CN109402086A - A kind of 2-Methyl Butyric Acid side-chain hydrolysis enzyme and its expression bacterial strain and application - Google Patents

A kind of 2-Methyl Butyric Acid side-chain hydrolysis enzyme and its expression bacterial strain and application Download PDF

Info

Publication number
CN109402086A
CN109402086A CN201810114102.4A CN201810114102A CN109402086A CN 109402086 A CN109402086 A CN 109402086A CN 201810114102 A CN201810114102 A CN 201810114102A CN 109402086 A CN109402086 A CN 109402086A
Authority
CN
China
Prior art keywords
butyric acid
acid side
methyl butyric
leu
enzyme
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201810114102.4A
Other languages
Chinese (zh)
Other versions
CN109402086B (en
Inventor
吕雪峰
梁波
杨勇
黄雪年
郑玲辉
滕云
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang Hisun Pharmaceutical Co Ltd
Qingdao Institute of Bioenergy and Bioprocess Technology of CAS
Original Assignee
Zhejiang Hisun Pharmaceutical Co Ltd
Qingdao Institute of Bioenergy and Bioprocess Technology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang Hisun Pharmaceutical Co Ltd, Qingdao Institute of Bioenergy and Bioprocess Technology of CAS filed Critical Zhejiang Hisun Pharmaceutical Co Ltd
Priority to CN201810114102.4A priority Critical patent/CN109402086B/en
Publication of CN109402086A publication Critical patent/CN109402086A/en
Application granted granted Critical
Publication of CN109402086B publication Critical patent/CN109402086B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/18—Carboxylic ester hydrolases (3.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/02—Oxygen as only ring hetero atoms
    • C12P17/06—Oxygen as only ring hetero atoms containing a six-membered hetero ring, e.g. fluorescein

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Mycology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention belongs to protein engineerings and field of medicine production, provide a kind of 2-Methyl Butyric Acid side-chain hydrolysis enzyme, and the enzyme is obtained by rite-directed mutagenesis wild type PcEST, and mutational site is the 140th.The present invention also provides biomaterial relevant to the enzyme, the application of the enzyme, and the Aspergillus strain and construction method of the coding enzyme.2-Methyl Butyric Acid side-chain hydrolysis enzyme enzymatic activity provided by the invention is high, improves to the stability of temperature, is more advantageous to industrial applications.

