CN109385425A - A kind of high specific ABE base editing system and its application in β hemoglobinopathy - Google Patents

A kind of high specific ABE base editing system and its application in β hemoglobinopathy Download PDF

Info

Publication number
CN109385425A
CN109385425A CN201811345987.5A CN201811345987A CN109385425A CN 109385425 A CN109385425 A CN 109385425A CN 201811345987 A CN201811345987 A CN 201811345987A CN 109385425 A CN109385425 A CN 109385425A
Authority
CN
China
Prior art keywords
tada
sequence
grna
leu
lys
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201811345987.5A
Other languages
Chinese (zh)
Inventor
松阳洲
梁普平
黄军就
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sun Yat Sen University
Original Assignee
Sun Yat Sen University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sun Yat Sen University filed Critical Sun Yat Sen University
Priority to CN201811345987.5A priority Critical patent/CN109385425A/en
Publication of CN109385425A publication Critical patent/CN109385425A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06—Antianaemics
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4717—Plasma globulins, lactoglobulin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention provides a kind of ABE base editing systems of efficiently targeting HBG1 and HBG2 promoter region, it can be used for treating β hemoglobinopathy, the system comprises the high specific gRNA of a variety of special target HBG gene promoter regions, it will be in the body cell of the system introducing to people, it is catalyzed adenine (Adenine at target site, A) to guanine (Guanine, G displacement), the expression for improving HBG1 and HBG2, to treat β hemoglobinopathy (such as β-thalassemia, sickle cell anemia disease).The technology is with a wide range of applications in β hemoglobinopathy field of gene.

