2249del 15、2236-2250del 15、2240-2257del 18、2235-2252>AAT del 18、2237-
2251del 15、2238-2255del 18、2238-2248>GC del 11、2238-2252>GCA del 15、2239-
2247del 9、2239-2253del 15、2239-2256del 18、2239-2248>C del 10、2239-2258>CA del
20、2240-2251del 12、2240-2254del 15、2239-2251>C del 13、2236-2253del 18、2237-
One of 2254del 18,2237-2255 > T del and T790M or a variety of.
4. kit according to claim 3, which is characterized in that in the mutation of the EGFR gene,
For detect 19 exons missing 2235-2249del 15,2236-2250del 15,2240-2257del 18,
2235-2252>AAT del 18、2237-2251del 15、2238-2255del 18、2238-2248>GC del 11、
2238-2252>GCA del 15、2239-2247del 9、2239-2253del 15、2239-2256del 18、2239-2248
>C del 10、2239-2258>CA del 20、2240-2251del 12、2240-2254del 15、2239-2251>C del
13, the primer pair such as institute of SEQ ID NO 1 and 2 of 2236-2253del 18,2237-2254del 18,2237-2255 > T de
Show, probe is as shown in SEQ ID NO 3.
5. according to kit as claimed in claim 3, which is characterized in that for detecting the upstream primer of T790M, wild type it is upper
Trip and downstream primer, respectively as shown in SEQ ID NO 04,05 and 06, corresponding saltant type probe and blocking probe such as SEQ
Shown in ID NO 7 and 8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811454633.4A CN109402261A (en) | 2018-11-30 | 2018-11-30 | It is a kind of for detecting the kit of EGFR genetic mutation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811454633.4A CN109402261A (en) | 2018-11-30 | 2018-11-30 | It is a kind of for detecting the kit of EGFR genetic mutation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109402261A true CN109402261A (en) | 2019-03-01 |
Family
ID=65456486
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811454633.4A Pending CN109402261A (en) | 2018-11-30 | 2018-11-30 | It is a kind of for detecting the kit of EGFR genetic mutation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109402261A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110438206A (en) * | 2019-08-23 | 2019-11-12 | 杭州迪安医学检验中心有限公司 | Primer, probe and the kit of one group of 19 Exon deletion of detection EGFR gene mutation |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103923974A (en) * | 2014-01-27 | 2014-07-16 | 上海涌泰生物医药科技有限公司 | Kit for detecting T790M site mutation of EGFR gene exon 20, and method thereof |
| CN108642156A (en) * | 2018-06-29 | 2018-10-12 | 江苏先声医学诊断有限公司 | A kind of the digital pcr detection kit and its detection method of T790M gene mutations |
| CN108841953A (en) * | 2018-06-05 | 2018-11-20 | 北京雅康博生物科技有限公司 | The kit of 22 kinds of EGFR gene mutation is detected using digital pcr technology |
-
2018
- 2018-11-30 CN CN201811454633.4A patent/CN109402261A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103923974A (en) * | 2014-01-27 | 2014-07-16 | 上海涌泰生物医药科技有限公司 | Kit for detecting T790M site mutation of EGFR gene exon 20, and method thereof |
| CN108841953A (en) * | 2018-06-05 | 2018-11-20 | 北京雅康博生物科技有限公司 | The kit of 22 kinds of EGFR gene mutation is detected using digital pcr technology |
| CN108642156A (en) * | 2018-06-29 | 2018-10-12 | 江苏先声医学诊断有限公司 | A kind of the digital pcr detection kit and its detection method of T790M gene mutations |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110438206A (en) * | 2019-08-23 | 2019-11-12 | 杭州迪安医学检验中心有限公司 | Primer, probe and the kit of one group of 19 Exon deletion of detection EGFR gene mutation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108949990B (en) | Kit and method for detecting EGFR gene mutation | |
| CN106591438B (en) | Nucleic acid combination, kit and application for detecting Her2 gene | |
| CN106939337B (en) | Construction method of hormone receptor positive breast cancer recurrence monitoring gene mutation library | |
| CN108753965A (en) | A kind of compound amplification detection system of microsatellite instability state and its application | |
| CN109593847B (en) | Primer pair, kit and method for detecting stability of NR24 locus of microsatellite | |
| CN108342464A (en) | One-step method detects the kit and its detection method of HER2/neu gene expression amounts | |
| CN109371132A (en) | It is a kind of for detecting the kit of CYP2D6 gene copy number variation | |
| CN109402261A (en) | It is a kind of for detecting the kit of EGFR genetic mutation | |
| CN109439755A (en) | It is a kind of for detecting the kit of breast cancer related gene expression | |
| CN107641649B (en) | Primer pair, kit and method for detecting stability of NR27 locus of microsatellite | |
| WO2016044673A1 (en) | Hybrid multi-step nucleic acid amplification | |
| CN111235240A (en) | PCR reaction solution and kit for detecting mutation at V600E locus of human BRAF gene | |
| CN116334281A (en) | Kit and method for conventional/real-time fluorescence/digital PCR identification of toxic mushroom species | |
| WO2019084998A1 (en) | Kit for detecting kras, nras, or braf gene mutation | |
| WO2015168831A1 (en) | Methods and compositions for detecting expression of target genes | |
| CN113718020A (en) | Primer-probe combination and kit for detecting internal tandem repeat mutation of human leukemia FLT3 gene and application of primer-probe combination and kit | |
| CN102876799A (en) | Multiple real-time quantitative polymerase chain reaction (PCR) kit for detecting mixed lineage leukemia (MLL) relative fuse genes | |
| CN103103267A (en) | Kit for detecting genotype of human chromosome 21 STR (short tandem repeat) | |
| CN109439756A (en) | It is a kind of for detecting the kit of KRAS correlation drug resistance | |
| US20150159224A1 (en) | Ultrasensitive detection and characterization of clustered kras mutations using peptide nucleic acid clamp pcr in drop-based microfluidics | |
| CN111850129A (en) | Primer pair, kit and method for detecting stability of NR21 locus of microsatellite | |
| CN102399858A (en) | Detection method for DNA point mutation based on fluorescent quenching release | |
| CN110241186A (en) | Detect the binary channels real-time fluorescent quantitative RT-PCR method of GATA3 gene relative expression quantity | |
| CN110684849A (en) | Primer, probe, kit and method for detecting KRAS gene mutation of human circulating tumor cell based on ddPCR | |
| CN109371170A (en) | A kind of kit for quantitative detection hepatitis type B virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190301 |
|
| WD01 | Invention patent application deemed withdrawn after publication |