Description

A kind of 2-Methyl Butyric Acid side-chain hydrolysis enzyme and its expression bacterial strain and application
Technical field
The invention belongs to protein engineering and field of medicine production, it is related to a kind of 2-Methyl Butyric Acid side-chain hydrolysis enzyme and energy Enough produce the bacterial strain of citrinin J.
Background technique
Cardiovascular and cerebrovascular disease seriously threatens human health, and morbidity and mortality are in many countries and regions rankings One.Hyperlipidemia (hypercholesterolemia) is a major incentive of cardiovascular and cerebrovascular disease, therefore prevents hyperlipidemia, adjusts blood Rouge and reduction blood lipid become the key of prevention and treatment cardiovascular and cerebrovascular disease.For these reasons, cholesterol-lowering drug has very big city Field prospect, for many years always situated in the forefront of global well selling medicine.
Simvastatin (Simvastatin) i.e. simvastatin (Zocor) is the important drop blood of one kind of Merck company research and development Rouge drug can effectively inhibit the internal synthesis of cholesterol, be one of the choice drug for treating hyperlipidemia.The conjunction of Simvastatin At being with the tunning Lovastatin (lovastatin) of Aspergillus terreus for raw material, by chemically synthesized.In Simvastatin It in synthesis process, needs first to remove Lovastatin C8 2-Methyl Butyric Acid side chains, obtains citrinin J (Monacolin J), Then 2,2- acid dimethyl side chain is added on the position C8 of citrinin J by subsequent technique again, pungent cuts down him to obtain Spit of fland.It can be seen that citrinin J is the important as precursors object of Simvastatin synthesis.Currently, being adopted in the synthetic route of Simvastatin Chemically hydrolysis Lovastatin prepares citrinin J, will use a large amount of acid, alkali and organic examination in whole preparation process Agent, complex process, time-consuming, yield is low, pollution pressure is big.
2-Methyl Butyric Acid side-chain hydrolysis enzyme can hydrolyze the side chain ester bond fracture of Lovastatin, generate citrinin J and 2- Methylbutanoic acid.Komagata et al. was purified into a kind of 2- in 1986 in the mycelium of fungi Emericella unguis Methylbutanoic acid side-chain hydrolysis enzyme, the transformation efficiency of the enzyme are about 86%.In next decades, researcher sends out successively again Show multiple 2-Methyl Butyric Acid side-chain hydrolysis enzymes, however the catalytic efficiency of these enzymes is lower, there are apparent substrate suppression phenomenon, And the protein sequence and correlative coding gene information about enzyme are not all accredited, therefore directly can not be utilized and be changed to it It makes, these problems all strongly limit application of the enzyme in large-scale industrial production.
Present inventor reported a kind of 2-Methyl Butyric Acid side-chain hydrolysis enzyme PcEST (SEQ ID NO:1) in 2017, The 2- methylbutyryl side chain that it can effectively hydrolyze Lovastatin generates citrinin J and 2-Methyl Butyric Acid, and catalytic efficiency is aobvious Write the Lovastatin side-chain hydrolysis esterase (WO2005040107A2) reported before being higher than.In addition, by high yield monascus purpureus It is overexpressed PcEST in Aspergillus terreus bacterial strain, so that Lovastatin is hydrolyzed into citrinin J after synthesizing in vivo, to obtain It is capable of the aspergillus engineered strain of direct fermentation production citrinin J, can establish one-step fermentation and directly produce citrinin J's New process (Huang XN, Liang YJ, Yang Y, Lu XF.Single-step production of the simvastatin precursor monacolin J by engineering of an industrial strain of Aspergillus terreus.Metab.Eng.,2017,42,109-114).But Lovastatin hydrolyzes in the engineered strain Rate is about 95%, still has about 5% Lovastatin residual, this will increase the cost of later separation purifying.Therefore, one is constructed Citrinin J can be efficiently synthesized and be highly desirable without the remaining engineered strain of Lovastatin, can be further simplified pungent Statin production technology is cut down, production cost is reduced.
Summary of the invention
The object of the present invention is to provide a kind of new 2-Methyl Butyric Acid side-chain hydrolysis enzymes, it improves PcEST solubility table The effect and thermal stability reached, while its catalytic activity is further increased, it can be preferably applied for industrial production, solved Above-mentioned prior art problem.
In the first aspect, the present invention provides a kind of 2-Methyl Butyric Acid side-chain hydrolysis enzyme, is by rite-directed mutagenesis wild type The mutant that PcEST (SEQ ID NO:1) is obtained, mutational site are the 140th, mutant form Q140L, that is, the 2- first The sequence of base butyric acid side-chain hydrolysis enzyme is as shown in SEQ ID NO:2.
In present specification, unless specific instructions, PcEST/Q140L is abbreviated as Q140L, indicates protein mutant.This Field technical staff based on context content, can clearly distinguish Q140L expression is mutant form or mutant.
In present specification, meaning that the abbreviation of amino acid, nucleotide has this field general.
The second aspect provides biomaterial relevant to 2-Methyl Butyric Acid side-chain hydrolysis enzyme of the invention, are as follows:
(1) nucleic acid molecules, nucleic acid molecule encoding 2-Methyl Butyric Acid side-chain hydrolysis enzyme of the invention；Preferably, described Nucleic acid molecules are pcest/Q140L, and sequence is as shown in SEQ ID NO:3；Or
(2) comprising the expression cassette, recombinant vector, recombinant cell or recombinant microorganism of (1) described nucleic acid molecules；
Preferably, the microorganism is Aspergillus strain, is able to produce citrinin J.
About above-mentioned biomaterial, those skilled in the art are according to the amino acid of the 2-Methyl Butyric Acid side-chain hydrolysis enzyme of offer Sequence could be aware that the sequence for encoding the nucleic acid molecules of the enzyme, and can be readily selected, make and use comprising the nucleic acid Molecule is to express expression cassette, recombinant vector, recombinant cell and the recombinant microorganism of albumen.
In terms of third, 2-Methyl Butyric Acid side-chain hydrolysis enzyme of the invention is provided in hydrolysis containing 2-Methyl Butyric Acid side chain Application in statin substance；Preferably, the statin substance containing 2-Methyl Butyric Acid side chain is Lovastatin, U.S.A cuts down him Spit of fland or Pravastatin；It is further preferred that the statin substance is acid, lactone formula or salt formula.
4th aspect, provides the method for constructing the Aspergillus strain of above-mentioned production citrinin J, including the Aspergillus strain that will set out The DNA fragmentation cotransformation of protoplast and the nucleic acid molecules comprising encoding 2-Methyl Butyric Acid side-chain hydrolysis enzyme of the invention, through sieving It is obtained after choosing.Preferably, the Aspergillus strain that sets out is Aspergillus (Aspergillus sp.) HZ01, and deposit number is CGMCC NO.12970。