Description

A kind of high specific ABE base editing system and its application in β hemoglobinopathy
Technical field
The present invention relates to gene modification field, more particularly, to a kind of high specific ABE base editing system and its Gene editing, gene therapy, the application especially in the treatment of β hemoglobinopathy.
Background technique
β hemoglobinopathy is the genetic disease as caused by red blood cell hyperglobulinemia resulting anomaly, mainly includes that the Mediterranean β is poor Blood and sickle cell anemia.The hyperglobulinemia of adult includes Hb A2 (2.5%), Hb F (0.5%) and Hb A1 (97%) three types.Wherein the maximum HbA1 albumen of accounting is made of 2 alpha globulin subunits and two beta Globulin subunits. HbF albumen is made of 2 alpha globulin subunits and two gamma Globulin subunits.It is by hyperglobulinemia β by wherein β hemoglobinopathy A kind of common monogenic inheritance disease caused by Globulin is mutated, encoding gene are HBB (human β globin).γ Globulin is by two gene codings of HBG1 and HBG2.Clinical research discovery, HbF high expression can alleviate beta Thalassemia With the symptom of sickle cell anemia.So the expression for improving HbF becomes one of the treatment method for the treatment of β hemoglobinopathy. Forefathers' the study found that will be located at the GTGTGGGG in HBG1 and HBG2 promoter regionAAA in GGGGCCCCCAAG sequence (underscore mark) is mutated into G, and expression (Wienert, B.et the al.KLF1drives the of gamma Globulin can be improved expression of fetal hemoglobin in British HPFH.Blood 130,803-807(2017))。
ABE base editing system is grouped as by TadA:TadA*:Cas9 fusion protein and gRNA two parts group.? Under the guidance of gRNA,
TadA:TadA*:Cas9 fusion protein can be in conjunction with the target site on DNA, wherein the DNA chain complementary with gRNA It can be cut off by Cas9 nuclease, rather than 4-9 A bases then can be by adenine deaminase on complementary strand --- TadA albumen --- It is catalyzed deamination and forms I base.With the duplication of DNA, I (hypoxanthine, Inosine) base can by G (guanine, Guanine) base substitutes, to realize the base replacement of A to G.
2017, the David Liu group of Harvard University was found, was using ABE base editing system combination boot sequence The gRNA (being named as HBG-GX19gRNA, SEQ ID NO.6) of GUGGGGAAGGGGCCCCCAAG can be incited somebody to action GTGTGGGGAAA (underscore mark) in GGGGCCCCCAAG sequence is mutated into G.Extract the candidate stem cell of patient itself (Hematopoietic stem cell, HSC) or bone marrow cell utilize adenine base editing system editor HBG1 and HBG2 Promoter region, then can accurately change the promoter sequence of HBG1 and HBG2 on protogene seat, improve the table of HBG1 and HBG2 It reaches, this method has the characteristics that high-efficient, highly-safe.The HSC of mutation repair is fed back to patient, then it is blood red to treat β Albumen patient.
But ours the study found that David Liu group provide HBG-GX19gRNA (SEQ ID NO.6) and ABE alkali Base editing system has undershooting-effect.Therefore, it is necessary to provide a kind of gRNA and ABE base editing system with more high specific The promoter region of HBG1 and HBG2 are edited, to raise the expression of gamma Globulin, improves the level of HbF, so that it is blood red to treat β Albumen disease.
Summary of the invention
The purpose of the present invention is have to miss the target for the ABE base editing system of above-mentioned targeting HBG1 and HBG2 promoter region Effect, and provide a kind of gRNA with more high specific and the ABE base editing system of higher editorial efficiency, the present invention mention The ABE base editing system of confession is improved by the promoter region of editor HBG1 and HBG2 with raising the expression of gamma Globulin The level of HbF, to treat β hemoglobinopathy.In a specific embodiment of the invention, the present invention passes through the length for changing gRNA Degree develops HBG-GGX20 (SEQ ID NO.1), HBG-GX20 (SEQ ID NO.2), HBG- with more high specific GX17 (SEQ ID NO.3) and HBG-GX16 (SEQ ID NO.4), and by itself and TadA:TadA*:Cas9 fusion protein ABE alkali Base editing system combination, specifically by the GTGTGGGG in HBG1 and HBG2 promoter regionAAA in GGGGCCCCCAAG sequence (underscore mark) is mutated into G, to treat β hemoglobinopathy.
Above-mentioned purpose of the present invention is achieved through the following technical solutions:
In a first aspect, the present invention provides a kind of gRNA for targeting HBG1 and HBG2 promoter region, the gRNA sequence Nucleotide sequence include at least one of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4.
In one specific embodiment of first aspect present invention, the gRNA sequence further includes frame sequence, wherein gRNA Frame sequence are as follows: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAA AAGUGGCAC CGAGUCGGUGCUUUUUU(SEQ ID NO.7)。
It is understood that SEQ ID NO.1 of the present invention, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 institute Show that gRNA sequence is gRNA boot sequence, SEQ ID NO.7 of the present invention is a specific example, does not limit present invention protection model It encloses, those skilled in the art can should be included in the scope of the present invention as needed using other substitution frame sequences.
Second aspect, the present invention provides a kind of ABE base editor systems of targeting editor HBG1 and HBG2 promoter region System, the ABE base editing system includes TadA:TadA*:Cas9 fusion protein, further includes targeting HBG1 and HBG2 promoter The gRNA in region, the nucleotide sequence of the gRNA sequence include SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, At least one of SEQ ID NO.4.
In one specific embodiment of second aspect of the present invention, the TadA:TadA*:Cas9 fusion protein includes CRISPR/ Effect protein structural domain, the adenosine deaminase structural domain of Cas system.
In one specific embodiment of second aspect of the present invention, the TadA:TadA*:Cas9 fusion protein includes CRISPR/ Effect protein structural domain, connecting peptides, the adenosine deaminase structural domain of Cas system.
It will be appreciated by persons skilled in the art that TadA:TadA*:Cas9 fusion protein of the present invention is by Cas9 Effect protein is merged with adenosine deaminase (abbreviation TadA albumen), and those skilled in the art can according to need, and utilize one One Cas9 effect protein structural domain and one or more TadA albumen are attached, are melted by item or a plurality of connecting peptides Hop protein, in a specific embodiment of the invention, the TadA albumen is repeated once.It is understood that the Cas9 effect The order of connection of the N-terminal and C-terminal of answering albumen and TadA albumen is this field routine techniques, and connecting peptides include but is not limited to ability The connecting peptides segment of domain routine, typically, such as GS linker.
It will be appreciated by persons skilled in the art that TadA is adenosine deaminase in TadA:TadA*:Cas9 fusion protein Abbreviation, TadA* be TadA mutant abbreviation, Cas9 be CRISPR/Cas system Cas9 effect protein.
Further, in the effect protein structural domain of the CRISPR/Cas system, the Cas9 effect protein include but It is not limited to no cleavage activity or only with the Cas Protein S treptococcus pyogenes Cas9 of single-stranded cleavage activity (SpCas9),Staphylococcus aureus Cas9(SaCas9),Lachnospiraceae Cpf1(LbCpf1), Acidaminococcus Cpf1(AsCpf1),Streptococcus thermophilus Cas9(StCas9),and Neisseria meningitidis Cas9 (NmCas9) and Francisella Cpf1 (FnCpf1) etc..
In one specific embodiment of second aspect of the present invention, the amino acid sequence of the TadA:TadA*:Cas9 fusion protein Be classified as amino acid at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, 99% shown in SEQ ID NO.5 or 99.5% consistent sequence.
In one specific embodiment of second aspect of the present invention, the TadA:TadA*:Cas9 fusion protein can also be merged Other protein, protein domain or protein fragments, the protein, protein domain or protein fragments include But be not limited to following 1) -5) one of or it is a variety of:
1) maltose-binding protein (MBP), S-tag, Lex A DNA binding structural domain (DBD) fusions, GAL4DNA knot Close structural domain fusions and herpes simplex virus (HSV) BP16 protein fusions；
2) molecular labeling can be used to identify the position of target sequence using the TadA:TadA*:Cas9 fusion protein of label；
3) epitope tag, the non-limiting example of the epitope tag include histidine (His) label, V5 label, FLAG Label, influenza virus hemagglutinin (HA) label, Myc label, VSV-G label and thioredoxin (Trx) label；
4) reporter gene, the example of the reporter gene include, but are not limited to glutathione-S-transferase (GST), peppery Root peroxidase (HRP), chloramphenicol acetyltransferase (CAT), beta galactosidase, β-glucuronidase, luciferin Enzyme, green fluorescent protein (GFP), HcRed, DsRed, green fluorescin (CFP), yellow fluorescence protein (YFP), to include blue The autofluorescence albumen of fluorescin (BFP)；
5) and with one or more following active protein domain: methyl enzymatic activity, hepatic Microsomal Aniline Hydroxylase, Transcriptional activation activity, transcription repression activity, transcription releasing factor activity, histone modification activity, RNA cleavage activity and nucleic acid knot Close activity.
It is understood that term " polypeptide ", " peptide " and " protein " or " protein fragments " interchangeably make herein With referring to the polymer of the amino acid with any length.The polymer can be linear chain or branched chain, it can wrap Amino acid containing modification, and it can be interrupted by non-amino acid.These terms also cover the amino acid polymerization being modified Object；These modification for example disulfide bond formation, glycosylation, esterification (lipidation), acetylation, phosphorylation or any other repair Decorations, such as and the combination of detection molecules labeling component.
In one specific embodiment of second aspect of the present invention, the gRNA sequence further includes frame sequence, wherein gRNA Frame sequence are as follows: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAA AAGUGGCAC CGAGUCGGUGCUUUUUU(SEQ ID NO.7)。
It is understood that SEQ ID NO.1 of the present invention, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 institute Show that gRNA sequence is gRNA boot sequence, SEQ ID NO.7 of the present invention is a specific example, does not limit present invention protection model It encloses, those skilled in the art can should be included in the scope of the present invention as needed using other substitution frame sequences.
In one specific embodiment of second aspect of the present invention, the gRNA can be expressed by carrier, be transcribed in vitro, be changed Be synthetically prepared, and the gRNA may also pass through chemical modification, to improve its editorial efficiency, specificity, safety etc..
The third aspect, the present invention provides a kind of non-naturally occurring or engineering composition, the composition is such as Lower 1) -6) one of or a variety of:
1) include one or more carriers, which includes component I and component II:
The component I includes the first regulating element, and the coding being operably connected with first regulating element is such as The coded sequence of TadA:TadA*:Cas9 fusion protein described in second aspect；The component II includes the second regulating element, with And the coded sequence of gRNA of the coding being operably connected with second regulating element as described in second aspect；Wherein, group I and II is divided to be located on identical or different carrier；
2) mRNA and carrier comprising the TadA:TadA*:Cas9 fusion protein as described in second aspect, the carrier Including the second regulating element, and the gRNA encoded as described in second aspect being operably connected with second regulating element Coded sequence；
3) albumen and carrier comprising the TadA:TadA*:Cas9 fusion protein as described in second aspect, the carrier Including the second regulating element, and the gRNA encoded as described in second aspect being operably connected with second regulating element Coded sequence；
4) expression vector and such as second aspect comprising the TadA:TadA*:Cas9 fusion protein as described in second aspect The gRNA；
5) mRNA comprising TadA:TadA*:Cas9 fusion protein as described in second aspect and as described in second aspect GRNA；
6) albumen comprising TadA:TadA*:Cas9 fusion protein as described in second aspect and as described in second aspect GRNA.
It will be appreciated by persons skilled in the art that in composition described in the third aspect, TadA:TadA*:Cas9 fusion Albumen can be DNA, the form of RNA or albumen；GRNA can be the form of DNA or RNA.Third aspect present invention is suitable Under the conditions of TadA:TadA*:Cas9 fusion protein or directly offer TadA:TadA*:Cas9 fusion protein and suitable are provided Under the conditions of transcribe gRNA or directly provide gRNA.The suitable condition can be intracellular or in-vitro transcription/translation system.
