CN109385427A - A kind of relevant APOE mutated gene of Ahl tribulus sea silent sickness and its application - Google Patents

Abstract

This application discloses a kind of relevant APOE mutated gene of Ahl tribulus sea silent sickness and its applications.The relevant APOE mutated gene of the Ahl tribulus sea silent sickness of the application occurs c.48G > A by the code area of wild type APOE gene and is mutated.The APOE mutated gene of the application is the new relevant pathogenic mutation gene of one kind of Alzheimer disease, the discovery in the APOE mutated gene or pathogenic mutation site, it further expands and the perfect detection and research of Alzheimer disease, new detection site is provided for the diagnosis or treatment of the disease, and new detection method and approach, also a new target site is provided for the exploitation of target drug.

Description

A kind of relevant APOE mutated gene of Ahl tribulus sea silent sickness and its application

Technical field

This application involves gene field, more particularly to a kind of relevant APOE mutated gene of Ahl tribulus sea silent sickness and its Using.

Background technique

Alzheimer disease (Alzheimer ' s disease, abridge AD, is commonly called as senile dementia) is a kind of onset concealment Progress sexual development nervous system degenerative disease.Clinical early stage performance is mainly the decline of patient's memory and takes care of oneself The decline of ability eventually leads to and progressive cognition dysfunction and missing, neurobehavioral exception occurs, mental status and life occurs Self-care ability living completely loses, and the cause of disease is unknown.So far, Alzheimer disease gene studies finds beta amyloid precursor egg White (abbreviation APP), presenilin 1 and 2 (being abbreviated as PSEN1, PSEN2 respectively) totally 3 kinds of Disease-causing genes；Apo E is confirmed simultaneously (abbreviation APOE) allele is its important inherent cause.And the Alzheimer disease hereditary pattern of these gene-correlations is Autosomal dominant inheritance.Although having discovered that some mutation will lead to Alzheimer disease on these genes at present, It is that still there are many diseases because unknown.But on these genes or on other genes, however it remains it is many undiscovered or The mutation detected, this directly result in by existing detection method cannot accurately to the patient of doubtful illness whether illness into Row accurate judgement, for Alzheimer disease diagnosis, block heredity of the disease in family and target drug exploitation etc. all Have a significant impact.

Summary of the invention

The purpose of the application is to provide a kind of new relevant APOE mutated gene of Ahl tribulus sea silent sickness and the mutation The application of gene.

The application uses following technical scheme:

The one side of the application discloses a kind of relevant APOE mutated gene of Ahl tribulus sea silent sickness, which is mutated base The code area of reason wild type APOE gene occurs c.48G > A and is mutated.

Specifically, the sequence of the APOE mutated gene of the application is sequence shown in Seq ID No.1.

It should be noted that the application had found in a large amount of research and practice process it is a kind of newly and Alzheimer The relevant APOE mutated gene of disease, the APOE mutated gene be the code area of wild type APOE gene occur c.48G > A mutation and At that is, in the code area of wild type APOE gene, the 48th bit base is mutated by G for A.The mutation directly results in original coding color The codon mutation of propylhomoserin Trp can only finally encode the short more of 15 amino acid for terminator codon, i.e. APOE mutated gene Peptide, changes the structure and function of original polypeptide, and then leads to Alzheimer disease.

The another side of the application discloses a kind of relevant polypeptide of Ahl tribulus sea silent sickness, which is wild type APOE's Amino acid sequence occurs p.Trp16Ter and stops mutation.

Wherein, p.Trp16Ter stops mutation, that is, indicates in original polypeptide sequence that the 16th is tryptophan, is now become Terminator codon, i.e., all mutation lacks from the 16th amino acids in original polypeptide sequence, only remains the ammonia of front 15 Base acid.

Specifically, the polypeptide of the application is sequence shown in Seq ID No.2.

It should be noted that the polypeptide of the application, the actually polypeptide of the APOE mutated gene coding of the application, because This, the appearance or presence of the polypeptide are that direct Ahl tribulus sea silent sickness is relevant.

The another aspect of the application discloses the APOE mutated gene of the application or the polypeptide of the application in preparation A Erci Application in the silent sick detection reagent in sea, kit or equipment.