During Aspergillus of setting out used in the present invention (Aspergillus sp.) HZ01 was preserved on October 17th, 2016 State's Microbiological Culture Collection administration committee common micro-organisms center (CGMCC), deposit number are CGMCC NO.12970, preservation Centre address is Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3.
The preparation of Aspergillus strain protoplast, the co-cultivation of protoplast and DNA fragmentation, screening of positive Aspergillus etc. are all It is the ordinary skill in the art.
Preferably, the sequence such as SEQ ID of the nucleic acid molecules of coding 2-Methyl Butyric Acid side-chain hydrolysis enzyme of the invention Shown in NO:3.
5th aspect provides nucleic acid molecules of the invention or expression cassette comprising the nucleic acid molecules, recombinant vector, again The application of group cell or recombinant microorganism in the Aspergillus strain that preparation produces citrinin J.
6th aspect, provides a kind of method for preparing citrinin J, including fermented and cultured Aspergillus provided by the invention Strain, or with 2-Methyl Butyric Acid side-chain hydrolysis enzyme hydrolysis Lovastatin provided by the invention.
7th aspect, provide aforementioned present invention biomaterial Aspergillus strain or its bacteria suspension or its fermentation liquid or its Metabolite is preparing the application in citrinin J.
8th aspect, provide aforementioned present invention biomaterial Aspergillus strain or its bacteria suspension or its fermentation liquid or its Application of the metabolite in production blood lipid-lowering medicine, wherein the blood lipid-lowering medicine is Simvastatin.
Compared with wild-type enzyme, enzyme activity improves 2-Methyl Butyric Acid side-chain hydrolysis enzyme provided by the invention, is higher by about 2 times, right The stability of temperature improves, and simplifies the production technology of Simvastatin, reduces production cost, is more advantageous to industrial applications.
Detailed description of the invention
Fig. 1: A is the electrophoretic analysis figure of wild type and mutant protein purification result；B is enzyme activity determination result figure, enzyme activity It is a unit of activity (U) that unit of force, which is defined as enzyme amount needed for being catalyzed 1 micromole's citrinin J of generation per minute,.In figure What ordinate indicated is the enzyme activity unit number contained by every milligram of zymoprotein.WT: wild type PcEST；Q140L:PcEST/ Q140L mutant.
Fig. 2: the electrophoretic analysis figure of wild type and mutant protein solubility expression, WT: wild type PcEST；Q140L: PcEST/Q140L mutant.S: soluble protein fraction；I: insolubility protein part.
Fig. 3: the thermal stability analysis figure of wild type and mutant protein, WT: wild type PcEST；Q140L:PcEST/ Q140L mutant.
Fig. 4: pG3H plasmid map schematic diagram.
Fig. 5: it is overexpressed the Genomic PCR verification result of Aspergillus transformation of PcEST/Q140L；Wherein, 1#, 2#, 7#, 8#, 9#, 10#, 11#, 13# are positive transformant, and C is plasmid pG3H-pcest/Q140L, and wt is control strain HZ01 bacterial strain.
Fig. 6: it is overexpressed the Genomic PCR verification result of Aspergillus transformation of wild type PcEST；Wherein, 1#, 4#, 5# are Positive transformant, C are plasmid pG3H-pcest, and wt is control strain HZ01 bacterial strain.
Fig. 7: the HPLC analysis of the 8th day sample of each bacterial strain；Wherein, HZ01 is wild-type strain, and HZ-PcEST is to be overexpressed The control strain of wild type PcEST, HZ-PcEST/Q140L are the aspergillus engineered strains for being overexpressed PcEST/Q140L mutant, Wherein figure B is the partial enlargement diagram of figure A.
Fig. 8: the content of Lovastatin and citrinin J in the 8th day fermented sample of each bacterial strain；Wherein, HZ01 is wild type Bacterial strain, HZ-PcEST series are the control strain for being overexpressed wild type PcEST, and Q140L series is to be overexpressed PcEST/Q140L to dash forward The aspergillus engineered strain of variant.
Specific embodiment
The content of present invention is described below in conjunction with specific embodiment.It is used in the following embodiment if nothing clearly states Reagent, instrument are this field conventional reagent, instrument, can be obtained by commercially available approach；Used method is also conventional side Method, those skilled in the art can clearly know how to complete the experiment, obtain and tie accordingly according to description Fruit.
Plasmid, which extracts, in the present invention uses OMEGA company Plasmid Mini Kit I kit (D6942-01), DNA piece Duan Huishou is using OMEGA company Cycle-Pure Kit kit (D6492-01), and gel recycling is using OMEGA company Gel Extraction Kit kit (D2500-01).
CD culture medium composition are as follows: 3g/L NaNO3, 2g/L KCl, 1g/L KH2PO4, 0.5g/L MgSO4·7H2O, 0.02g/L FeSO4·7H2O, 10g/L glucose.
CD plating medium composition are as follows: 3g/L NaNO3, 2g/L KCl, 1g/L KH2PO4, 0.5g/L MgSO4·7H2O, 0.02g/L FeSO4·7H2O, 10g/L glucose, 1.5g/L agar.
IPM fluid nutrient medium: 60g L-1Glucose, 2g L-1NH4NO3, 20mg L-1(NH4)2HPO4, 20mg L-1FeSO4, 0.4g L-1MgSO4, 4.4mg L-1ZnSO4, 0.5g/L corn pulp, pH 3.5.
Lovastatin fermentation seed culture medium: 9g L-1Glucose, 10g L-1Sucrose, 1g L-1Yeast extract, 1g L-1 Peptone, 1g L-1Sodium acetate, 0.04g L-1KH2PO4, 0.1g L-1MgSO4, 5g L-1Dregs of beans, 1.5g L-1Calcium carbonate, pH6.8。
Lovastatin fermentation medium: 70g L-1Glucose, 20g L-1Sucrose, 1.5g L-1Yeast extract, 20g L-1 Peptone, 7g L-1Sodium acetate, 0.5g L-1KH2PO4, 0.5g L-1MgSO4, 5g L-1Dregs of beans, 5g L-1Calcium carbonate, GPE (cigarette Platform Heng Xin Chemical Industry Science Co., Ltd, model THIX-298) 0.1mL L-1, pH6.5.
The acquisition of embodiment 1:2- methylbutanoic acid side-chain hydrolysis enzyme mutant
The building of 1.2- methylbutanoic acid side-chain hydrolysis enzyme mutant Q140L
(1) it is mutated PCR: rite-directed mutagenesis is carried out using QuikChange method.With pEASY-E2-pcest plasmid (Huang XN,Liang YJ,Yang Y,Lu XF.(2017).Single-step production of the simvastatin precursor monacolin J by engineering of an industrial strain of Aspergillus Terreus.Metab.Eng., 42,109-114) it is template, primer is designed and synthesized according to mutational site, carries out PCR amplification, Obtain the gene of coding 2-Methyl Butyric Acid side-chain hydrolysis enzyme mutant.
PCR reaction system are as follows: 32.5 μ L of sterile water, 1 μ L, 5 × PrimeSTAR HS buffer (Mg of template DNA2+plus) 10 μ L, dNTP mixed liquor (each 2.5mmol/L), 4 μ L, mutant primer is to Q140L-F (5 '- CAAAATGGCGCGCACTATACGCGAATCCGG-3 ') and Q140L-R (5 '- CCGGATTCGCGTATAGTGCGCGCCATTTTG-3 ') each 1 μ L (20pmol/ μ L), TaKaRa PrimeSTAR HS DNA is poly- 0.5 μ L of synthase.Reaction condition are as follows: 95 DEG C of initial denaturation 5min；94 DEG C of 10s, 60 DEG C of 15s, 72 DEG C of 7.5min, 18 circulations；Finally 72 DEG C of extension 10min.