In third aspect present invention embodiment, term " carrier " refers to a kind of nucleic acid molecules, it can be transported and it Another nucleic acid molecules of connection.Carrier includes but is not limited to single-stranded, double-strand or partially double stranded nucleic acid molecules；Including one Or multiple free ends, the nucleic acid molecules without free end (such as cricoid)；Nucleic acid molecules including DNA, RNA, or both；And Other diversified polynucleotides known in the art.Optionally, a type of carrier is " plasmid ", refers to and wherein may be used To be for example inserted into the circular double stranded DNA ring of other DNA fragmentation by standard molecule clone technology.Optionally, another seed type Carrier be viral vectors, wherein DNA or RNA sequence derived from virus are present in for packaging virus (for example, reverse transcription disease Poison, replication defect type retrovirus, adenovirus, replication-defective adenoviral and adeno-associated virus) carrier in.Virus Carrier also includes the polynucleotides carried by the virus for being transfected into a kind of host cell.Certain carriers are (for example, have thin The bacteria carrier and episomal mammalian vectors of bacterium replication orgin) it can be independently multiple in their imported host cells System.Other carriers (for example, non-add type mammalian vector) are integrated into the gene of the host cell after introducing host cell In group, and thus replicated together with the host genome.Moreover, the gene that certain carriers can instruct them to be operatively connected Expression.Such carrier is referred to herein as " expression vector ".Carrying agent, which is commonly expressed, used in the recombinant DNA technology is usually Plasmid form.
In general, " being operably connected " is intended to indicate that nucleotide sequence allows the nucleotide sequence with a kind of in carrier The mode of expression be connected to one or more regulating elements (optionally, carrier be in a kind of in-vitro transcription/translation system The nucleotide sequence can be expressed；Optionally, the nucleotides sequence can be expressed when the carrier is introduced in host cell Column).
In third aspect present invention embodiment, term " expression ", which refers to from DNA profiling, is transcribed into polynucleotides (as turned Record into mRNA or other RNA transcripts) process and/or the mRNA of transcription then translate into the process of peptide, polypeptide or protein. The polypeptide of transcript and coding can collectively referred to as " gene product ".If polynucleotides derive from genomic DNA, expression be can wrap Include the montage of mRNA in eukaryocyte.
Terms used herein " non-naturally occurring " or " engineering " are interchangeably used, when referring to nucleic acid molecules or more When peptide, indicate that the nucleic acid molecules or polypeptide are found in tying in nature with it at least substantially from them in nature or such as At least another component separate out closed.
In third aspect present invention preferred embodiment, first regulating element is (in an embodiment of the present invention, " regulating element " of the present invention can be understood as " expression casette ") include one or more pol III promoter (such as 2,3,4,5, or more 1, pol III promoter), one or more pol II promoter (such as 1,2,3,4,5, or more A pol II promoter), one or more pol I promoter (such as 1,2,3,4,5, or more pol I promoter) or its Combination.In addition, the first regulating element can also be T7 promoter, Sp6 promoter etc..The example of pol III promoter include but It is not limited to U6 and H1 promoter.The example of pol II promoter includes but is not limited to that reverse transcription Rous sarcoma virus (RSV) LTR is opened Mover (optionally with RSV enhancer), cytomegalovirus (CMV) promoter (optionally having cmv enhancer) are [referring to example Such as, wave Saudi Arabia (Boshart) et al., " cell " (Cell) 41:521-530 (1985)], SV40 promoter, dihydrofolate reduction Enzyme promoters, beta-actin promoter, phosphoglycerokinase (PGK) promoter and EF1 α promoter.
In some embodiments of third aspect present invention, albumen coded sequence is through codon optimization, so as to specific It is expressed in cell such as eukaryocyte.These eukaryocytes can be those of particular organisms or from particular organisms, such as lactation Animal, including but not limited to people, mouse, rat, rabbit, dog or non-human primate.In general, codon optimization refers to The codon more frequently or most frequently used in gene by being used in host cell replaces at least the one of native sequences A codon (for example, about or more than about 1,2,3,4,5,10,15,20,25,50, or more codon maintain the day simultaneously Right amino acid sequence and modify a nucleic acid sequence to enhance the method for the expression in host cell interested.Different objects Kind shows specific preference for certain codons with specific amino acids.Codon preference is (close between biology The difference that numeral uses) it is often related to the translation efficiency of mRNA (mRNA), and the translation efficiency is then considered depending on (except other things) availability of the property for the codon being translated and specific transfer RNA (tRNA) molecule.It is intracellular selected The advantage of tRNA generally reflect the codon for being used most frequently for peptide synthesis.Therefore, gene can be customized to be based on password Best gene expression of the son optimization in given biology.Codon usage table can be readily available, such as be made in codon With in database (" Codon Usage Database "), and these tables can be adjusted by different modes it is applicable.Referring to, Middle village Y. (Nakamura Y.) et al., " codon tabulated from international DNA sequence data library uses: state in 2000 " (Codon usage tabulated from the international DNA sequence databases:status For the year 2000) " nucleic acids research " (Nucl.Acids Res.) 28:292 (2000).For codon optimization spy Fixed ordered series of numbers so as to the computerized algorithm expressed in specific host cell be also it is available, as gene manufacture (Gene Forge) (Aptagen company；Chris Jacobs (Jacobus), PA) and it is available.In some embodiments, it is encoding In the sequence of CRISPR enzyme one or more codons (such as 1,2,3,4,5,10,15,20,25,50, or more or All codons) correspond to the codon most frequently used for specific amino acids.
In a preferred embodiment of this invention, second regulating element includes but is not limited to one or more pol II promoter (such as 1,2,3,4,5, or more pol II promoter), one or more pol I promoter (such as 1,2,3, 5, or more 4, pol I promoter), or combinations thereof, pol III promoter (including but not limited to U6, H1 promoter), T7 Promoter, Sp6 promoter etc..
In a preferred embodiment of this invention, described first or two regulating element further include enhancer, internal ribosome Entry site (IRES) and other expression control elements (such as transcription stop signals, such as polyadenylation signal and poly U Sequence).Such adjusting sequence is for example described in Gaston Godel (Goeddel), " gene expression technique: Enzymology method " (GENE EXPRESSION TECHNOLOGY:METHODS IN ENZYMOLOGY) 185, academic press (Academic Press) is holy Ground Asia brother (San Diego), in California (1990).Regulating element includes that one nucleotides sequence of guidance is listed in many classes Those of constitutive expression in the host cell of type sequence and instruct the nucleotide sequence only in certain host cells table Up to those of sequence (for example, organizing specific type adjust sequence).Tissue-specific promoter can be instructed mainly in the interested phase Hope the expression in tissue, the tissue such as muscle, neuron, bone, skin, blood, specific organ (such as liver, pancreas Gland) or special cell type (such as lymphocyte).Regulating element can be in a manner of Temporal dependency (such as with the cell cycle Dependence or stage of development dependence mode) guidance expression, which may or may not be that tissue or cell type are special Anisotropic.
In a preferred embodiment of this invention, second regulating element is T7 promoter.
In a preferred embodiment of this invention, described first or two regulating element further include enhancer, internal ribosome Entry site (IRES) and other expression control elements (such as transcription stop signals, such as polyadenylation signal and poly U Sequence).Such adjusting sequence is for example described in Gaston Godel (Goeddel), " gene expression technique: Enzymology method " (GENE EXPRESSION TECHNOLOGY:METHODS IN ENZYMOLOGY) 185, academic press (Academic Press) is holy Ground Asia brother (San Diego), in California (1990).Regulating element includes that one nucleotides sequence of guidance is listed in many classes Those of constitutive expression in the host cell of type sequence and instruct the nucleotide sequence only in certain host cells table Up to those of sequence (for example, organizing specific type adjust sequence).Tissue-specific promoter can be instructed mainly in the interested phase Hope the expression in tissue, the tissue such as muscle, neuron, bone, skin, blood, specific organ (such as liver, pancreas Gland) or special cell type (such as lymphocyte).Regulating element can be in a manner of Temporal dependency (such as with the cell cycle Dependence or stage of development dependence mode) guidance expression, which may or may not be that tissue or cell type are special Anisotropic.
Fourth aspect present invention provides a kind of for starting in body cell, human body internal specific human editor HBG1 and HBG2 The method of subregion, the method includes groups described in ABE base editing system described in delivering second aspect or the third aspect Object is closed, keeps the gene order of the ABE base editing system or composition and people's HBG1 and HBG2 promoter region close, obtains Obtain people's HBG1 and HBG2 promoter gene by editor.
In embodiments of the present invention, term " makes the ABE base editing system (base editing system) or composition It is close with the gene order of people's HBG1 and HBG2 promoter region " refer to component is delivered in vitro (in vitro) or in vivo In (in vivo) environment, ex vivo environment such as those skilled in the art reaction solution that demand configures according to specific experiments, internal ring Border is such as intracellular；The term " close " refers in vitro (in vitro) or in vivo (in vivo) environment, each component It can be contacted with the gene order of people's HBG1 and HBG2 promoter region, and those skilled in the art occur under certain conditions The reaction being anticipated that.
In an embodiment of the present invention, the present invention provides following methods, including into cell, human body deliver one or Multiple polynucleotides, one or more carriers, one or more transcripts, and/or the albumen of one or more transcriptions.Some Aspect, invention further provides the cells generated by such method.
In an embodiment of the present invention, the ABE base editing system compound compound with gRNA is delivered to cell, people In vivo.Can be used the gene transfer method of conventional virus and non-viral base by base editing system described in second aspect or Composition described in the third aspect introduces the cell of people, in human body.
Cell of such method into cell culture or individual can be used and give composition described in the third aspect. Non-virus carrier delivery system include DNA plasmid, RNA (such as transcript of carrier described herein), albumen, naked nucleic acid and The compound nucleic acid with Delivery excipient (such as liposome).Viral vector delivery system includes DNA and RNA virus, is being delivered to They have sequestered or integrated genome after cell.About the summary of genes delivery system, referring to peace moral (Anderson), " science " (Science) 256:808-813 (1992)；Receive Bell (Nabel) Fil Ge Na (Felgner), TIBTECH 11: 211-217(1993)；Three paddy (Mitani) Ka Siji (Caskey), TIBTECH11:162-166 (1993)；Di Long (Dillon), (1993) TIBTECH 11:167-175；Miller (Miller), " nature " (Nature) 357:455-460 (1992)；Fan Bulangte (Van Brunt), " biotechnology " (Biotechnology) 6 (10): 1149-1154 (1988)； Wei Nie (Vigne), " restoring neurology and Neuscience " (Restorative Neurology and Neurosciece) 8: 35-36(1995)；Silent (Kremer) the & Perry Coudé of Cray is special (Perricaudet), " British Medical bulletin " (British Medical Bulletin)51(1):31-44(1995)；It breathes out clatter clatter (Haddada) et al., " microbiology and immunology are worked as Preceding theme " Dorr husband strangles (Doerfler) and wins in (Current Topics in Microbiologyand Immunology) Nurse (editor) (1995)；And remaining (Yu) et al., " gene therapy " (Gene Therapy) 1:13-26 (1994).
The Nonviral delivery methods of nucleic acid include fat transfection, nuclear transfection, microinjection, electricity turn, particle gun, virion, Liposome, immunoliposome, polycation or lipid: the reagent enhancing of nucleic acid conjugate, naked DNA, artificial virions and DNA Property intake.Fat transfection is described in such as U.S. Patent number 5,049,386,4,946,787 and 4,897,355 and fat transfection is tried Agent is commercially available (for example, TransfectamTM and LipofectinTM).Effective Receptor recognition rouge suitable for polynucleotides turns The cation and neutral lipid of dye include Felgner (Fil Ge Na), WO 91/17424；Those of WO 91/16024.Delivering It can be for cell (such as external or give in vitro) or target tissue (such as giving in vivo).
Lipid: the preparation of nucleic acid complexes (liposome including targeting, such as immunolipid complexes) is the skill of this field (see, for example, Krystal (Crystal), " science " (Science) 270:404-410 (1995) known to art personnel；Cloth Lai Ze (Blaese) et al., " cancer gene therapy " (Cancer Gene Ther.) 2:291-297 (1995)；Bell (Behr) Et al., " bioconjugate chemistry " (Bioconjugate Chem.) 5:382-389 (1994)；Thunder rice (Remy) et al., " biology is altogether Yoke chemistry " 5:647-654 (1994)；High (Gao) et al., " gene therapy " (Gene Therapy) 2:710-722 (1995)；Chinese mugwort Ha Maide (Ahmad) et al., " cancer research " (Cancer Res.) 52:4817-4820 (1992)；U.S. Patent number 4,186, 183,4,217,344,4,235,871,4,261,975,4,485,054,4,501,728,4,774,085,4,837,028 and 4,946,787)。