It is appreciated that the APOE mutated gene of the application is dashed forward as relevant cause a disease of a newfound Alzheimer disease Become gene, those skilled in the art can be prominent for the APOE of the application according to existing mutated gene detection method and technology Become gene order and design detection reagent, forms kit or special inspecting equipment, such as the APOE mutated gene for the application Sequence conventionally designs corresponding detection primer, fluorescence probe, gene recombination probe, padlock probe etc., to A Erci The silent disease in sea is detected.Likewise, the polypeptide of the application is also a kind of completely new substance, and presence and the A Erci of the polypeptide The silent disease in sea is directly related, and therefore, those skilled in the art can be according to existing protein or polypeptide detection methods, for this Shen Polypeptide design detection reagent please forms kit or special inspecting equipment.

The another aspect of the application discloses a kind of recombinant vector of APOE mutated gene containing the application.

The another aspect of the application discloses a kind of recombinant cell of recombinant vector containing the application.

It is appreciated that the APOE mutated gene of the application can be inserted into carrier, be made completely to study conveniently Recombinant vector, to facilitate subsequent research or detection.Specific carrier type can select, example according to research purpose difference Such as, as Alzheimer disease detection positive control when, carrier can choose conventional pMD18-T or pMD19-T etc.；As for The preparation method of recombinant vector can refer to the prior art.Likewise, recombinant cell is also for facilitating subsequent research or inspection It surveys, the recombinant vector of the mutated gene inserted with the application is imported, specific host cell species can be according to research mesh Difference and select, this is without limitation.

The another further aspect of the application discloses a kind of kit for detecting Alzheimer disease, includes detection in the kit The reagent of the APOE mutated gene of the application, and/or detect the reagent of the polypeptide of the application.

It preferably, further include the recombinant vector of the application in kit.

It preferably, further include the recombinant cell of the application in kit.

Preferably, in the kit of the application, the reagent for detecting the APOE mutated gene of the application includes that pair for amplification draws Object, the forward primer of the amplimer are sequence shown in Seq ID No.3, and reverse primer is sequence shown in Seq ID No.4,

Seq ID No.3:5 '-TGGTCAAAAGACCTCTATGC-3 '

Seq ID No.4:5 '-TGATAGTGACAACTCGTGGA-3 '.

It should be noted that the primer of sequence shown in sequence shown in Seq ID No.3 and Seq ID No.4, is for open country C.48G > A mutation occurs for the code area of raw type APOE gene, the design of this target site, i.e., includes in the amplified fragments of primer C.48G > A mutation；In a kind of implementation of the application, using shown in sequence shown in Seq ID No.3 and Seq ID No.4 After the DNA that the primer pair of sequence is extracted is expanded, by carrying out sequencing analysis to amplified production, it is determined whether exist c.48G > A therefore can be by the primer of sequence shown in sequence shown in Seq ID No.3 and Seq ID No.4 individually as detection A Er The kit of Ci Haimo disease.

It is appreciated that the reagent of the mutant gene sequence of detection the application is not only limited in sequence shown in Seq ID No.3 With the primer of sequence shown in Seq ID No.4, for the application c.48G > A be mutated, can be devised by more expand draw Object, it includes c.48G > A mutation primer that amplimer herein, which refers in particular to amplified fragments, is carried out by these amplimers to DNA After amplification, analyze amplified fragments in whether the mutation containing the application, thereby confirm that the mutated gene sequence with the presence or absence of the application Column.In addition it is also possible to for example glimmering in real time according to c.48G > A mutation design specific primer or specific probe, specific probe Light probe, gene recombination probe, padlock probe etc.；And sequencing is also not limited to for c.48G > A mutation confirmation method, may be used also To be confirmed by specific primer or specific probe to c.48G > A mutation；Certainly, sequencing is most direct, effective and quasi- True method.

The beneficial effects of the present application are as follows:

The APOE mutated gene of the application is the new relevant pathogenic mutation gene of one kind of Alzheimer disease, the APOE The discovery in mutated gene or pathogenic mutation site, is further expanded and the perfect detection and research of Alzheimer disease, for this The diagnosis or treatment of disease provide new detection site and new detection method and approach, are also the exploitation of target drug Provide a new target site.