(2) digestion: the PCR product that reaction is completed is taken out, and is added by the ratio of 1:50 (Dpn I enzyme: PCR product, v:v) Dpn I enzyme, 1 hour of 37 DEG C of digestions.
(3) it takes out, converts to e. coli bl21 (DE3) competent cell, in (50 μ g/ of final concentration containing kanamycin Ml it is coated on LB plate), 37 DEG C are incubated overnight.
After transformant is grown, picking monoclonal sends to sequencing, shown in the nucleotide sequence SEQ ID NO:3 according to mutant The mutant form bacterial strain that is correctly mutated of screening and it includes correspondence carrier pEASY-E2-pcest/Q140L.
2. the building of wild type 2-Methyl Butyric Acid side-chain hydrolysis expression of enzymes carrier:
Pass through Standard PCR primer 1:5 ' GGAATTCCATATGGATACCACCTTTCAGGCG 3 ' and primer 2: 5 ' CCGCTCGAGTCACTGCTGACCTTTCCAGGC 3 ' is respectively from plasmid pEASY-E2-pcest and pEASY-E2-pcest/ Wild type PcEST gene pcest and PcEST/Q140L mutant gene pcest/Q140L is arrived in amplification on Q140L, and PCR product is pure Restriction enzyme Nde I and Xho I digestion are used after change, are connected with the pET28a-smt3 carrier through identical digestion, obtained load Body is respectively designated as pET-pcest and pET-pcest/Q140L, and it is thin that plasmid converts e. coli bl21 (DE3) competence respectively Its gene order is identified in born of the same parents, picking transformant, sequencing.Pcest/Q140L mutant sequence is wild as shown in SEQ ID NO:3 Type pcest is as shown in SEQ ID NO:4.
3. the purifying of protein
The e. coli bl21 (DE3) of culture expression wild-type enzyme and mutant enzyme, 37 DEG C of cultures add to logarithmic growth phase Enter inducer isopropylthio-β-D- thiogalactoside (IPTG, final concentration are 0.2mM), after 16 DEG C of overnight inducing expressions, collects bacterium Body, is resuspended in 40ml Tris-HCl buffer (20mM, pH 8.0), and ultrasonication thallus obtains crude enzyme liquid, by Ni- NTA is purified.Albumen is collected, with Ulp1 (Ulp1:PcEST mass ratio is 1:50) digestion overnight, passes through the anti-side for hanging Ni column Formula continues purifying protein, and most target proteins are pierced by Ni column, and His-sumo is closer in conjunction with Ni column, needs high concentration The imidazoles of (250mM) can just elute, therefore can obtain true protein (Figure 1A).
Through being sequenced, the sequence of mutant enzyme and expected consistent.
Embodiment 2: measurement enzymatic activity
Protein prepared by Example 1 carries out enzyme assay.The concentration of zymoprotein is 0.05 μM, substrate Lovastatin Concentration be 400 μM, 37 DEG C are reacted 10 minutes, the citrinin J for utilizing HPLC measurement to generate.HPLC reacts the chromatographic column used It is Agilent ZORBAX XDB-C18 (4.6 × 150mm, 5 μm), mobile phase is acetonitrile: 0.1% phosphoric acid (50:50, v:v) stream Speed is 1ml/min, 10 μ l of sample introduction.As a result as shown in Figure 1B, the enzyme activity of the 2-Methyl Butyric Acid side-chain hydrolysis enzyme of mutant Q140L is 2.51 times of wild enzyme.
The measurement of embodiment 3:2- methylbutanoic acid side-chain hydrolysis enzyme mutant enzymatic property
1,2-Methyl Butyric Acid side-chain hydrolysis enzyme wild type and the measurement of mutant protein solubility expression
E. coli bl21 (DE3) 100ml of culture encoding wild type and mutant 2-Methyl Butyric Acid side-chain hydrolysis enzyme, 37 DEG C culture is added inducer isopropylthio-β-D- thiogalactoside (IPTG, final concentration are 0.2mM), 25 to logarithmic growth phase The inducing expression that albumen is carried out under the conditions of DEG C, collects bacterium solution after staying overnight, is centrifuged after ultrasonication, separates supernatant and precipitating, sinks Tris-HCl the buffer (50mM, pH 8.0) for part addition same volume of forming sediment suspends.Take same amount of supernatant and precipitating egg White liquor carries out the analysis of SDS-PAGE protein electrophoresis, as a result as shown in Figure 2.The wild-type protein of the overwhelming majority in sediment fraction, on Supernatant fraction only has minimal amount of PcEST albumen, and the protein content of PcEST obviously increases in the supernatant fraction of mutant Q140L It is more, illustrate that the amount of soluble expression of Q140L mutant protein increases relative to wild type.
2,2-Methyl Butyric Acid side-chain hydrolysis enzyme wild type and the measurement of the temperature stability of mutant protein
The reactive tank temperature condition of PCR instrument is set, the wild type and mutant protein of equivalent is taken out, is placed on tool There is the anti-of different temperatures (20 DEG C, 22 DEG C, 25 DEG C, 28 DEG C, 30 DEG C, 32 DEG C, 35 DEG C, 37 DEG C, 40 DEG C, 42 DEG C, 45 DEG C and 50 DEG C) It answers in slot, is incubated for 10 minutes, places cooled on ice 10 minutes immediately, be then taken out albumen and carry out enzyme assay, measurement Condition is: the concentration of enzyme is 0.05 μM, and the concentration of substrate Lovastatin is 400 μM, and 37 DEG C are reacted 10 minutes, is measured using HPLC The citrinin J of generation.With do not do Temperature Treatment albumen activity be 100%, calculate albumen after treatment of different temperature The relative value of enzymatic activity draws curve.As shown in figure 3, the T of mutant Q140L50Value improves 3 DEG C than wild type.
Embodiment 4: the building of the Aspergillus strain of citrinin J is produced
The two kinds of plasmids of pEASY-E2-pcest/Q140L constructed respectively using pEASY-E2-pcest and embodiment 1 is moulds Plate, with primer pcest-F1 (5 '-gatccatggataccacctttcaggc-3 ') and pcest-R1 (5 '- Gatgcggccgcgttagcagccggatctcagtg-3 ') expand wild type pcest and mutant pcest/Q140L gene piece Section carries out digestion with restriction enzyme Nco I (Thermo, FD0573) and Not I (Thermo, FD0593) respectively and recycles Target fragment (1.2kb).With restriction enzyme Pci I (Thermo, ER1871) and Not I to carrier pG3H (Fig. 4, Xuenian Huang,Xuefeng Lv,Jianjun Li*,Cloning and functional characterization of a native glyceraldehyde-3-phosphate dehydrogenase promoter for Aspergillus terreus,Journal of Industrial Microbiology and Biotechnology,2014,41(3):585- 592) digestion, the segment that recycling size is about 7.3kb are carried out.By digestion pcest and pcest/Q140L segment difference after the recovery It is attached with pG3H carrier with T4 ligase, and converts escherichia coli DH5a, PCR and the correct plasmid of sequence verification are remembered respectively For pG3H-pcest and pG3H-pcest/Q140L.Respectively using pG3H-pcest and pG3H-pcest/Q140L as template, with drawing Object PgpdAt-F630 (5 '-catcatcgcattctccctctcg-3 ') and TtrpC-R2 (5 '- Ttactattgtatacccatcttag-3 ') PCR amplification is carried out, obtain the Expression element PgpdAt-pcest-TtrpC of PcEST And PgpdAt-pcest/Q140L-TtrpC, the Expression element include that promoter PgpdAt, PcEST (or PcEST/Q140L) is compiled Code sequence pcest (or pcest/Q140L), terminator TtrpC, size 2490bp are carried out by PCR product QIAquick Gel Extraction Kit Recovery purifying.With plasmid pPTR II (TAKARA, Catalog No.:3621) for template, with ptrA-F (5 '- Gggcaattgattacgggatc-3 ') and ptrA-R (5 '-atggggtgacgatgagccgc-3 ') as primer amplification obtain The selection markers pyrithiamine resistant gene ptrA segment that size is about 2.0kb, through PCR product QIAquick Gel Extraction Kit recovery purifying.