In a preferred embodiment of the invention, TadA:TadA*:Cas9 fusion protein described in second aspect is first prepared Carrier for expression of eukaryon, prokaryotic expression carrier or be transcribed in vitro carrier；Then carrier for expression of eukaryon is expanded, and prepared without in Prokaryotic expression carrier (or is transferred to inducing expression base editor in Escherichia coli by the carrier for expression of eukaryon of the transfection grade of toxin Enzyme), prepare TadA:TadA*:Cas9 fusion protein.The coding DNA of TadA:TadA*:Cas9 fusion protein can also be cloned Into the in-vitro transcription carrier comprising T7 Sp6 promoter, by being transcribed in vitro, preparation TadA:TadA*:Cas9 merges egg White mRNA.
In a preferred embodiment of the invention, gRNA described in second aspect is prepared, gRNA can be directly synthesized, or The coded sequence of gRNA is cloned into the transcription vector (such as pDR274 comes from Addgene) comprising T7 or Sp6 promoter, or logical The modes such as PCR, annealing, synthesis are crossed directly in the front end of the corresponding coding DNA of gRNA plus T7 or Sp6 promoter, then pass through body The method of outer transcription prepares gRNA；Or the coded sequence of the gRNA is cloned into carrier for expression of eukaryon pGEM-T-U6- In gRNA carrier, the pGEM-T-U6-gRNA carrier is to be expanded from pX330 carrier (Addgene) by way of PCR PCR product is connected into pGEM-T carrier (Promega) in such a way that TA is cloned by the frame sequence of U6 promoter and gRNA In it is obtained.
In an of the invention preferred embodiment, by the DNA of base editing enzymes described in second aspect (transcript mRNA or The albumen of translation) with the expression vector of gRNA (gRNA of the gRNA or synthesis that perhaps transcribe) by including but is not limited to rouge Plasmids, virus infection, electricity turn and the modes such as microinjection are imported into the cell of people.
Further, the viral vectors that the virus infection uses includes but is not limited to retroviral vector, slow disease Poisonous carrier, adenovirus vector and adenovirus first close viral vectors etc..
In a preferred embodiment of the invention, people's cell includes but is not limited to bone marrow cell, candidate stem cell (HSC), embryonic stem cell (ESC), inducing pluripotent stem cells (iPSC) and hematopoietic progenitor cells.
It is understood that the gene order of the ABE base editing system and people's HBG1 and HBG2 promoter region Close, TadA:TadA*:Cas9 fusion protein forms compound in conjunction with gRNA, the compound under the guidance of gRNA, TadA:TadA*:Cas9 fusion protein can be in conjunction with the target site on DNA, wherein the DNA chain complementary with gRNA can be by Cas9 Nuclease cutting, rather than the A base in certain sites then can be by adenine deaminase on complementary strand --- TadA albumen --- catalysis Deamination forms I base.With the duplication of DNA, I (hypoxanthine, Inosine) base can be by G (guanine, Guanine) alkali Base substitution, thus specifically by the GTGTGGGG in HBG1 and HBG2 promoter regionAA(lower stroke of A in GGGGCCCCCAAG sequence Line mark) it is mutated into G, to treat β hemoglobinopathy.
Fifth aspect present invention provides a kind of eukaryotic host cell, includes targeting human editor HBG1 described in second aspect Non-naturally occurring or engineering combination described in ABE base editing system or the third aspect with HBG2 promoter region Object.
In an embodiment of the present invention, the eukaryotic host cell includes but is not limited to bone marrow cell, and Hematopoietic Stem is thin Born of the same parents (HSC), embryonic stem cell (ESC), inducing pluripotent stem cells (iPSC) and hematopoietic progenitor cells.
Sixth aspect present invention provides a kind of kit, and the gRNA sequence or second aspect provided comprising first aspect mentions The ABE base editing system of confession, non-naturally occurring or engineering the composition of third aspect offer, the 5th aspect provide One of eukaryotic host cell is a variety of.
In an embodiment of the present invention, the kit further includes conventional matched reaction reagent and/or consersion unit.Example Such as, kit can provide one or more reactions or storage buffer.It by the available form in specific measurement or can press The form (such as by concentration or lyophilized form) for needing to add one or more other components before the use provides reagent.Buffering Liquid can be any buffer, including but not limited to sodium carbonate buffer, sodium bicarbonate buffer liquid, borate buffer solution, Tris Buffer, MOPS buffer, HEPES buffer solution and combinations thereof.In some embodiments, which is alkaline.Some In embodiment, which has the pH from about 7 to about 10.In some embodiments, which includes one or more few Nucleotide, one or more nucleic acid include at least one gRNA sequence as described in relation to the first aspect.
Each component in kit of the present invention can provide either individually or in combination, and can be provided in any In suitable container, such as bottle, bottle, pipe.
Seventh aspect present invention provides a kind of targeting volume as described in the gRNA sequence of first aspect offer, second aspect Collect the ABE base editing system of people's HBG1 and HBG2 promoter region, the non-naturally occurring or engineering that the third aspect provides A kind of kit for providing of composition, one of the eukaryotic host cell that provides of the 5th aspect or a variety of, the 6th aspect exist Prevention improves, and/or treats the application in β hemoglobinopathy.
In an embodiment of the present invention, the β hemoglobinopathy includes β-thalassemia, sickle cell anemia.
Eighth aspect present invention provides a kind of targeting human editor HBG1 and HBG2 promoter region as described in second aspect The ABE base editing system in domain, non-naturally occurring or engineering the composition of third aspect offer, the 5th aspect provide Eukaryotic host cell is applied by following one or more methods:
1) targeting human editor HBG1 and HBG2 promoter region described in the gRNA sequence that first aspect is provided, second aspect The ABE base editing system in domain, non-naturally occurring or engineering the composition of third aspect offer, the 5th aspect provide Eukaryotic host cell is individually applied；
2) targeting human editor HBG1 and HBG2 promoter region described in the gRNA sequence that first aspect is provided, second aspect The ABE base editing system in domain, non-naturally occurring or engineering the composition of third aspect offer, the 5th aspect provide Eukaryotic host cell and one or more of operation, biological therapy, immunization therapy use in conjunction；
3) targeting described in the gRNA sequence that is provided the first aspect by the way of delivering in vivo, second aspect is compiled Collect the ABE base editing system of people's HBG1 and HBG2 promoter region, the non-naturally occurring or engineering that the third aspect provides Composition, the eukaryotic host cell that provides of the 5th aspect is directly delivered to patient's body and treated；
4) targeting human editor described in the gRNA sequence, second aspect that in-vitro transfection technology provides first aspect is first passed through Non-naturally occurring or engineering the group that the ABE base editing system of HBG1 and HBG2 promoter region, the third aspect provide It closes object to mix with host cell, then by targeting human editor described in the gRNA sequence provided containing first aspect, second aspect Non-naturally occurring or engineering the group that the ABE base editing system of HBG1 and HBG2 promoter region, the third aspect provide The defeated time patient's body of host cell for closing object implements treatment；
5) the eukaryotic host cell input patient's body implementation that the 5th aspect provides is controlled.
Ninth aspect present invention provides a kind for the treatment of method of β hemoglobinopathy, comprising:
1) targeting human editor HBG1 and HBG2 promoter region described in the gRNA sequence that first aspect is provided, second aspect The ABE base editing system in domain, non-naturally occurring or engineering the composition of third aspect offer, the 5th aspect provide Eukaryotic host cell individually treats patient；
2) targeting human editor HBG1 and HBG2 promoter region described in the gRNA sequence that first aspect is provided, second aspect The ABE base editing system in domain, non-naturally occurring or engineering the composition of third aspect offer, the 5th aspect provide Eukaryotic host cell is combined with one or more of operation, biological therapy, immunization therapy treats patient；
3) targeting described in the gRNA sequence that is provided the first aspect by the way of delivering in vivo, second aspect is compiled Collect the ABE base editing system of people's HBG1 and HBG2 promoter region, the non-naturally occurring or engineering that the third aspect provides Composition, the eukaryotic host cell that provides of the 5th aspect is directly delivered to patient's body and treated；
4) targeting human editor described in the gRNA sequence, second aspect that in-vitro transfection technology provides first aspect is first passed through Non-naturally occurring or engineering the group that the ABE base editing system of HBG1 and HBG2 promoter region, the third aspect provide It closes object to mix with host cell, then by targeting human editor described in the gRNA sequence provided containing first aspect, second aspect Non-naturally occurring or engineering the group that the ABE base editing system of HBG1 and HBG2 promoter region, the third aspect provide The defeated time patient's body of host cell for closing object implements treatment；
5) the eukaryotic host cell input patient's body that the 5th aspect provides is implemented into treatment.
In a specific embodiment of the invention, HBG-GGX20 (SEQ ID NO.1) will be expressed, HBG-GX20 (SEQ ID ), NO.2 the segment of HBG-GX17 (SEQ ID NO.3) and HBG-GX16 (SEQ ID NO.4) sequence is cloned into gRNA expression and carries In body, and by it individually with pcDNA3.1-ABE7.10 carrier (SEQ ID NO.9) cotransfection into 293T cell, generate GRNA and TadA:TadA*:Cas9 fusion protein.Under the guidance of gRNA, TadA:TadA*:Cas9 fusion protein can be with DNA On target site combine, wherein the DNA chain complementary with gRNA can be cut off by Cas9 nuclease, rather than 4-9 A alkali on complementary strand Base then can be by adenine deaminase --- TadA albumen ---, and catalysis deamination forms I base.With the duplication of DNA, I (secondary Huang Purine, Inosine) base can be substituted by G (guanine, Guanine) base, to realize the base replacement of A to G, specifically will GTGTGGGG in HBG1 and HBG2 promoter regionAAA (underscore mark) in GGGGCCCCCAAG sequence is mutated into G.Through Deep sequencing comparison, is more specifically targeted to HBG1 and HBG2 for ABE base editing system than HBG-GX19 (SEQ ID NO.6) Promoter region, the A at its target spot is accurately transformed into G, reduces the undershooting-effect of ABE base editing system.
ABE base editing system the invention has the following advantages:
The present invention provides technical solutions can be more specifically compared to the HBG-GX19 (SEQ ID NO.6) of existing report ABE base editing system is targeted to the promoter region of HBG1 and HBG2, the A at its target spot is accurately transformed into G, reduces ABE The undershooting-effect of base editing system more efficiently raises the expression of gamma Globulin, the level of HbF is improved, thus more efficiently Treat β hemoglobinopathy.High specific system provided by the invention has very in the field of gene of β hemoglobinopathy Broad application prospect.
Detailed description of the invention
Fig. 1 is the site of missing the target that PCR product deep sequencing verifies HBG-GX19gRNA, has 6 positions in 18 sites of missing the target Point can be verified, and be marked with No. *.6 sites include: HBG OT1, HBG OT3, HBG OT4, HBG OT5, HBG OT6, HBG OT9.Abscissa indicates A base editorial efficiency.
Fig. 2 is that PCR product deep sequencing compares HBG-GGX20, HBG-GX20, HBG-GX19, HBG-GX17, HBG-GX16 Miss the target the editorial efficiency of site and target site at 10, and abscissa indicates A base editorial efficiency.
Fig. 3 is to compare HBG-GGX20, HBG-GX20, HBG-GX19, and HBG-GX17, HBG-GX16 are in 10 sites of missing the target And the relative activity of target site.Wherein, the relative activity is by removing each gRNA in the editorial efficiency of different loci With HBG-GX19gRNA ratio obtained by editor's activity of target site1, ratio shown by way of thermal map again.In figure It has been shown that, HBG-GGX20, HBG-GX17 and HBG-GX16gRNA have higher specificity compared to HBG-GX19gRNA.
Fig. 4 is HBG-GGX20, HBG-GX20, HBG-GX19, the coding nucleotide sequence of HBG-GX17, HBG-GX1 and HBG promoter target site nucleotide sequence.
Specific embodiment
The present invention is further illustrated below in conjunction with Figure of description and specific embodiment, but embodiment is not to the present invention It limits in any form.
Unless stated otherwise, the present invention uses reagent, method and apparatus for the art conventional reagent, method and are set It is standby.Unless stated otherwise, following embodiment agents useful for same and material are commercially available.Test method without specific conditions is led to Often according to normal conditions or condition proposed by manufacturer implement.
In the embodiment of the invention, the present invention provides a kind of more high specifics for editing HBG1 and HBG2 Promoter region gRNA, ABE base editing system, method, kit and its application.To raise the expression of gamma Globulin, The level for improving HbF, to treat β hemoglobinopathy.