Detailed description of the invention

Fig. 1 is located near c.48G > mutational site A in the embodiment of the present application in patients with Alzheimer disease sequencing result Sequencing peak figure.

Specific embodiment

Although having there is the related genes of some Alzheimer diseases to study and report at present, cause a disease base Cause or gene point mutation still have significant component of unknown；Therefore, the application carries out deeply to Alzheimer disease On the basis of entering research, it was found that c.48G > A occurs for a kind of gene of new mutation, the i.e. code area of wild type APOE gene prominent Raw mutated gene is sold of one's property, at present there is no document reports for the gene mutation.

The application is described in further detail below by specific embodiment.Following embodiment only to the application carry out into One step explanation, should not be construed as the limitation to the application.

Embodiment one

This example chooses a patients with Alzheimer disease, carries out exon sequencing to its blood sample；Exon sequencing is adopted With the BGI Exome V4Kit full exon trapping Kit of 59M, variance is obtained in conjunction with BGISEQ-500 high-flux sequence platform According to.Then by the filtering of the public databases such as dbSNP database, thousand human genome databases, HapMap database, remove institute There is known and variation of the gene frequency greater than 0.005 in the database；In combination with Alzheimer disease known Information removes same sense mutation and the variation of noncoding region, and carries out SNP function prediction using SIFT software, finally obtains 1 It may cause pathogenic gene mutation.It is specific as follows:

One, sample acquires

The peripheral blood sample of patient is extracted, complete genome DNA is extracted, this example uses OMEGA Blood DNA Midi Kit DNA extraction is carried out, specific steps include:

S11 takes 2mL peripheral blood sample, 150 μ L OB Protease, 2.1mL Buffer BL and 20 μ L RNase A to add Enter in EP pipe, after then thoroughly mixing within maximum speed whirlpool 1 minute；In 65 C water bath 15~20 minutes, and in water-bath Whirlpool 5 times in journey；

2.2mL dehydrated alcohol is added into EP pipe, maximum speed whirlpool 30 seconds, thoroughly mixes, is cracked, must be split by S12 Solve liquid；

3.5mL lysate is moved into the 15mL centrifuge tube with Filter column by S13, and 4000 turns are centrifuged 5 minutes, takes out Filter column, Filtering liquid is outwelled, Filter column is put back to；

The 15mL centrifuge tube with Filter column is added in step S12 residue lysate, 4000 turns are centrifuged 5 minutes, take out filtering Column outwells filtering liquid, puts back to Filter column.

3mL HB Buffer is added in S14, washs Filter column, and 4000 turns are centrifuged 5 minutes, takes out Filter column, outwells filtering Liquid puts back to Filter column；

3mL DNA Wash Buffer is added in S15, and 4000 turns are centrifuged 5 minutes, takes out Filter column, outwells filtering liquid, Put back to Filter column；

3mL DNA Wash Buffer is added in S16 again, and 4000 turns are centrifuged 5 minutes, takes out Filter column, outwells filtered fluid Body puts back to Filter column；4000 turns are centrifuged 15 minutes, dry Filter column；

Filter column is moved to new 15mL centrifuge tube by S17, and the Elution Buffer of 70 degrees Celsius of 500 μ L, room is added Temperature stands 5 minutes, and 4000 turns are centrifuged 5 minutes, collects the filtered fluid containing DNA；

Filter column is moved to new 15mL centrifuge tube by S18 again, and the Elution of 70 degrees Celsius of 500 μ L is added Buffer is stored at room temperature 5 minutes, and 4000 turns are centrifuged 5 minutes, collect the filtered fluid containing DNA；

Using the concentration and purity of spectrophotometer measurement DNA, the OD260/ of resulting each sample genomic DNA OD280 is respectively positioned between 1.7-2.0, and concentration is no less than 200ng/ μ L, and total amount is no less than 30 μ g.

Two, exon trapping and sequencing

This example carries out exon trapping using the full exon trapping Kit of BGI Exome V4 Kit 59M, specifically includes:

Genome DNA sample is interrupted at random using ultrasonic wave high-performance sample processing system (Covaris), is passed through The segment of 150bp-250bp or so is obtained after Piece Selection.Then carry out the reparation of DNA fragmentation end, 3 ' ends plus " A " base, two End adds library connector.Library after connector connection carries out linear amplification (LM-PCR) and is prepared into Hybrid Library.Wherein, library connects Head uses the sequence measuring joints of BGISEQ-500 high-flux sequence platform, the specific reactant that end is repaired plus " A " is connected with connector The library construction of system and conditioned reference routine, is not specifically limited herein.