Aspergillus strain HZ01 (is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC), deposit number is CGMCC NO.12970, and collection address is Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3). It is inoculated in PDA solid plate (BD, DifcoTMPotato Dextrose Agar, 213400) on, 30 DEG C are cultivated 7 days, and spore is obtained Son.By the spore inoculating of HZ01 bacterial strain to 50mL fluid nutrient medium IPM (60g L-1Glucose, 2g L-1NH4NO3, 20mg L-1 (NH4)2HPO4, 20mg L-1FeSO4, 0.4g L-1MgSO4, 4.4mg L-1ZnSO4, 0.5g/L corn starch (Sigma, C8160- 500G), pH 3.5) in, making spore concentration is about 107A/mL, in 200rmp, 32 DEG C of culture 12-18h.With sterile single layer 500 Mesh nylon cloth is collected by filtration the mycelia grown, and with the 0.6M MgSO of sterilizing4Solution flushes three times, press dry be placed on it is sterile In 50ml triangular flask；1g mycelia is weighed, 10ml enzymolysis liquid is added, handles 1-3h in 30 DEG C, 60rpm.Enzymolysis liquid ingredient are as follows: 0.8% (mass volume ratio) cellulase (Sigma, Catalog No.:C1184), 0.8% (mass volume ratio) lyases (Sigma, Catalog NO.:L1412), 0.4% (mass volume ratio) glusulase (the raw work in Shanghai, Catalog No.: SB0870)、0.6M MgSO4, via 0.22 μm of sterilizing filter filtration sterilization.Mixed liquor after above-mentioned enzymatic hydrolysis is first used 8 layers Lens wiping paper filtering, collects filtrate.4 DEG C are collected by centrifugation protoplast, with pre-cooling 1.0M sorbitol solution washed once, then be pre-chilled STC (STC be 1.0M sorbierite, 50mM TrisHCl-pH 8.0,50mM CaCl2) washed once, finally plasm Weight is suspended from the STC of pre-cooling, and protoplast concentration is adjusted to 2 × 10 with STC8A/mL, obtains protoplast suspension.
Into the 150 above-mentioned protoplast suspensions of μ l simultaneously be added DNA fragmentation PgpdAt-pcest/Q140L-TtrpC (or PgpdAt-pcest/Q140L-TtrpC) (about 3 μ g) and ptrA (about 0.5 μ g), total volume are 15 μ l, Expression element and ptrA's Molar ratio is about 1:5.Add PSTC (PSTC 40%PEG4000,1.2M sorbierite, the 50mM Tris- of 50 μ l ice baths HCl-pH8.0,50mM CaCl2), it mixes gently, ice bath 30min.The PSTC of 1mL room temperature is added, is placed at room temperature for after mixing 20min；Then it is poured into after 30mL top-layer agar (CD+1.2M sorbierite+4g/L agarose, 48 DEG C of heat preservations after sterilizing) mixing 10 pieces of CD-SP regenerate screening and culturing medium plate (CD plate+1.2M sorbierite+0.1mg/L pyrithiamine (Sigma, P0256)) On, it is cultivated 5-7 days under 30 DEG C, dark condition.
From picking on transformation and selection plate there are pyrithiamine resistant transformants to be forwarded on screening flat board CD-P (CD plate + 0.1mg/L pyrithiamine), it is cultivated at 32 DEG C and carries out within 5 days passage purifying, continuous passage 4 times.Choose 4 conversions for stablizing passage Sub (2#, 3#, 4#, 5#) carries out single spore separation purifying, and the single colonie spore inoculating selected is in IPM fluid nutrient medium, and 30 DEG C, 200rpm is cultivated 48 hours, is collected mycelia and is extracted genome.PCR is carried out with primer PgpdAt-F630/TtrpC-R2 to test Card can amplify band (the PcEST/Q140L or wild type PcEST Expression element) person that size is about 2.6kb as the positive.By scheming 1#, 2#, 7#, 8#, 9#, 10#, 11#, 13# transformant known to 5 are the positive, are integrated with PcEST/Q140L Expression element on genome This 8 plants of HZ-PcEST/Q140L engineered strains are denoted as Q140L-1, Q140L- by PgpdAt-pcest/Q140L-TtrpC respectively 2,Q140L-7,Q140L-8,Q140L-9,Q140L-10,Q140L-11,Q140L-13.1#, 4#, 5# transformant as shown in Figure 6 For the positive transformant for being integrated with PcEST Expression element PgpdAt-pcest-TtrpC, it is denoted as HZ-PcEST-1, HZ- respectively PcEST-4、HZ-PcEST-5。
Embodiment 5: the fermentation verifying of the Aspergillus strain of citrinin J is produced
The Aspergillus strain for carrying out fermented and cultured will be needed to be inoculated in PDA solid plate, 30 DEG C of cultures, 7 days acquisition spores, packet It includes: engineered strain Q140L-1, Q140L-2, Q140L-7, Q140L-8, Q140L- of 8 plants of overexpression PcEST/Q140L mutant 9, Q140L-10, Q140L-11, Q140L-13, engineered strain HZ-PcEST-1, HZ- of 3 plants of overexpression wild type PcEST PcEST-4, HZ-PcEST-5 and starting strain HZ01.By spore inoculating in 35ml Lovastatin fermentation seed culture medium (250mL triangular flask), 28 DEG C, 220rpm shake culture 48 hours, 4 bottles of control strain HZ01 strain inoculated.By 3.5mL seed liquor It is inoculated in 30mL Lovastatin fermentation medium (250mL triangular flask), 28 DEG C, 220rpm shake culture 8 days.0.8mL is taken to ferment Liquid (with the pipette tips of haircut) is added into 15mL centrifuge tube, and the 0.2M NaOH solution of 0.8mL is added, adds 8mL without water beetle Alcohol is placed in overturning concussion 4 hours on blending instrument.With 0.22 μm of organic phase filter filtration treatment sample, HPLC is sent to analyze.HPLC points Analysis method are as follows: liquid-phase chromatographic column is Agilent ZORBAX SB-C18 liquid-phase chromatographic column 883975-902 (4.6 × 150mm, 5 μ M), mobile phase is acetonitrile/0.1%H3PO4=0.7/0.3, flow velocity 0.5ml/min, UV detector (237nm), 25 DEG C.Knot Fruit is as shown in Figure 7,8, and product is mainly Lovastatin in starting strain HZ01 bacterial strain, and citrinin J content is seldom.It is overexpressed Primary product is citrinin J in the engineered strain of wild type PcEST, and Lovastatin residual is seldom, about 5%-8%.It is overexpressed In the aspergillus engineered strain of PcEST/Q140L mutant, a large amount of citrinin J is contained in primary product, and Lovastatin exists It can't detect in the bacterial strain of part, content is few in the bacterial strain of part, and it is subsequent no longer to be isolated and purified lower than 0.5%, into One step simplifies Simvastatin production technology, reduces production cost.This illustrates to be overexpressed the PcEST mutation that enzyme performance improves Body, can be improved the hydrolysis efficiency intracellular of Lovastatin, to improve Lovastatin percent hydrolysis, reduces Lovastatin residual, obtains It obtains character and more preferably produces citrinin J aspergillus engineered strain.
Sequence table
<110>Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences
Haizheng Medicine Stock Co., Ltd., Zhejiang Prov
<120>a kind of 2-Methyl Butyric Acid side-chain hydrolysis enzyme and its expression bacterial strain and application
<130> DP1F171503ZX
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 399
<212> PRT
<213>penicillium chrysogenum (Penicillium chrysogenum)
<400> 1
Met Asp Thr Thr Phe Gln Ala Ala Ile Asp Thr Gly Lys Ile Asn Gly
1 5 10 15
Ala Val Val Cys Ala Thr Asp Ala Gln Gly His Phe Val Tyr Asn Lys
20 25 30
Ala Thr Gly Glu Arg Thr Leu Leu Ser Gly Glu Lys Gln Pro Gln Gln
35 40 45
Leu Asp Asp Val Leu Tyr Leu Ala Ser Ala Thr Lys Leu Ile Thr Thr
50 55 60
Ile Ala Ala Leu Gln Cys Val Glu Asp Gly Leu Leu Ser Leu Asp Gly
65 70 75 80
Asp Leu Ser Ser Ile Ala Pro Glu Leu Ala Ala Lys Tyr Val Leu Thr
85 90 95
Gly Phe Thr Asp Asp Glu Ser Pro Leu Asp Asp Pro Pro Ala Arg Pro
100 105 110
Ile Thr Leu Lys Met Leu Leu Thr His Ser Ser Gly Thr Ser Tyr His
115 120 125
Phe Leu Asp Pro Ser Ile Ala Lys Trp Arg Ala Gln Tyr Ala Asn Pro
130 135 140
Glu Asn Glu Lys Pro Arg Leu Val Glu Glu Met Phe Thr Tyr Pro Leu
145 150 155 160
Ser Phe Gln Pro Gly Thr Gly Trp Met Tyr Gly Pro Gly Leu Asp Trp
165 170 175
Ala Gly Arg Val Val Glu Arg Val Thr Gly Gly Thr Leu Met Glu Phe
180 185 190
Met Gln Lys Arg Ile Phe Asp Pro Leu Gly Ile Thr Asp Ser Gln Phe
195 200 205
Tyr Pro Val Thr Arg Glu Asp Leu Arg Ala Arg Leu Val Asp Leu Asn
210 215 220
Pro Ser Asp Pro Gly Ala Leu Gly Ser Ala Val Ile Gly Gly Gly Gly
225 230 235 240
Glu Met Asn Leu Arg Gly Arg Gly Ala Phe Gly Gly His Gly Leu Phe
245 250 255
Leu Thr Gly Leu Asp Phe Val Lys Ile Leu Arg Ser Leu Leu Ala Asn
260 265 270
Asp Gly Met Leu Leu Lys Pro Ala Ala Val Asp Asn Met Phe Gln Gln
275 280 285
His Leu Gly Pro Glu Ala Ala Ala Ser His Arg Ala Ala Leu Ala Ser
290 295 300
Pro Leu Gly Pro Phe Phe Arg Val Gly Thr Asp Pro Glu Thr Lys Val
305 310 315 320
Gly Tyr Gly Leu Gly Gly Leu Leu Thr Leu Glu Asp Val Asp Gly Trp
325 330 335
Tyr Gly Glu Arg Thr Leu Thr Trp Gly Gly Gly Leu Thr Leu Thr Trp
340 345 350
Phe Ile Asp Arg Lys Asn Asn Leu Cys Gly Val Gly Ala Ile Gln Ala
355 360 365
Val Leu Pro Val Asp Gly Asp Leu Met Ala Asp Leu Lys Gln Thr Phe
370 375 380
Arg His Asp Ile Tyr Arg Lys Tyr Ser Ala Trp Lys Gly Gln Gln
385 390 395
<210> 2
<211> 399
<212> PRT
<213>artificial sequence (Artificial Sequence)
<400> 2
Met Asp Thr Thr Phe Gln Ala Ala Ile Asp Thr Gly Lys Ile Asn Gly
1 5 10 15
Ala Val Val Cys Ala Thr Asp Ala Gln Gly His Phe Val Tyr Asn Lys
20 25 30
Ala Thr Gly Glu Arg Thr Leu Leu Ser Gly Glu Lys Gln Pro Gln Gln
35 40 45
Leu Asp Asp Val Leu Tyr Leu Ala Ser Ala Thr Lys Leu Ile Thr Thr
50 55 60
Ile Ala Ala Leu Gln Cys Val Glu Asp Gly Leu Leu Ser Leu Asp Gly
65 70 75 80
Asp Leu Ser Ser Ile Ala Pro Glu Leu Ala Ala Lys Tyr Val Leu Thr
85 90 95
Gly Phe Thr Asp Asp Glu Ser Pro Leu Asp Asp Pro Pro Ala Arg Pro
100 105 110
Ile Thr Leu Lys Met Leu Leu Thr His Ser Ser Gly Thr Ser Tyr His
115 120 125
Phe Leu Asp Pro Ser Ile Ala Lys Trp Arg Ala Leu Tyr Ala Asn Pro
130 135 140
Glu Asn Glu Lys Pro Arg Leu Val Glu Glu Met Phe Thr Tyr Pro Leu
145 150 155 160
Ser Phe Gln Pro Gly Thr Gly Trp Met Tyr Gly Pro Gly Leu Asp Trp
165 170 175
Ala Gly Arg Val Val Glu Arg Val Thr Gly Gly Thr Leu Met Glu Phe
180 185 190
Met Gln Lys Arg Ile Phe Asp Pro Leu Gly Ile Thr Asp Ser Gln Phe
195 200 205
Tyr Pro Val Thr Arg Glu Asp Leu Arg Ala Arg Leu Val Asp Leu Asn
210 215 220
Pro Ser Asp Pro Gly Ala Leu Gly Ser Ala Val Ile Gly Gly Gly Gly
225 230 235 240
Glu Met Asn Leu Arg Gly Arg Gly Ala Phe Gly Gly His Gly Leu Phe
245 250 255
Leu Thr Gly Leu Asp Phe Val Lys Ile Leu Arg Ser Leu Leu Ala Asn
260 265 270
Asp Gly Met Leu Leu Lys Pro Ala Ala Val Asp Asn Met Phe Gln Gln
275 280 285
His Leu Gly Pro Glu Ala Ala Ala Ser His Arg Ala Ala Leu Ala Ser
290 295 300
Pro Leu Gly Pro Phe Phe Arg Val Gly Thr Asp Pro Glu Thr Lys Val
305 310 315 320
Gly Tyr Gly Leu Gly Gly Leu Leu Thr Leu Glu Asp Val Asp Gly Trp
325 330 335
Tyr Gly Glu Arg Thr Leu Thr Trp Gly Gly Gly Leu Thr Leu Thr Trp
340 345 350
Phe Ile Asp Arg Lys Asn Asn Leu Cys Gly Val Gly Ala Ile Gln Ala
355 360 365
Val Leu Pro Val Asp Gly Asp Leu Met Ala Asp Leu Lys Gln Thr Phe
370 375 380
Arg His Asp Ile Tyr Arg Lys Tyr Ser Ala Trp Lys Gly Gln Gln
385 390 395
<210> 3
<211> 1200
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
atggatacca cctttcaggc ggcgattgat accggcaaaa ttaacggcgc agttgtttgc 60
gcaaccgacg cacagggcca ttttgtttat aacaaagcaa ccggcgaacg taccctgctg 120
tctggcgaaa aacaaccgca acagctggat gatgttctgt atctggcaag cgcgaccaaa 180
ctgattacca ccattgctgc tctgcaatgc gttgaagacg gtctgctgag tctggacggc 240
gatctgagta gtattgcacc ggaactggca gcgaaatacg ttctgaccgg ttttaccgac 300
gacgaaagtc cgctggacga tccgccggca cgtccgatta ccctgaaaat gctgctgacc 360
catagcagcg gtaccagcta tcatttcctg gatccgtcta tcgcaaaatg gcgcgcacta 420
tacgcgaatc cggaaaacga aaaaccgcgt ctggtcgaag agatgttcac ctatccgctg 480
agttttcaac cgggtaccgg ctggatgtac ggtccgggtc tggattgggc aggtcgcgtt 540
gttgaacgtg ttacgggcgg taccctgatg gaattcatgc agaaacgcat cttcgatccg 600
ctgggtatca ccgatagcca gttttatccg gttacccgcg aagatctgcg cgcacgtctg 660
gttgatctga atccgtctga tccgggcgca ctgggttctg cagttattgg cggcggcggt 720
gaaatgaatc tgcgcggtcg cggcgcattt ggcggtcacg gtctgtttct gaccggtctg 780
gatttcgtca aaatcctgcg tagcctgctg gctaacgacg gtatgctgct gaaaccggct 840
gctgtcgata acatgttcca gcagcatctg ggtccggaag cagcagcaag tcatcgcgca 900
gcactggcaa gtccgctggg tccgtttttc cgcgttggta ccgatccgga aaccaaagtt 960
ggttacggtc tgggcggtct gctgaccctg gaagacgttg acggttggta cggcgaacgt 1020
accctgacct ggggcggtgg tctgaccctg acctggttta tcgaccgcaa aaacaacctg 1080
tgtggtgttg gcgcaattca agcagttctg ccggttgacg gcgatctgat ggcagatctg 1140
aaacagacct tccgccacga tatctaccgc aaatacagcg cctggaaagg tcagcagtga 1200
<210> 4
<211> 1200
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
atggatacca cctttcaggc ggcgattgat accggcaaaa ttaacggcgc agttgtttgc 60
gcaaccgacg cacagggcca ttttgtttat aacaaagcaa ccggcgaacg taccctgctg 120
tctggcgaaa aacaaccgca acagctggat gatgttctgt atctggcaag cgcgaccaaa 180
ctgattacca ccattgctgc tctgcaatgc gttgaagacg gtctgctgag tctggacggc 240
gatctgagta gtattgcacc ggaactggca gcgaaatacg ttctgaccgg ttttaccgac 300
gacgaaagtc cgctggacga tccgccggca cgtccgatta ccctgaaaat gctgctgacc 360
catagcagcg gtaccagcta tcatttcctg gatccgtcta tcgcaaaatg gcgcgcacaa 420
tacgcgaatc cggaaaacga aaaaccgcgt ctggtcgaag agatgttcac ctatccgctg 480
agttttcaac cgggtaccgg ctggatgtac ggtccgggtc tggattgggc aggtcgcgtt 540
gttgaacgtg ttacgggcgg taccctgatg gaattcatgc agaaacgcat cttcgatccg 600
ctgggtatca ccgatagcca gttttatccg gttacccgcg aagatctgcg cgcacgtctg 660
gttgatctga atccgtctga tccgggcgca ctgggttctg cagttattgg cggcggcggt 720
gaaatgaatc tgcgcggtcg cggcgcattt ggcggtcacg gtctgtttct gaccggtctg 780
gatttcgtca aaatcctgcg tagcctgctg gctaacgacg gtatgctgct gaaaccggct 840
gctgtcgata acatgttcca gcagcatctg ggtccggaag cagcagcaag tcatcgcgca 900
gcactggcaa gtccgctggg tccgtttttc cgcgttggta ccgatccgga aaccaaagtt 960
ggttacggtc tgggcggtct gctgaccctg gaagacgttg acggttggta cggcgaacgt 1020
accctgacct ggggcggtgg tctgaccctg acctggttta tcgaccgcaa aaacaacctg 1080
tgtggtgttg gcgcaattca agcagttctg ccggttgacg gcgatctgat ggcagatctg 1140
aaacagacct tccgccacga tatctaccgc aaatacagcg cctggaaagg tcagcagtga 1200