Method provided by the present invention for editing the promoter region of HBG1 and HBG2, uses use provided by the invention In editor HBG1 and HBG2 promoter region ABE base editing system or kit, the method includes but be not limited to as The one or more steps of lower step:
Comparative example
Article (Gaudelli, the N.M.et that the step of comparative example of the present invention delivers with reference to David Liu seminar al.Programmable base editing of A*T to G*C in genomic DNA without DNA Cleavage.Nature 551,464-471 (2017)), it is invented in conjunction with this seminar fast based on genome sequencing detection gland Method (the EndoV-seq technology, with specific reference to the patent application CN of the applicant of purine single base editing system undershooting-effect 2018111602309 embodiment partial tables 2 and Fig. 6 and its related experiment step that undershooting-effect is detected and is analyzed), lead to Cross the inspection of the technologies such as gene chemical synthesis, molecular cloning, cell experiment, nucleic acid purification, PCR product deep sequencing, bioinformatic analysis The undershooting-effect for measuring HBG-GX19gRNA (SEQ ID NO.6) and ABE base editing system, specifically includes:
HBG-GX19gRNA (SEQ ID NO.6) and the combination effect sequencing of ABE base editing system
Expression HBG-GX19gRNA (nucleotides sequence of gRNA boot sequence is classified as SEQ ID NO.6) is cloned into gRNA table Up to (pUC19-SpCas9-gRNA, nucleotides sequence are classified as SEQ ID NO.8, the building of this laboratory) and pcDNA3.1- in carrier ABE7.10 carrier (Ai Ji Biotechnology Co., Ltd synthesizes by Guangzhou, and nucleotides sequence is classified as SEQ ID NO.9) expression vector is total It is transfected into 293T cell, cell is collected after 48h.Genomic DNA (DNeasy is extracted using genome DNA extracting reagent kit Blood&Tissue Kit, Qiagen), operating method is carried out fully according to specification.Then passed through using the primer in table 1 PCR amplification target site and site of missing the target, and these PCR products are used for deep sequencing.
As a result such as such as Fig. 1, pass through deep sequencing, it has been found that for HBG, there are 6 sites in 18 sites of missing the target It is missed the target.These results suggest that the ABE base editing system of HBG-GX19gRNA guidance has undershooting-effect.
Effect example
GRNA and ABE base editing system combination effect sequencing provided by the invention and effect compare
The HBG-GX19gRNA of comparative example is replaced are as follows: (nucleotides sequence of gRNA boot sequence is classified as HBG-GGX20 SEQ ID NO.1), HBG-GX20 (nucleotides sequence of gRNA boot sequence is classified as SEQ ID NO.2), HBG-GX17 (nucleotide Sequence is SEQ ID NO.3) and the frame sequence of HBG-GX16 (nucleotides sequence is classified as SEQ ID NO.4), gRNA be SEQ ID NO.7:GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACU UGAAAAAGUGGCACCGAGUC GGUGCUUUUUU1(Gaudelli,N.M.et al.Programmable base editing of A*T to G*C in genomic DNA without DNA cleavage.Nature551,464-471(2017))
Separately verify its base edit effect:
HBG-GGX20 (nucleotides sequence of gRNA boot sequence is classified as SEQ ID NO.1) will be encoded, HBG-GX20 (gRNA The nucleotides sequence of boot sequence is classified as SEQ ID NO.2), (nucleotides sequence of gRNA boot sequence is classified as SEQ ID to HBG-GX17 NO.3) and HBG-GX16 (nucleotides sequence of gRNA boot sequence is classified as SEQ ID NO.4) gene order is cloned into gRNA expression In carrier (pUC19-SpCas9-gRNA, nucleotides sequence are classified as SEQ ID NO.8, the building of this laboratory), and individually by it (by Guangzhou, Ai Ji Biotechnology Co., Ltd is synthesized, and nucleotides sequence is classified as SEQ ID with pcDNA3.1-ABE7.10 carrier NO.9) cotransfection collects cell into 293T cell after 48h.Genomic DNA is extracted using genome DNA extracting reagent kit (DNeasy Blood&Tissue Kit, Qiagen), operating method are carried out fully according to specification.Then drawing in table 1 is utilized Object passes through totally 10 sites of missing the target PCR amplification target site and OT1-OT10, and these PCR products are used for deep sequencing.
As a result such as such as Fig. 3, pass through deep sequencing, it has been found that HBG-GGX20 (SEQ ID NO.1), HBG-GX17 (SEQ ID NO.3) and HBG-GX16 (SEQ ID NO.4) have compared to HBG-GX19gRNA (SEQ ID NO.6) it is higher special Property.And editorial efficiency that HBG-GX20 (SEQ ID NO.2) is then provided simultaneously at higher target site and efficiency of missing the target.
It should be pointed out that for those skilled in the art, not departing from principle of the embodiment of the present invention Under the premise of, several improvements and modifications can also be made, these improvements and modifications are also considered as the protection scope of the embodiment of the present invention.It will HBG-GGX20 (SEQ ID NO.1), HBG-GX20 (SEQ ID NO.2), HBG-GX17 (SEQ ID NO.3) and HBG-GX16 (SEQ ID NO.4) gRNA and ABE base editing system is imported into candidate stem cell, has knowledge according to this field, can be with , it is envisioned that the promoter of the HBG1 and HBG2 gene in candidate stem cell can be edited, the expression of gamma Globulin is raised.
Potential site statistics and its PCR product deep sequencing primer of missing the target of table 1HBG-GX19gRNA
The base sequence difference of SEQ ID NO.8 and SEQ ID NO.9 of the present invention is as follows: (the SEQ ID NO.8 Base sequence with SEQ ID NO.9 is the sequence of the building of this laboratory and business plasmid vector, therefore is not written into subsequent sequence table In):
SEQ ID NO.8:
TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTC TGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAAC TATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAA ATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTAT TACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGT TGTAAAACGACGGCCAGTGAATTCGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGT TAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAAT TTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTC GATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGGTCTTCGAGAAGACCTGTTTTAGAGCTAGAAAT AGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTCTAGAGTCGACC TGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGC GCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGC GGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGT ATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAG GCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCAT CACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAG CTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGG CGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAA CCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATC GCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGT GGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGA GTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCG CAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTT AAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCA ATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTG TCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCC CCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGG GCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAG TAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTA TGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGC TCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAA TTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGT GTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTG CTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACC CACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAA ATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGC ATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCG CACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTA TCACGAGGCCCTTTCGTC
SEQ ID NO.9:
AGCTTAAGTTTAAACCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCC TCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCA TTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATA GCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCTAGGGGGTATCCC CACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGC CCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATC GGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCA CGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTT GTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCT ATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTAATTCTGTGGAATGTGTGTCAGTTAGGGTGTG GAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAG TCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAAC TCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATG CAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGC AAAAAGCTCCCGGGAGCTTGTATATCCATTTTCGGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGA ACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAA TCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCC GGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGT GCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTC ACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGC CCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGA TCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGG ATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGAC TGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGG CGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTC TTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGATT TCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAG CGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAA TAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTAT CTTATCATGTCTGTATACCGTCGACCTCTAGCTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAAT TGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAG CTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAA TCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCG GTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGC AGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATA GGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGA TACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGC CTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCT CCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCC AACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGG TGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGA AGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTTTTTTTGTT TGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCA GTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATT AAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAG GCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACG GGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAA TAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGT TGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGT GTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGT TGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATG GTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAAC CAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCAC ATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTG AGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTG AGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCC TTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAAT AAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCGACGGATCGGGAGATCTCCCGATCCC CTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGA GGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGC TTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTTGACATTGATTATTGACTAGTTAT TAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGG CCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAG GGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATG CCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGA CTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATG GGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCAC CAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTG GGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTC ACTATAGGGAGACCCAAGCTGGCTAGCGTTTAAACGGGCCCTCTAGACTCGAGCGGCCGCCATGTCCGAAGTCGAGT TTTCCCATGAGTACTGGATGAGACACGCATTGACTCTCGCAAAGAGGGCTTGGGATGAACGCGAGGTGCCCGTGGGG GCAGTACTCGTGCATAACAATCGCGTAATCGGCGAAGGTTGGAATAGGCCGATCGGACGCCACGACCCCACTGCACA TGCGGAAATCATGGCCCTTCGACAGGGAGGGCTTGTGATGCAGAATTATCGACTTATCGATGCGACGCTGTACGTCA CGCTTGAACCTTGCGTAATGTGCGCGGGAGCTATGATTCACTCCCGCATTGGACGAGTTGTATTCGGTGCCCGCGAC GCCAAGACGGGTGCCGCAGGTTCACTGATGGACGTGCTGCATCACCCAGGCATGAACCACCGGGTAGAAATCACAGA AGGCATATTGGCGGACGAATGTGCGGCGCTGTTGTCCGACTTTTTTCGCATGCGGAGGCAGGAGATCAAGGCCCAGA AAAAAGCACAATCCTCTACTGACTCTGGTGGTTCTTCTGGTGGTTCTAGCGGCAGCGAGACTCCCGGGACCTCAGAG TCCGCCACACCCGAAAGTTCTGGTGGTTCTTCTGGTGGTTCTTCCGAGGTCGAATTTTCACATGAGTATTGGATGCG ACACGCCTTGACGCTCGCCAAAAGGGCGAGGGACGAACGGGAAGTTCCCGTAGGCGCCGTCCTTGTACTGAATAATC GAGTTATTGGCGAAGGTTGGAACAGGGCCATAGGACTGCATGATCCAACAGCCCATGCAGAAATCATGGCGCTCCGG CAGGGTGGCCTTGTCATGCAAAATTATAGGCTGATCGACGCGACGTTGTACGTCACCTTCGAACCTTGCGTTATGTG TGCAGGCGCTATGATACATTCAAGAATTGGGCGAGTCGTGTTTGGGGTCAGGAACGCAAAGACTGGTGCAGCCGGTT CCCTTATGGATGTGCTCCACTACCCAGGAATGAATCATCGGGTCGAGATTACAGAGGGGATACTGGCTGACGAATGC GCCGCCCTCCTGTGCTACTTCTTTCGGATGCCCAGGCAGGTGTTTAACGCACAGAAGAAAGCTCAAAGCAGTACCGA CTCTGGGGGCTCTAGTGGAGGCTCCAGCGGTTCTGAGACCCCCGGCACTAGTGAATCTGCCACTCCCGAATCATCCG GGGGATCTTCAGGGGGATCTGATAAAAAGTATTCTATTGGTTTAGCCATCGGCACTAATTCCGTTGGATGGGCTGTC ATAACCGATGAATACAAAGTACCTTCAAAGAAATTTAAGGTGTTGGGGAACACAGACCGTCATTCGATTAAAAAGAA TCTTATCGGTGCCCTCCTATTCGATAGTGGCGAAACGGCAGAGGCGACTCGCCTGAAACGAACCGCTCGGAGAAGGT ATACACGTCGCAAGAACCGAATATGTTACTTACAAGAAATTTTTAGCAATGAGATGGCCAAAGTTGACGATTCTTTC TTTCACCGTTTGGAAGAGTCCTTCCTTGTCGAAGAGGACAAGAAACATGAACGGCACCCCATCTTTGGAAACATAGT AGATGAGGTGGCATATCATGAAAAGTACCCAACGATTTATCACCTCAGAAAAAAGCTAGTTGACTCAACTGATAAAG CGGACCTGAGGTTAATCTACTTGGCTCTTGCCCATATGATAAAGTTCCGTGGGCACTTTCTCATTGAGGGTGATCTA AATCCGGACAACTCGGATGTCGACAAACTGTTCATCCAGTTAGTACAAACCTATAATCAGTTGTTTGAAGAGAACCC