The Hybrid Library of preparation and 59Mb Exon chip BGI Exome V4 Kit are subjected to capture enrichment, washed away not It is expanded after the segment of enrichment.Amplified production carries out single-stranded separation and cyclisation processing, and rolling-circle replication is passed through in cyclisation library (rolling circle amplification, abridge RCA) generates DNA nanosphere (DNA Nano Ball, abridge DNB), matter Upper machine sequencing after control is qualified.Wherein, the specific method of chip capture enrichment refers to kit specification.Single-stranded separation, cyclisation, rolling Circle amplification is not specifically limited herein with reference to conventional DNB nanosphere preparation method.

Three, exon is sequenced

This example is sequenced exon trapping product using BGISEQ-500 high-flux sequence platform, specifically includes:

BGISEQ-500 is using the joint probe anchoring polymerization technique (abbreviation cPAS) of optimization and improved DNA nanosphere (abbreviation DNB) core sequencing technologies.DNA molecular anchor and fluorescence probe are polymerize on nanosphere first, subsequent high-resolution Imaging system is acquired optical signal, and optical signal can be obtained sequence to be measured after digitized processing.Wherein, DNB passes through Linear amplification enhances signal, reduces the error rate singly copied.Moreover, DNB size and the size of active site on chip match, Each site combines a DNA nanosphere, in the utilization efficiency for guaranteeing to improve sequence testing chip in the case where precision is sequenced.Using Advanced semiconductor precise machining process forms binding site array in silicon chip surface, realizes the regularly arranged suction of DNA nanosphere It is attached.Obtained raw image data is sequenced, is converted into original sequence data (raw through base identification software (Base Calling) Reads), data are with FASTQ stored in file format.

Four, sequencing data and analysis

After obtaining final sequencing result, variation data are obtained by BGISEQ-500 high-flux sequence platform.Then By the filtering of the public databases such as dbSNP database, thousand human genome databases, HapMap database, remove all known And in the database gene frequency be greater than 0.005 variation.In combination with Alzheimer's disease known information, remove Same sense mutation and the variation of noncoding region, and SNP function prediction is carried out using SIFT software, finally obtaining 1 may cause Pathogenic gene mutation.

The network address of dbSNP database are as follows:

http://hgdownload.cse.ucsc.edu/goldenPath/hg19/database/ snp132.txt.gz.

HapMap database network address are as follows: ftp: //ftp.ncbi.nlm.nih.gov/hapmap

Thousand human genome database network address are as follows: ftp: //ftp.1000genomes.ebi.ac.uk/vol1/ftp

Patient is obtained as a result, and there is mutation c.48G > A in the gene coding region APOE, is heterozygote, is tentatively judged patient C.48G > A mutation is the pathogenic sites of its Alzheimer disease on the gene coding region APOE.According to sequencing result, the mutation base The nucleic acid sequence of cause is sequence shown in Seq ID No.1, and the 48th bit base is A base by the G base mutation of wild type, so that The codon mutation of original coding tryptophan Trp is for terminator codon；That is, the Seq ID No.1 institute that mutation obtains Show that the gene translation of sequence has obtained a new amino acid polypeptide, sequence shown in the polypeptide, that is, Seq ID No.2.Abrupt information As shown in table 1.

Seq ID No.1:

5’-ATGAGCTCAGGGGCCTCTAGAAAGAGCTGGGACCCTGGGAACCCCTGACCTCCAGACTGGCCAATC ACAGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGAGCA AGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCAC TGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAG GTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACA ACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGG ACATGGAGGACGTGTGCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAG CTGCGGGTGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCG CCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGGCCCC TGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCC TGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGCCGGACC-3’。

In sequence shown in Seq ID No.1, the 48th bit base is mutated for A, and the 48th alkali of wild type APOE gene Base is G.