Claims (9)

1. a kind of 2-Methyl Butyric Acid side-chain hydrolysis enzyme, sequence is as shown in SEQ ID NO:2.
2. a kind of biomaterial, are as follows:
(1) nucleic acid molecules, the nucleic acid molecule encoding 2-Methyl Butyric Acid side-chain hydrolysis enzyme as described in claim 1；Preferably, The sequence of the nucleic acid molecules is as shown in SEQ ID NO:3；Or
(2) comprising the expression cassette, recombinant vector, recombinant cell or recombinant microorganism of (1) described nucleic acid molecules.
3. biomaterial according to claim 2, wherein the recombinant microorganism is Aspergillus strain, is able to produce not Receive Kelin J.
4. 2-Methyl Butyric Acid side-chain hydrolysis enzyme according to claim 1 is in Statins of the hydrolysis containing 2-Methyl Butyric Acid side chain Application in substance；Preferably, the statin substance containing 2-Methyl Butyric Acid side chain is Lovastatin, mevastatin or general Cut down statin；It is further preferred that the statin substance is acid, lactone formula or salt formula.
5. a method of construct biomaterial as claimed in claim 3, including will set out Aspergillus strain protoplast with comprising The DNA fragmentation cotransformation for encoding the nucleic acid molecules of 2-Methyl Butyric Acid side-chain hydrolysis enzyme as described in claim 1, after screening It arrives；Preferably, the Aspergillus strain that sets out is Aspergillus (Aspergillus sp.) HZ01, deposit number CGMCC NO.12970；Preferably, the sequence of the nucleic acid molecules of the coding 2-Methyl Butyric Acid side-chain hydrolysis enzyme as described in claim 1 As shown in SEQ ID NO:3.
6. application of the biomaterial as claimed in claim 2 in the Aspergillus strain that preparation produces citrinin J.
7. a kind of method for preparing citrinin J, including fermentation biomaterial as claimed in claim 3, or with claim 1 The 2-Methyl Butyric Acid side-chain hydrolysis enzyme hydrolysis Lovastatin.
8. biomaterial as claimed in claim 3 or its bacteria suspension or its fermentation liquid or its metabolite are preparing citrinin J In application.
9. biomaterial as claimed in claim 3 or its bacteria suspension or its fermentation liquid or its metabolite are in production blood lipid-lowering medicine In application, wherein the blood lipid-lowering medicine is Simvastatin.
CN201810114102.4A 2018-02-05 2018-02-05 2-methylbutyrate side chain hydrolase, expression strain and application thereof Active CN109402086B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810114102.4A CN109402086B (en) 2018-02-05 2018-02-05 2-methylbutyrate side chain hydrolase, expression strain and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810114102.4A CN109402086B (en) 2018-02-05 2018-02-05 2-methylbutyrate side chain hydrolase, expression strain and application thereof