TATAAATGCAAGTGGCGTGGATGCGAAGGCTATTCTTAGCGCCCGCCTCTCTAAATCCCGACGGCTAGAAAACCTGA TCGCACAATTACCCGGAGAGAAGAAAAATGGGTTGTTCGGTAACCTTATAGCGCTCTCACTAGGCCTGACACCAAAT TTTAAGTCGAACTTCGACTTAGCTGAAGATGCCAAATTGCAGCTTAGTAAGGACACGTACGATGACGATCTCGACAA TCTACTGGCACAAATTGGAGATCAGTATGCGGACTTATTTTTGGCTGCCAAAAACCTTAGCGATGCAATCCTCCTAT CTGACATACTGAGAGTTAATACTGAGATTACCAAGGCGCCGTTATCCGCTTCAATGATCAAAAGGTACGATGAACAT CACCAAGACTTGACACTTCTCAAGGCCCTAGTCCGTCAGCAACTGCCTGAGAAATATAAGGAAATATTCTTTGATCA GTCGAAAAACGGGTACGCAGGTTATATTGACGGCGGAGCGAGTCAAGAGGAATTCTACAAGTTTATCAAACCCATAT TAGAGAAGATGGATGGGACGGAAGAGTTGCTTGTAAAACTCAATCGCGAAGATCTACTGCGAAAGCAGCGGACTTTC GACAACGGTAGCATTCCACATCAAATCCACTTAGGCGAATTGCATGCTATACTTAGAAGGCAGGAGGATTTTTATCC GTTCCTCAAAGACAATCGTGAAAAGATTGAGAAAATCCTAACCTTTCGCATACCTTACTATGTGGGACCCCTGGCCC GAGGGAACTCTCGGTTCGCATGGATGACAAGAAAGTCCGAAGAAACGATTACTCCCTGGAATTTTGAGGAAGTTGTC GATAAAGGTGCGTCAGCTCAATCGTTCATCGAGAGGATGACCAACTTTGACAAGAATTTACCGAACGAAAAAGTATT GCCTAAGCACAGTTTACTTTACGAGTATTTCACAGTGTACAATGAACTCACGAAAGTTAAGTATGTCACTGAGGGCA TGCGTAAACCCGCCTTTCTAAGCGGAGAACAGAAGAAAGCAATAGTAGATCTGTTATTCAAGACCAACCGCAAAGTG ACAGTTAAGCAATTGAAAGAGGACTACTTTAAGAAAATTGAATGCTTCGATTCTGTCGAGATCTCCGGGGTAGAAGA TCGATTTAATGCGTCACTTGGTACGTATCATGACCTCCTAAAGATAATTAAAGATAAGGACTTCCTGGATAACGAAG AGAATGAAGATATCTTAGAAGATATAGTGTTGACTCTTACCCTCTTTGAAGATCGGGAAATGATTGAGGAAAGACTA AAAACATACGCTCACCTGTTCGACGATAAGGTTATGAAACAGTTAAAGAGGCGTCGCTATACGGGCTGGGGACGCTT GTCGCGGAAACTTATCAACGGGATAAGAGACAAGCAAAGTGGTAAAACTATTCTCGATTTTCTAAAGAGCGACGGCT TCGCCAATAGGAACTTTATGCAGCTGATCCATGATGACTCTTTAACCTTCAAAGAGGATATACAAAAGGCACAGGTT TCCGGACAAGGGGACTCATTGCACGAACATATTGCGAATCTTGCTGGTTCGCCAGCCATCAAAAAGGGCATACTCCA GACAGTCAAAGTAGTGGATGAGCTAGTTAAGGTCATGGGACGTCACAAACCGGAAAACATTGTAATCGAGATGGCAC GCGAAAATCAAACGACTCAGAAGGGGCAAAAAAACAGTCGAGAGCGGATGAAGAGAATAGAAGAGGGTATTAAAGAA CTGGGCAGCCAGATCTTAAAGGAGCATCCTGTGGAAAATACCCAATTGCAGAACGAGAAACTTTACCTCTATTACCT ACAAAATGGAAGGGACATGTATGTTGATCAGGAACTGGACATAAACCGTTTATCTGATTACGACGTCGATCACATTG TACCCCAATCCTTTTTGAAGGACGATTCAATCGACAATAAAGTGCTTACACGCTCGGATAAGAACCGAGGGAAAAGT GACAATGTTCCAAGCGAGGAAGTCGTAAAGAAAATGAAGAACTATTGGCGGCAGCTCCTAAATGCGAAACTGATAAC GCAAAGAAAGTTCGATAACTTAACTAAAGCTGAGAGGGGTGGCTTGTCTGAACTTGACAAGGCCGGATTTATTAAAC GTCAGCTCGTGGAAACCCGCCAGATCACAAAGCATGTTGCCCAGATACTAGATTCCCGAATGAATACGAAATACGAC GAGAACGATAAGCTGATTCGGGAAGTCAAAGTAATCACTTTAAAGTCAAAATTGGTGTCGGACTTCAGAAAGGATTT TCAATTCTATAAAGTTAGGGAGATAAATAACTACCACCATGCGCACGACGCTTATCTTAATGCCGTCGTAGGGACCG CACTCATTAAGAAATACCCGAAGCTAGAAAGTGAGTTTGTGTATGGTGATTACAAAGTTTATGACGTCCGTAAGATG ATCGCGAAAAGCGAACAGGAGATAGGCAAGGCTACAGCCAAATACTTCTTTTATTCTAACATTATGAATTTCTTTAA GACGGAAATCACTCTGGCAAACGGAGAGATACGCAAACGACCTTTAATTGAAACCAATGGGGAGACAGGTGAAATCG TATGGGATAAGGGCCGGGACTTCGCGACGGTGAGAAAAGTTTTGTCCATGCCCCAAGTCAACATAGTAAAGAAAACT GAGGTGCAGACCGGAGGGTTTTCAAAGGAATCGATTCTTCCAAAAAGGAATAGTGATAAGCTCATCGCTCGTAAAAA GGACTGGGACCCGAAAAAGTACGGTGGCTTCGATAGCCCTACAGTTGCCTATTCTGTCCTAGTAGTGGCAAAAGTTG AGAAGGGAAAATCCAAGAAACTGAAGTCAGTCAAAGAATTATTGGGGATAACGATTATGGAGCGCTCGTCTTTTGAA AAGAACCCCATCGACTTCCTTGAGGCGAAAGGTTACAAGGAAGTAAAAAAGGATCTCATAATTAAACTACCAAAGTA TAGTCTGTTTGAGTTAGAAAATGGCCGAAAACGGATGTTGGCTAGCGCCGGAGAGCTTCAAAAGGGGAACGAACTCG CACTACCGTCTAAATACGTGAATTTCCTGTATTTAGCGTCCCATTACGAGAAGTTGAAAGGTTCACCTGAAGATAAC GAACAGAAGCAACTTTTTGTTGAGCAGCACAAACATTATCTCGACGAAATCATAGAGCAAATTTCGGAATTCAGTAA GAGAGTCATCCTAGCTGATGCCAATCTGGACAAAGTATTAAGCGCATACAACAAGCACAGGGATAAACCCATACGTG AGCAGGCGGAAAATATTATCCATTTGTTTACTCTTACCAACCTCGGCGCTCCAGCCGCATTCAAGTATTTTGACACA ACGATAGATCGCAAACGATACACTTCTACCAAGGAGGTGCTAGACGCGACACTGATTCACCAATCCATCACGGGATT ATATGAAACTCGGATAGATTTGTCACAGCTTGGGGGTGACTCTGGTGGTTCTCCCAAGAAGAAGAGGAAAGTCTAAA
It should be pointed out that for those skilled in the art, not departing from principle of the embodiment of the present invention Under the premise of, several improvements and modifications can also be made, these improvements and modifications are also considered as the protection scope of the embodiment of the present invention.
Sequence table
<110>Zhongshan University
<120>a kind of high specific ABE base editing system and its application in β hemoglobinopathy
<130> 2018
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> RNA
<213>artificial sequence (Artificial Sequence)
<400> 1
ggguggggaa ggggccccca ag 22
<210> 2
<211> 21
<212> RNA
<213>artificial sequence (Artificial Sequence)
<400> 2
gguggggaag gggcccccaa g 21
<210> 3
<211> 18
<212> RNA
<213>artificial sequence (Artificial Sequence)
<400> 3
ggggaagggg cccccaag 18
<210> 4
<211> 17
<212> RNA
<213>artificial sequence (Artificial Sequence)
<400> 4
gggaaggggc ccccaag 17
<210> 5
<211> 1763
<212> PRT
<213>artificial sequence (Artificial Sequence)
<400> 5
Ser Glu Val Glu Phe Ser His Glu Tyr Trp Met Arg His Ala Leu Thr
1 5 10 15
Leu Ala Lys Arg Ala Trp Asp Glu Arg Glu Val Pro Val Gly Ala Val
20 25 30
Leu Val His Asn Asn Arg Val Ile Gly Glu Gly Trp Asn Arg Pro Ile
35 40 45
Gly Arg His Asp Pro Thr Ala His Ala Glu Ile Met Ala Leu Arg Gln
50 55 60
Gly Gly Leu Val Met Gln Asn Tyr Arg Leu Ile Asp Ala Thr Leu Tyr
65 70 75 80
Val Thr Leu Glu Pro Cys Val Met Cys Ala Gly Ala Met Ile His Ser
85 90 95
Arg Ile Gly Arg Val Val Phe Gly Ala Arg Asp Ala Lys Thr Gly Ala
100 105 110
Ala Gly Ser Leu Met Asp Val Leu His His Pro Gly Met Asn His Arg
115 120 125
Val Glu Ile Thr Glu Gly Ile Leu Ala Asp Glu Cys Ala Ala Leu Leu
130 135 140
Ser Asp Phe Phe Arg Met Arg Arg Gln Glu Ile Lys Ala Gln Lys Lys
145 150 155 160
Ala Gln Ser Ser Thr Asp Ser Gly Gly Ser Ser Gly Gly Ser Ser Gly
165 170 175
Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser Ser Gly
180 185 190
Gly Ser Ser Gly Gly Ser Ser Glu Val Glu Phe Ser His Glu Tyr Trp
195 200 205
Met Arg His Ala Leu Thr Leu Ala Lys Arg Ala Arg Asp Glu Arg Glu
210 215 220
Val Pro Val Gly Ala Val Leu Val Leu Asn Asn Arg Val Ile Gly Glu
225 230 235 240
Gly Trp Asn Arg Ala Ile Gly Leu His Asp Pro Thr Ala His Ala Glu
245 250 255
Ile Met Ala Leu Arg Gln Gly Gly Leu Val Met Gln Asn Tyr Arg Leu
260 265 270
Ile Asp Ala Thr Leu Tyr Val Thr Phe Glu Pro Cys Val Met Cys Ala
275 280 285
Gly Ala Met Ile His Ser Arg Ile Gly Arg Val Val Phe Gly Val Arg
290 295 300
Asn Ala Lys Thr Gly Ala Ala Gly Ser Leu Met Asp Val Leu His Tyr
305 310 315 320
Pro Gly Met Asn His Arg Val Glu Ile Thr Glu Gly Ile Leu Ala Asp
325 330 335
Glu Cys Ala Ala Leu Leu Cys Tyr Phe Phe Arg Met Pro Arg Gln Val
340 345 350
Phe Asn Ala Gln Lys Lys Ala Gln Ser Ser Thr Asp Ser Gly Gly Ser
355 360 365
Ser Gly Gly Ser Ser Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala
370 375 380
Thr Pro Glu Ser Ser Gly Gly Ser Ser Gly Gly Ser Asp Lys Lys Tyr
385 390 395 400
Ser Ile Gly Leu Ala Ile Gly Thr Asn Ser Val Gly Trp Ala Val Ile
405 410 415
Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe Lys Val Leu Gly Asn
420 425 430
Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile Gly Ala Leu Leu Phe
435 440 445
Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu Lys Arg Thr Ala Arg
450 455 460
Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys Tyr Leu Gln Glu Ile
465 470 475 480
Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser Phe Phe His Arg Leu
485 490 495
Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys His Glu Arg His Pro
500 505 510
Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His Glu Lys Tyr Pro
515 520 525
Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp Ser Thr Asp Lys Ala
530 535 540
Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met Ile Lys Phe Arg
545 550 555 560
Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp Asn Ser Asp Val
565 570 575
Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr Asn Gln Leu Phe Glu
580 585 590
Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys Ala Ile Leu Ser
595 600 605
Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn Leu Ile Ala Gln Leu
610 615 620
Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu Ile Ala Leu Ser
625 630 635 640
Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp Leu Ala Glu Asp
645 650 655
Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp Asp Leu Asp Asn
660 665 670
Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu Phe Leu Ala Ala
675 680 685
Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile Leu Arg Val Asn
690 695 700
Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met Ile Lys Arg Tyr
705 710 715 720
Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala Leu Val Arg Gln
725 730 735
Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp Gln Ser Lys Asn
740 745 750
Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln Glu Glu Phe Tyr
755 760 765
Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly Thr Glu Glu Leu
770 775 780
Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys Gln Arg Thr Phe
785 790 795 800
Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly Glu Leu His Ala
805 810 815
Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu Lys Asp Asn Arg
820 825 830
Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro Tyr Tyr Val Gly
835 840 845
Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met Thr Arg Lys Ser
850 855 860
Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val Val Asp Lys Gly
865 870 875 880
Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn Phe Asp Lys Asn
885 890 895
Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu Leu Tyr Glu Tyr
900 905 910
Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr Val Thr Glu Gly
915 920 925
Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys Lys Ala Ile Val
930 935 940
Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val Lys Gln Leu Lys
945 950 955 960
Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser Val Glu Ile Ser
965 970 975
Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr Tyr His Asp Leu
980 985 990
Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn Glu Glu Asn Glu
995 1000 1005
Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu Phe Glu Asp Arg
1010 1015 1020
Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His Leu Phe Asp Asp
1025 1030 1035 1040
Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr Thr Gly Trp Gly Arg
1045 1050 1055
Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp Lys Gln Ser Gly Lys
1060 1065 1070
Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe Ala Asn Arg Asn Phe
1075 1080 1085
Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe Lys Glu Asp Ile Gln
1090 1095 1100
Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His Glu His Ile Ala
1105 1110 1115 1120
Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile Leu Gln Thr Val
1125 1130 1135
Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg His Lys Pro Glu
1140 1145 1150
Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr Thr Gln Lys Gly
1155 1160 1165
Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu Glu Gly Ile Lys
1170 1175 1180
Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val Glu Asn Thr Gln
1185 1190 1195 1200
Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln Asn Gly Arg Asp
1205 1210 1215
Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu Ser Asp Tyr Asp
1220 1225 1230
Val Asp His Ile Val Pro Gln Ser Phe Leu Lys Asp Asp Ser Ile Asp
1235 1240 1245
Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly Lys Ser Asp Asn
1250 1255 1260
Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn Tyr Trp Arg Gln
1265 1270 1275 1280
Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe Asp Asn Leu Thr
1285 1290 1295
Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp Lys Ala Gly Phe Ile
1300 1305 1310
Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr Lys His Val Ala Gln
1315 1320 1325
Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp Glu Asn Asp Lys Leu
1330 1335 1340
Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser Lys Leu Val Ser Asp
1345 1350 1355 1360
Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu Ile Asn Asn Tyr
1365 1370 1375
His His Ala His Asp Ala Tyr Leu Asn Ala Val Val Gly Thr Ala Leu
1380 1385 1390
Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val Tyr Gly Asp Tyr
1395 1400 1405
Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser Glu Gln Glu Ile
1410 1415 1420
Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn Ile Met Asn Phe
1425 1430 1435 1440
Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile Arg Lys Arg Pro
1445 1450 1455
Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val Trp Asp Lys Gly
1460 1465 1470
Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser Met Pro Gln Val Asn
1475 1480 1485
Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser
1490 1495 1500
Ile Leu Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp
1505 1510 1515 1520
Trp Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr
1525 1530 1535
Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu
1540 1545 1550
Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser
1555 1560 1565
Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys Glu
1570 1575 1580
Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu Phe Glu
1585 1590 1595 1600
Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala Gly Glu Leu Gln
1605 1610 1615
Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val Asn Phe Leu Tyr
1620 1625 1630
Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro Glu Asp Asn Glu
1635 1640 1645
Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr Leu Asp Glu Ile
1650 1655 1660
Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile Leu Ala Asp Ala
1665 1670 1675 1680
Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys His Arg Asp Lys Pro
1685 1690 1695
Ile Arg Glu Gln Ala Glu Asn Ile Ile His Leu Phe Thr Leu Thr Asn
1700 1705 1710
Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg
1715 1720 1725
Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His
1730 1735 1740
Gln Ser Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu
1745 1750 1755 1760
Gly Gly Asp
<210> 6
<211> 20
<212> RNA
<213>artificial sequence (Artificial Sequence)
<400> 6
guggggaagg ggcccccaag 20
<210> 7
<211> 82
<212> RNA
<213>artificial sequence (Artificial Sequence)
<400> 7
guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc cguuaucaac uugaaaaagu 60
ggcaccgagu cggugcuuuu uu 82

Claims (10)

1. a kind of gRNA for targeting HBG1 and HBG2 promoter region, which is characterized in that include gRNA sequence, the gRNA sequence Nucleotide sequence include at least one of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4.
2. a kind of ABE base editing system of targeting editor HBG1 and HBG2 promoter region, which is characterized in that the ABE alkali Base editing system includes TadA:TadA*:Cas9 fusion protein, further includes the gRNA for targeting HBG1 and HBG2 promoter region, institute State gRNA sequence nucleotide sequence include SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, in SEQ ID NO.4 It is at least one.
3. ABE base editing system according to claim 2, which is characterized in that the TadA:TadA*:Cas9 merges egg White amino acid sequence be amino acid at least 80% shown in SEQ ID NO.5,85%, 90%, 92%, 95%, 96%, 97%, 98%, 99% or 99.5% consistent sequence.
4. a kind of non-naturally occurring or engineering composition, which is characterized in that the composition is 1) -6) one of or It is a variety of:
1) include one or more carriers, which includes component I and component II:
The component I includes the first regulating element, and the coding such as right being operably connected with first regulating element It is required that the coded sequence of TadA:TadA*:Cas9 fusion protein described in 2；The component II includes the second regulating element, and The coding being operably connected with second regulating element gRNA sequence as described in claim 1；Wherein, component I and II On identical or different carrier；
2) comprising the mRNA and carrier of TadA:TadA*:Cas9 fusion protein as claimed in claim 2, the carrier includes Second regulating element, and the coding gRNA sequence as described in claim 1 being operably connected with second regulating element Column；
3) comprising the albumen and carrier of TadA:TadA*:Cas9 fusion protein as claimed in claim 2, the carrier includes Second regulating element, and the coding gRNA sequence as described in claim 1 being operably connected with second regulating element Column；
4) comprising TadA:TadA*:Cas9 fusion protein as claimed in claim 2 expression vector and such as claim 1 institute The gRNA stated；
5) mRNA comprising TadA:TadA*:Cas9 fusion protein as claimed in claim 2 and as described in claim 1 gRNA；
6) albumen comprising TadA:TadA*:Cas9 fusion protein as claimed in claim 2 and as described in claim 1 gRNA。
5. a kind of method in body cell or a internal targeting editor HBG1 and HBG2 promoter region, which is characterized in that Include: to deliver ABE base editing system as claimed in claim 2 or composition as claimed in claim 4, makes described The sequence of ABE base editing system or composition and people HBG1 and HBG2 is close.
6. a kind of eukaryotic host cell, which is characterized in that comprising claim 1 provide gRNA sequence, as claimed in claim 2 ABE base editing system or composition as claimed in claim 5.
7. a kind of kit for the expression in body cell or human body internal specific up-regulation HBG1 and HBG2, which is characterized in that GRNA sequence, the ABE base editing system of claim 2 offer, the claim 4 provided including claim 1 provides non- One of eukaryotic host cell that naturally occurring or engineering composition, claim 6 provide is a variety of.
8. the ABE base editing system that a kind of gRNA sequence as claimed in claim 1, claim 2 provide, claim 5 provide It is non-naturally occurring or engineering composition, claim 6 provide eukaryotic host cell, claim 7 provide examination Agent box prevents, improves, and/or treats the medicine of the β hemoglobinopathy caused by HBB gene mutation preparing in body cell or human body Application in object.
9. application as claimed in claim 8, which is characterized in that the β hemoglobinopathy includes β-thalassemia, sickle Cell anaemia.
10. the ABE base editing system that a kind of gRNA sequence provided such as claim 1, claim 2 provide, claim 5 The eukaryotic host cell of non-naturally occurring or engineering the composition, claim 6 offer that provide is by following a kind of or more Kind method is applied:
1) ABE base editing system that gRNA sequence that such as claim 1 provides, claim 2 provide, claim 5 are mentioned The eukaryotic host cell of non-naturally occurring or engineering the composition, claim 6 offer that supply individually is applied；
2) ABE base editing system that gRNA sequence that such as claim 1 provides, claim 2 provide, claim 5 are mentioned Supply it is non-naturally occurring or engineering composition, claim 6 provide eukaryotic host cell and operation, biological therapy, One or more of immunization therapy use in conjunction；
3) ABE that gRNA sequence, the claim 2 provided such as such as claim 1 is provided by the way of delivering in vivo The eukaryon of non-naturally occurring or engineering composition, claim 6 offer that base editing system, claim 5 provide Host cell is directly delivered to patient's body and is treated；
4) the ABE base that in-vitro transfection technology provides gRNA sequence that such as claim 1 provides, claim 2 is first passed through to compile Non-naturally occurring or engineering the composition that the system of collecting, claim 5 provide is mixed with host cell, then will be contained It states as the gRNA sequence, the ABE base editing system of claim 2 offer, the claim 5 that provide such as claim 1 provide Defeated time patient's body of host cell of non-naturally occurring or engineering composition implements treatment；
5) the eukaryotic host cell input patient's body provided claim 6 implements treatment.
CN201811345987.5A 2018-11-13 2018-11-13 A kind of high specific ABE base editing system and its application in β hemoglobinopathy Pending CN109385425A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811345987.5A CN109385425A (en) 2018-11-13 2018-11-13 A kind of high specific ABE base editing system and its application in β hemoglobinopathy

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811345987.5A CN109385425A (en) 2018-11-13 2018-11-13 A kind of high specific ABE base editing system and its application in β hemoglobinopathy

Publications (1)

Publication Number Publication Date
CN109385425A true CN109385425A (en) 2019-02-26

Family

ID=65428723

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811345987.5A Pending CN109385425A (en) 2018-11-13 2018-11-13 A kind of high specific ABE base editing system and its application in β hemoglobinopathy

Country Status (1)

Country Link
CN (1) CN109385425A (en)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110029096A (en) * 2019-05-09 2019-07-19 上海科技大学 A kind of adenine base edit tool and application thereof
CN111718420A (en) * 2019-03-19 2020-09-29 华东师范大学 Fusion protein for gene therapy and application thereof
WO2020199200A1 (en) * 2019-04-04 2020-10-08 中国科学院脑科学与智能技术卓越创新中心 New-type single-base editing technique and use thereof
CN112011576A (en) * 2019-05-31 2020-12-01 华东师范大学 Application of CRISPR gene editing technology in treating thalassemia
CN113694218A (en) * 2021-08-30 2021-11-26 昆明理工大学 Gene repair treatment vector for ATP7B gene P992L mutation
CN114560946A (en) * 2020-11-27 2022-05-31 华东师范大学 Product, method and application of adenine single base editing without PAM limitation
WO2022143694A1 (en) * 2020-12-28 2022-07-07 华东师范大学 Method for performing gene editing on single or multiple genes in cell, and product and use
CN114848851A (en) * 2022-04-29 2022-08-05 广州医科大学附属第三医院（广州重症孕产妇救治中心、广州柔济医院） Medicine for treating beta-thalassemia
WO2023046086A1 (en) * 2021-09-24 2023-03-30 华东师范大学 Base editing system and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103270046A (en) * 2010-10-12 2013-08-28 费城儿童医院 Methods and compositions for treating hemophilia B
CN108291218A (en) * 2015-07-15 2018-07-17 新泽西鲁特格斯州立大学 Nuclease dependent/non-dependent target gene editing platform and application thereof
CN108290933A (en) * 2015-06-18 2018-07-17 布罗德研究所有限公司 Reduce the CRISPR enzyme mutants of undershooting-effect

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103270046A (en) * 2010-10-12 2013-08-28 费城儿童医院 Methods and compositions for treating hemophilia B
CN108290933A (en) * 2015-06-18 2018-07-17 布罗德研究所有限公司 Reduce the CRISPR enzyme mutants of undershooting-effect
CN108291218A (en) * 2015-07-15 2018-07-17 新泽西鲁特格斯州立大学 Nuclease dependent/non-dependent target gene editing platform and application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
NICOLE M. GAUDELLI等: "Programmable base editing of A•T to G•C in genomic DNA without DNA cleavage", 《NATURE》 *
陈超: "《新技术与精准医学》", 31 December 2017, 上海交通大学出版社 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111718420A (en) * 2019-03-19 2020-09-29 华东师范大学 Fusion protein for gene therapy and application thereof
CN111718420B (en) * 2019-03-19 2021-09-14 华东师范大学 Fusion protein for gene therapy and application thereof
WO2020199200A1 (en) * 2019-04-04 2020-10-08 中国科学院脑科学与智能技术卓越创新中心 New-type single-base editing technique and use thereof
CN110029096A (en) * 2019-05-09 2019-07-19 上海科技大学 A kind of adenine base edit tool and application thereof
CN110029096B (en) * 2019-05-09 2023-05-12 上海科技大学 Adenine base editing tool and application thereof
CN112011576A (en) * 2019-05-31 2020-12-01 华东师范大学 Application of CRISPR gene editing technology in treating thalassemia
CN114560946A (en) * 2020-11-27 2022-05-31 华东师范大学 Product, method and application of adenine single base editing without PAM limitation
WO2022143694A1 (en) * 2020-12-28 2022-07-07 华东师范大学 Method for performing gene editing on single or multiple genes in cell, and product and use
CN113694218A (en) * 2021-08-30 2021-11-26 昆明理工大学 Gene repair treatment vector for ATP7B gene P992L mutation
WO2023046086A1 (en) * 2021-09-24 2023-03-30 华东师范大学 Base editing system and application thereof
CN114848851A (en) * 2022-04-29 2022-08-05 广州医科大学附属第三医院（广州重症孕产妇救治中心、广州柔济医院） Medicine for treating beta-thalassemia

Similar Documents

Publication Publication Date Title
CN109385425A (en) A kind of high specific ABE base editing system and its application in β hemoglobinopathy
US11312937B2 (en) Nucleotide-specific recognition sequences for designer TAL effectors
CN113151215B (en) Engineered Cas12i nuclease, effector protein thereof and application thereof
US11214779B2 (en) Activatable CRISPR/CAS9 for spatial and temporal control of genome editing
US11274288B2 (en) Compositions and methods for promoting homology directed repair mediated gene editing
CN105899665B (en) The delivering method and composition being transformed for nuclease-mediated genome project
KR102465067B1 (en) Engineered CAS9 System for Eukaryotic Genome Modification
EP2975942B1 (en) Targeted disruption of t cell receptor genes using engineered zinc finger protein nucleases
CN108823202A (en) Base editing system, method, kit and its application of the mutation of people&#39;s HBB gene are repaired for specificity
KR20190039530A (en) Regulation of gene expression using engineered nuclease
CN106795488A (en) The method and composition of genome projectization and correction for the mediation of candidate stem cell amplifying nucleic acid enzyme
CN114672473B (en) Optimized Cas protein and application thereof
KR20060039019A (en) Methods and compositions for targeted cleavage and recombination
TWI609960B (en) Transposon system, kit comprising the same, and uses thereof
CN114438055B (en) Novel CRISPR enzymes and systems and uses
JP2024041916A (en) Site-specific rna editing by artificially constructed rna editing enzyme and related use thereof
CN109295054A (en) The detection method of gRNA for pathogen targeting gene RNA and the pathogen gene based on C2c2, detection kit
CN109402115A (en) Target Rett mutated gene RNA gRNA and Rett mutated gene detection method, detection kit
CN109897852A (en) The gRNA of tumour related mutation gene based on C2c2, detection method, detection kit
CN109468319A (en) For inhibiting HSV-1 to replicate and/or CRISPR/Cas9 system, method, kit and its application of target sequence expression
CN109913452A (en) For targeting the gRNA and the HBB mutation detection methods based on C2c2, detection kit of HBB RNA
CN109295055A (en) The gRNA of tumour related mutation gene based on C2c2, detection method, detection kit
CN113564145B (en) Fusion protein for cytosine base editing and application thereof
EP4228690A1 (en) Ww-domain-activated extracellular vesicles targeting coronaviruses
CN109468318A (en) For inhibiting HSV-1 to replicate and/or CRISPR/Cas9 system, method, kit and its application of target sequence expression

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20190226

RJ01 Rejection of invention patent application after publication