Seq ID No.2:

MSSGASRKSWDPGNP

Sequence shown in Seq ID No.2 only remains preceding 15 amino acids of original wild type APOE gene coding polypeptide, 16th amino acids are originally used for tryptophan, but have become terminator codon after being mutated.

1 APOE mutated gene of table

Embodiment two

The Alzheimer disease pathogenic gene APOE that this example is measured according to embodiment one c.48G > A heterozygous mutant, design is special Specific primer is carried out PCR amplification, and the authenticity for determining the mutation is sequenced using Sanger, specific as follows:

The primer sequence of this example design is as follows:

Upstream primer:

Seq ID No.3:5 '-TGGTCAAAAGACCTCTATGC-3 '

Downstream primer:

Seq ID No.4:5 '-TGATAGTGACAACTCGTGGA-3 '.

Using the specific primer of design, PCR amplification is carried out to the complete genome DNA of the patient of extraction, is then carried out Sanger sequence verification.DNA extracts reference implementation example one, resulting every using the concentration and purity of spectrophotometer measurement DNA The OD260/OD280 of a sample genomic DNA is respectively positioned between 1.7-2.0, and concentration is no less than 200ng/ μ L, and total amount is no less than 30 μg。

Pcr amplification reaction system are as follows: the Ex of 10 × Ex Taq Buffer, 2.5 μ L, the 2 μ L of dNTPs of 10mM, 5U/ μ L 0.15 μ L of Taq enzyme, 1 μ L of Primers of 100ng/ μ L, 1 μ L of DNA profiling supplement ddH₂O to 25 μ L.

PCR reaction condition are as follows: 95 DEG C of initial denaturation 5min；Then it carries out 30 " denaturation, extends annealing " to recycle: 95 DEG C 30s,55℃30s,72℃30s；72 DEG C of extension 7min after circulation terminates, 4 DEG C standby.

Before pcr amplification product is sequenced, purification process is first carried out, is specifically included, configured digestive juice, take shrimp alkali enzyme respectively It is mixed with excision enzyme 1:1.After PCR product centrifugation, the 1 above digestive juice of μ L is added in each hole into PCR reaction solution；By above-mentioned production PCR instrument carries out program reaction: 37 DEG C of 60min, 80 DEG C of 15min, 4 DEG C of preservations on object.

Sanger is sequenced

(1) configure SEQ MIX system: PCR product template 1 μ L, BigDye 4 μ L, 3.2pmol/ μ L 1 μ L of primer, go from Sub- 4 μ L of aqua sterilisa.

PCR cycle condition: 96 DEG C of 1min is sequenced, recycle subsequently into 25: 96 DEG C of 10s, 50 DEG C of 5s, 60 DEG C of 4min are followed After ring, 4 DEG C of preservations.

(2) product purification is sequenced: after the centrifugation of sequencing reaction plate, 1 μ L 125Mm EDTA, 1 μ L 3M is added in each reacting hole NaAc solution, 25 μ L of dehydrated alcohol, fullys shake 3min, is placed at room temperature for 15min；4300rpm is centrifuged 30min, is inverted 384 immediately Orifice plate centrifugation removes alcohol until 300rpm stops；35 μ L, 70% alcohol, 4 DEG C of 4300rpm centrifugations are added in every reacting hole 15min is inverted the centrifugation of 384 orifice plates immediately, until 300rpm stops, removing alcohol；It repeats 70% ethanol wash 1 time；Allow remnants' Alcohol is dry in room temperature volatilization, and 10 μ L Hi-Di formamides, 95 DEG C of denaturation 4min, rapid 4 ice-cold 4min are added.

(3) machine is sequenced on: after denaturation, upper sequenator ABI 3730 is sequenced.

The Sanger of pcr amplification product is sequenced, the results show that compared with standard APOE gene order c.48G patient occurs > A heterozygous mutant, the mutation are the pathogenic mutations for causing Alzheimer disease, and c.48G > A mutated site part sequencing peak figure is as schemed Shown in 1.

The foregoing is a further detailed description of the present application in conjunction with specific implementation manners, and it cannot be said that this Shen Specific implementation please is only limited to these instructions.For those of ordinary skill in the art to which this application belongs, it is not taking off Under the premise of from the application design, a number of simple deductions or replacements can also be made, all shall be regarded as belonging to the protection of the application Range.

SEQUENCE LISTING

<110>BGI-Shenzhen

<120>a kind of relevant APOE mutated gene of Ahl tribulus sea silent sickness and its application

<130> 17I24715

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 807

<212> DNA

<213>APOE is mutated Disease-causing gene

<400> 1

atgagctcag gggcctctag aaagagctgg gaccctggga acccctgacc tccagactgg 60

ccaatcacag gcaggaagat gaaggttctg tgggctgcgt tgctggtcac attcctggca 120

ggatgccagg ccaaggtgga gcaagcggtg gagacagagc cggagcccga gctgcgccag 180

cagaccgagt ggcagagcgg ccagcgctgg gaactggcac tgggtcgctt ttgggattac 240

ctgcgctggg tgcagacact gtctgagcag gtgcaggagg agctgctcag ctcccaggtc 300

acccaggaac tgagggcgct gatggacgag accatgaagg agttgaaggc ctacaaatcg 360

gaactggagg aacaactgac cccggtggcg gaggagacgc gggcacggct gtccaaggag 420

ctgcaggcgg cgcaggcccg gctgggcgcg gacatggagg acgtgtgcgg ccgcctggtg 480

cagtaccgcg gcgaggtgca ggccatgctc ggccagagca ccgaggagct gcgggtgcgc 540

ctcgcctccc acctgcgcaa gctgcgtaag cggctcctcc gcgatgccga tgacctgcag 600

aagcgcctgg cagtgtacca ggccggggcc cgcgagggcg ccgagcgcgg cctcagcgcc 660

atccgcgagc gcctggggcc cctggtggaa cagggccgcg tgcgggccgc cactgtgggc 720

tccctggccg gccagccgct acaggagcgg gcccaggcct ggggcgagcg gctgcgcgcg 780

cggatggagg agatgggcag ccggacc 807

<210> 2

<211> 15

<212> PRT

<213>APOE is mutated Disease-causing gene and encodes polypeptide

<400> 2

Met Ser Ser Gly Ala Ser Arg Lys Ser Trp Asp Pro Gly Asn Pro

1 5 10 15

<210> 3

<211> 20

<212> DNA

<213>artificial sequence

<400> 3

tggtcaaaag acctctatgc 20

<210> 4

<211> 20

<212> DNA

<213>artificial sequence

<400> 4

tgatagtgac aactcgtgga 20

Claims (10)

1. a kind of relevant APOE mutated gene of Ahl tribulus sea silent sickness, it is characterised in that: the APOE mutated gene is by wild The code area of type APOE gene occurs c.48G > A and is mutated.

2. APOE mutated gene according to claim 1, it is characterised in that: the APOE mutated gene is Seq ID Sequence shown in No.1.

3. a kind of relevant polypeptide of Ahl tribulus sea silent sickness, it is characterised in that: the polypeptide is the amino acid sequence of wild type APOE Column occur p.Trp16Ter and stop mutation.

4. polypeptide according to claim 3, it is characterised in that: the polypeptide is sequence shown in Seq ID No.2.

5. polypeptide described in APOE mutated gene according to claim 1 or 2 or claim 3 or 4, in preparation Ah Application in Alzheimer's disease detection reagent, kit or equipment.

6. a kind of recombinant vector containing APOE mutated gene of any of claims 1 or 2.

7. a kind of recombinant cell containing recombinant vector as claimed in claim 6.

8. it is a kind of detect Alzheimer disease kit, it is characterised in that: in the kit include detection claim 1 or The reagent of APOE mutated gene described in 2, and/or the reagent of polypeptide described in detection claim 3 or 4.

9. kit according to claim 8, it is characterised in that: further include as claimed in claim 6 in the kit Recombinant vector or recombinant cell as claimed in claim 7.

10. kit according to claim 8, it is characterised in that: APOE described in the detection as claimed in claim 1 or 22 is prominent The reagent for becoming gene includes pair for amplification primer, and the forward primer of the amplimer is sequence shown in Seq ID No.3, reversely Primer is sequence shown in Seq ID No.4,

Seq ID No.3:5 '-TGGTCAAAAGACCTCTATGC-3 '

Seq ID No.4:5 '-TGATAGTGACAACTCGTGGA-3 '.