Publications (2)

Publication Number Publication Date
CN109402086A true CN109402086A (en) 2019-03-01
CN109402086B CN109402086B (en) 2020-08-11

Family

ID=65463424

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810114102.4A Active CN109402086B (en) 2018-02-05 2018-02-05 2-methylbutyrate side chain hydrolase, expression strain and application thereof

Country Status (1)

Country Link
CN (1) CN109402086B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109402085A (en) * 2018-02-05 2019-03-01 中国科学院青岛生物能源与过程研究所 Synthesize recombinant bacterial strain, method and the relevant enzyme of Simvastatin
CN112143692A (en) * 2020-09-28 2020-12-29 江苏阿尔法药业有限公司 Lovastatin ester hydrolase recombinant strain, construction method and application

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5994566A (en) * 1998-06-29 1999-11-30 Industrial Technology Research Institute Process for preparing 6(R)-2 (8-hydroxy-2,6-dimethyl-polyhydro-naphthyl-1)-4-(R)-hydroxy-3,4,5,6-tetr ahydro-2H-pyran-2-one
WO2007139871A2 (en) * 2006-05-24 2007-12-06 The Regents Of The University Of California Methods and materials for making simvastatin and related compounds
CN101473040A (en) * 2006-06-20 2009-07-01 帝斯曼知识产权资产管理有限公司 Method for the production of simvastatin
CN102703539A (en) * 2003-10-21 2012-10-03 维莱尼姆公司 Methods for making simvastatin and intermediates
CN103725726A (en) * 2013-12-24 2014-04-16 烟台只楚药业有限公司 Preparation method for simvastatin by adopting enzymatic synthesis

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5994566A (en) * 1998-06-29 1999-11-30 Industrial Technology Research Institute Process for preparing 6(R)-2 (8-hydroxy-2,6-dimethyl-polyhydro-naphthyl-1)-4-(R)-hydroxy-3,4,5,6-tetr ahydro-2H-pyran-2-one
CN102703539A (en) * 2003-10-21 2012-10-03 维莱尼姆公司 Methods for making simvastatin and intermediates
WO2007139871A2 (en) * 2006-05-24 2007-12-06 The Regents Of The University Of California Methods and materials for making simvastatin and related compounds
CN101473040A (en) * 2006-06-20 2009-07-01 帝斯曼知识产权资产管理有限公司 Method for the production of simvastatin
CN103725726A (en) * 2013-12-24 2014-04-16 烟台只楚药业有限公司 Preparation method for simvastatin by adopting enzymatic synthesis

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BO LIANG等: "Enhanced single-step bioproduction of the simvastatin precursor monacolin J in an industrial strain of Aspergillus terreus by employing the evolved lovastatin hydrolase", 《BIOTECHOL J》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109402085A (en) * 2018-02-05 2019-03-01 中国科学院青岛生物能源与过程研究所 Synthesize recombinant bacterial strain, method and the relevant enzyme of Simvastatin
CN109402085B (en) * 2018-02-05 2021-02-12 中国科学院青岛生物能源与过程研究所 Recombinant strains, methods for synthesizing simvastatin, and related enzymes
CN112143692A (en) * 2020-09-28 2020-12-29 江苏阿尔法药业有限公司 Lovastatin ester hydrolase recombinant strain, construction method and application

Also Published As

Publication number Publication date
CN109402086B (en) 2020-08-11

Similar Documents

Publication Publication Date Title
CN100569938C (en) Can produce the Cladosporium endogenetic fungus of trans-resveratrol
Romano et al. Enzymatic hydrolysis of capsaicins for the production of vanillylamine using ECB deacylase from Actinoplanes utahensis
CN110527637A (en) A kind of Aspergillus terreus bacterial strain producing aconitic acid and its construction method and application
CN112899177B (en) Recombinant yarrowia lipolytica expressing myrosinase TGG4 and application thereof
CN101535467A (en) A levorotatory lactonohydrolase producing strain and its use for producing chiral oxyacid
CN107099516A (en) 7 β hydroxy sterols dehydrogenase mutants and its application in ursodesoxycholic acid synthesis
CN104152505A (en) Method for transforming and preparing 4-hydroxyl-L-isoleucine by using recombinant bacterial strains
CN107641622A (en) Hydrolyzable para-Phthalonitrile prepares the nitrilase of paracyanobenzoic acid
CN105695340B (en) Aspergillus oryzae and application thereof
CN106047837B (en) Serratia lipase mutant, recombinant expression transformant, enzyme preparation and application
CN107574173A (en) A kind of recombinant plasmid and its method for building High-productive Monascus Pigment Strain
CN109402086A (en) A kind of 2-Methyl Butyric Acid side-chain hydrolysis enzyme and its expression bacterial strain and application
CN109401985A (en) The Δ Tlrgt2 trichoderma engineering bacteria and its construction method of one plant height production peptaibols antibacterial peptide and application
CN104046586B (en) One strain gene engineering bacterium and the application in producing (2R, 3R)-2,3-butanediol thereof
CN110438015A (en) The method that the dried immature fruit of citron orange endogenetic fungus and its fermentation for producing hesperidinase produce hesperidinase
CN111471602A (en) Construction method and application of mucor circinelloides engineering strain for efficiently synthesizing gamma-linolenic acid by using cellulose
CN105602917B (en) A kind of production method and application of hesperidinase
CN109929822A (en) A kind of Aspergillus oryzae lipase mutant and its application
KR101830131B1 (en) Novel glycosyl hydrolase with beta-xylosidase and beta-glucosidase activities and uses thereof
CN108753744A (en) Sesquiterpene cyclase and its preparation and application, 2Z, 4E- α-root of Dahurian angelica perfume (or spice) ethane synthetic method
CN107201349A (en) A kind of engineering bacteria for expressing Kidney bean epoxide hydrolase and application
CN110358751A (en) A kind of recombinant lipase mutant, encoding gene, recombination engineering and application
CN108949784A (en) Application of the sporulation related gene sigmaF in producing enzyme
CN108118042B (en) 2-methylbutyrate side chain hydrolase, Monacolin J-producing aspergillus strain, and construction method and application thereof
CN113337432B (en) Methylophilus for producing pyrroloquinoline quinone and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant