CN109371134B

CN109371134B - Kit for detecting endometrial cancer cell markers in peripheral blood

Info

Publication number: CN109371134B
Application number: CN201811488969.2A
Authority: CN
Inventors: 谭焕然; 郭红燕; 牛刚; 张坤
Original assignee: Beijing Niuniu Gene Technology Co ltd; Peking University; Peking University Third Hospital
Current assignee: Beijing Niuniu Gene Technology Co ltd; Peking University; Peking University Third Hospital
Priority date: 2018-12-06
Filing date: 2018-12-06
Publication date: 2022-04-01
Anticipated expiration: 2038-12-06
Also published as: CN109371134A

Abstract

The invention provides a kit for detecting endometrial cancer cell markers in peripheral blood, which comprises magnetic beads combined with endometrial cancer antibodies and corresponding buffer reagents, wherein the kit adopts molecular biological methods such as magnetic bead sorting, reverse transcription-multiplex PCR and the like to detect the biological activity of tumor cells in blood circulation of an endometrial cancer patient, determines genes of drug treatment targets, determines the development and the regression of the endometrial cancer by detecting the expression levels of PAX8, ER and P53, and provides theoretical basis and experimental evidence for the individualized treatment of the endometrial cancer. The kit provided by the invention has the advantages of small detection sample amount, little harm to patients, high detection sensitivity and detection rate reaching 61.2%.

Description

Kit for detecting endometrial cancer cell markers in peripheral blood

Technical Field

The invention belongs to the technical field of biology, relates to a endometrial cancer detection kit, and particularly relates to a kit with high accuracy for detecting endometrial cancer cell markers in peripheral blood.

Background

Endometrial Cancer (EC) is a group of epithelial malignant tumors occurring in the endometrium, adenocarcinoma derived from endometrial glands is the most common, and accounts for 7% and 20% -30% of three malignant tumors in the female genital tract. Statistically, the incidence of endometrial cancer increases by 2.4% annually from 2007 to 2011, the mortality increases by 1.9% annually, and the relative survival rates at 5 and 10 years are 82% and 79%, respectively.

1. Present clinical diagnosis and treatment status of endometrial cancer and relevant factors influencing prognosis

1.1 endometrial cancer with different pathological types, the prognosis is obviously different.

The binary model of endometrial cancer proposed by Bokhman has now become widely accepted: the type I endometrial cancer mostly occurs in women in the menopause or the premenopause, the patients mostly have the history of exposure to endogenous or exogenous estrogen without antagonism, the patients have obvious correlation with female hyperestrogenism, such as obesity, ovatelesthetic uterine bleeding, infertility, polycystic ovarian syndrome, postmenopausal and endometrial hyperplasia, the most common type of endometrial cancer can reach 80-85 percent, mostly endometrioid adenocarcinoma is adopted, the tumor differentiation degree is better, the malignancy degree is generally lower, the endometrial cancer is sensitive to progestational hormone medicaments, the prognosis is better, and the 5-year survival rate is about 74 percent. The II type endometrial cancer is non-estrogen-dependent, mostly occurs in atrophic endometrium, is morphologically represented by low differentiation cancer, is mostly serous lymphoma, transparent cell carcinoma and other rare tumors, belongs to high malignant tumors, has deep muscle layer infiltration, has poor prognosis, and has the survival rate of 27-42% in 5 years.

1.2 clinical stages of endometrial cancer are different, and prognosis is obviously different.

Patients with endometrial cancer are diagnosed in hospitals mostly due to postmenopausal vaginal bleeding, irregular vaginal bleeding and other symptoms, and can be diagnosed early and treated timely through diagnostic uterine curettage and endometrial biopsy. The FIGO clinical stage is also one of the standard references for relevant studies on intimal cancer. The majority of endometrial cancer of women can be cured or does not have auxiliary radiotherapy in early diagnosis and operation, and the survival rate of endometrial cancer patients is obviously improved by combining the improvement of an operation mode, optimizing an auxiliary treatment scheme after operation and the like. Recurrence or metastasis of endometrial cancer after surgery is an important factor affecting survival of patients and also a significant cause of death. For disease determination, the worse the histological differentiation, the deeper the muscle layer infiltration, the higher the pelvic lymph node metastasis rate, and the worse the prognosis. Research shows that the 5-year survival rates of high, medium and low differentiation are respectively 94%, 84% and 72%. The 5-year survival rate of the patients with the IA stage high differentiation can even reach 100 percent; the survival rate of the patients with IB-IV stage and high differentiation is 67 percent; the survival rate of patients with IB-IV stage and low differentiation is only 26%, and the clinical stage and the tumor differentiation degree are all factors related to the prognosis of endometrial cancer. However, some early-stage endometrial cancers have local recurrence and distant metastasis, which seriously affect the quality of life of patients and are one of the problems to be considered.

1.3 treatment of endometrial cancer there are normative guidelines, but adjuvant treatment of early stage endometrial cancer is not well established.

Regarding the treatment of endometrial Cancer, the current guidelines recommended by the National Comprehensive Cancer Network (NCCN) adopted at home and abroad are regularly updated at the official website (www.nccn.org) to facilitate clinical use, and domestic scholars can correspondingly interpret the instruction of NCCN. In the NCCN guidelines, there are some recommendations for whether to add adjuvant therapy to patients after surgery in pathological staging, but there is no clear indication, for example, for endometrial cancer in the stages of fig IA and fig IB in clinical surgery, depending on whether there is a high risk factor and the pathological grading (G1, G2, G3) is different, the given treatment is recommended to be observation, intracavity radiotherapy, external irradiation, systemic chemotherapy, etc., or different adjuvant therapy methods are added in combination, but no objective evidence of medicine is added, and no clear recommendation is provided.

Most endometrial cancers have symptoms of vaginal bleeding, liquid drainage and the like at an early stage, the early-stage endometrial cancers are easy to find at an early stage, the early-stage endometrial cancers account for the highest percentage in clinic, standard staged endometrial cancer surgical treatment is mainly used for treatment, and detailed surgical relevant instructions of NCCN are also main basis for clinical treatment reference. However, the post-operative treatment is determined by the presence or absence of high-risk factors such as low-differentiation endometrioid cancer, lymphangioma embolus, high-risk tissue types (clear cell carcinoma, serous papillary adenocarcinoma, and adenosquamous carcinoma), and the like, and subsequent adjuvant treatments such as radiotherapy, chemotherapy, hormones, and the like are added.

However, there is no general consensus on whether or not to add, how to add, etc. the adjuvant therapy for early-stage endometrial cancer, and there is a big debate in clinical choice of postoperative adjuvant therapy, in clinical practice, whether or not the adjuvant therapy after the normative surgical pathology is added depends on the clinical experience and subjective choice of the physician, while the recurrence of patients in early stage without high risk factors is still the main reason for long-term prognosis. These are all places in clinical diagnosis and treatment where decision making and uniform consensus achievement are difficult, and there is a need to further verify the diagnosis and treatment scheme, accumulate clinical experience, evidence of medicine, and finally achieve consensus. The exploration of the basis for the addition of adjuvant therapy and the evaluation of clinical prognosis are also one of the problems to be solved at present.

1.3 clinical characteristics of recurrent endometrial cancer cases in our hospital in recent years

General data on recurrent endometrial cancer

22 cases with confirmed diagnosis of endometrial cancer in 2006-1-2016, receiving standard staged endometrial cancer surgery, complete clinical data, relapse of follow-up tumor, and receiving reoperation or puncture pathological confirmation are collected.

The median age for endometrial cancer was first confirmed to be 52 years (44-63 years). The clinical symptoms are: post-menopausal vaginal bleeding 12 cases (54.5%), vaginal drainage 2 cases (9.1%), irregular vaginal bleeding during non-menstrual periods 4 cases (18.2%),

pus accumulation/fluid in uterine cavity 1 case (4.5%), abdominal pain 2 cases (9.1%), and ultrasound examination without symptoms found 1 case (4.5%). Vaginal ultrasound revealed 21 abnormal echoes (95.5%) in the uterine cavity and 12 abnormal blood flow signals (54.5%) in the uterine cavity. The 12 cases received the pelvic cavity enhancement MRI examination, all suggested the intrauterine abnormality, and 8 cases suggested the endometrium binding band to be unclear. Before operation, pathological examination of endometrium is carried out, and endometrial cancer is diagnosed. Preoperative clinical staging of FIGO (81.2%) in stage I and 4 (18.2%) in stage II. The patients with hypertension were 12 cases (54.5%) and diabetes was 8 cases (36.4%).

First treatment of the condition

The endometrial cancer is received, staged operation is determined, the uterus is completely treated, double-accessory resection, pelvic lymph node resection, abdominal aorta side lymph node resection are performed, the endometrium pathology is scraped in the preoperative diagnosis, or the freezing pathology in the operation is confirmed to be the simultaneous resection of the omentum in the endometrial cancer operation of II type.

Type I endometrial cancer 18 cases (81.8%: highly differentiated 12 cases, moderately differentiated 5 cases, poorly differentiated 1 case), type II

4 cases of endometrial cancer (18.2%: serous adenocarcinoma 3 cases, clear cell carcinoma 1 case); muscle layer infiltration < 1/214 cases (63.6%), muscle layer infiltration > 1/27 cases (31.8%), muscle layer infiltration up to 1 case of serosal layer (4.5%); lymph nodes were positive in 4 cases (18.2%), pelvic lymph nodes and lymph nodes beside abdominal aorta. Clinical pathological staging (fino 2009) 12 cases in IA (54.5%), 5 cases in IB (22.7%), 1 case in II (4.5%), 4 cases in IIIC1 (18.2%).

According to NCCN guidelines, whether to add adjuvant therapy is determined according to the clinical pathological stage and whether high risk factors exist. 12 cases (54.5%) without any adjuvant treatment, 4 cases (18.2%) with postoperative chemotherapy, 2 cases with intracavitary (9.1%) radiotherapy, 2 cases with extra-pelvic (9.1%) radiotherapy, 2 cases with progestin (9.1%) treatment.

Criteria for diagnosis of recurrence, time of recurrence, and site of recurrence

The recurrent patients all receive the reoperation or the local focus puncture biopsy, and the endometrial cancer is confirmed to recur through pathology.

The median diagnosis time from the first operation to the recurrence is 4 years (1.5-7 years), 14 recurrence cases (63.6%) in the pelvic cavity, wherein 12 recurrence cases are mainly located in the vaginal amputation area, and 2 recurrence cases are located on the left side of the rear of the bladder; retroperitoneal iliac perivascular lymph nodes recurred 6 cases (27.3%); anterior extraperitoneal metastasis with pulmonary metastasis in 1 case (4.5%); lung transfer 1 case (4.5%).

Two of the lung metastases were patients in FIGO IA stage, with superficial muscle layer infiltration and high-medium differentiation, and thus, early-stage intimal cancer without high risk factors of recurrence and distant metastasis also occurred.

1.4 recurrence and distant metastasis of early-stage intimal cancer without high risk factors

Even if the early-stage endometrial cancer patients do not have high-risk factors such as low-differentiation endometrioid cancer, lymphangioma embolus, high-risk tissue types (clear cell carcinoma, serous papillary adenocarcinoma and adenosquamous carcinoma), deep muscle layer infiltration, cervical involvement and the like, a certain recurrence rate still exists after the operation, the distant metastasis of tumors is contained, and the common part is a lung. Patients with endometrial cancer relapse, especially early-stage endometrial cancer relapse, are not limited to local pelvic relapse, and there are also cases reported that the endometrial cancer relapses remotely, such as liver, lung, bone and the like [15], and there are also cases that early-stage non-high-risk endometrial cancer patients have lung metastasis and abdominal wall metastasis in our hospital. Whether other factors exist or not is the factor of relapse, and further research is needed.

1.5 summary of circulating tumor cells and methods for their detection

1.5.1 overview of circulating tumor cells

Circulating Tumor Cells (CTCs) refer to tumor cells with primary tumors or metastases shed into the blood, and it was first proposed that in 1869 that some of the CTCs entering the blood may have the ability to clone and grow to form metastases in a tissue-supported microenvironment, so that the number and molecular characteristics of CTCs can be used as a real-time noninvasive real-time "liquid biopsy" to provide clinical information about prognosis, treatment selection, effectiveness, and the like. The research shows that the existence and clinical significance of CTC in malignant tumor suggest that CTC is an independent prediction factor of poor prognosis, the progression-free survival period and the total survival period of patients with positive CTC detection are obviously shorter than those of patients with negative CTC detection, and the number of CTC is reduced after effective cytoreductive surgery or radiotherapy and chemotherapy, which indicates that CTC can assist in detecting the treatment effect so as to guide further treatment.

1.5.2 circulating tumor cell enrichment method

The current CTC enrichment method mainly comprises two aspects, namely positive or negative screening according to the biological characteristics of CTCs such as the expression of protein markers, for example, positive screening according to anti-epithelial markers or anti-mesenchymal markers or both, or negative screening according to anti-CD 45 to eliminate unwanted lymphocytes and the like; on the other hand, positive or negative enrichment is based on the physical characteristics of CTCs, such as size, density, charge, deformability, etc., such as density-based density gradient centrifugation (Ficoll density gradient), CTC-chip based on cell size, etc., each of which has its advantages and limitations.

1.5.3 endometrial cancer circulating tumor cell-related Studies

CTCs can be used as markers for predicting tumor progression and survival and also for early diagnosis of tumors since CTCs can be detected in patients at an early stage, and high numbers of CTCs are associated with aggressive disease, increased metastasis and decreased recurrence time [21 ]. The correlation study of CTC by Bogani on 28 patients with high-risk endometrial cancer shows that the CTC positive rate is 7%, and the number of CTC cells is correlated with muscle layer infiltration and lymph node positivity. The CK19 and CK20 are used for detecting CTC, the positive rate of a patient before the study of intimal cancer is 10% -35% [23], the positive rates of CTC in high-risk and low-risk groups of intimal cancer are respectively 53% and 50% in Klein study, a relapsed patient is 100%, the CTC is not detected in a negative control group, the CTC can form a metastatic focus [25] in an experiment of an in-vitro xenotransplantation model, and the CTC is gradually applied to a detection method for non-invasive real-time diagnosis, prognosis, chemotherapy treatment effect or drug resistance and the like, and is a tool for evaluating tumor heterogeneity.

For endometrial cancer patients, are there a high risk of hematogenous metastasis in the early stages of the tumor, such as the clinical features of peripheral blood CTCs and the presence or absence of a correlation between CTCs? It is the purpose of our study to carry out.

Disclosure of Invention

The invention aims to provide a kit capable of accurately detecting endometrial cancer markers, mainly relates to a detection kit and a composite detection technology for detecting endometrial cancer cells in peripheral blood of a patient with endometrial cancer, in particular to a detection technology and a kit for detecting endometrial cancer cells (malignant tumor cells) with high accuracy, and particularly relates to a detection kit capable of detecting free-ion endometrial cancer cells remaining in blood after radiotherapy and chemotherapy treatment.

The invention idea is as follows: the biological activity of tumor cells in blood circulation of an endometrial cancer patient is detected by adopting methods of magnetic bead separation, reverse transcription-multiplex PCR and other molecular biology, the development and the prognosis of the endometrial cancer are determined by detecting the expression levels of PAX8, ER and P53, and theoretical basis and experimental evidence are provided for individualized treatment of the endometrial cancer.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention provides a kit for detecting endometrial cancer markers in peripheral blood, which comprises the following components:

magnetic beads with endometrial cancer antibody bound:

magnetic beads to which oligonucleotide oligo (dT) is bound;

a buffer solution A; 100-

And (3) buffer solution B: 100-;

lysis/binding buffer 150-250 mL;

4.0-5.0mL of 10 Xbuffer solution;

dNTPs，5mM each 4.0-5.0mL

reverse transcriptase, 10000U/. mu.L 2.0-3.0mL

RNase inhibitor, 40U/. mu.L 0.4-0.6mL

2-3mL of 2 Xmultiplex PCR mixture

1-2mL of RNase-free water;

endometrial cancer tumor marker primer 10 mu mol/L3.0-5.0 mL;

wherein the endometrial cancer tumor marker is one or more of EpCAM, MUC1, CK 20;

the ER primer sequence is as follows:

the upstream primer is shown as SEQ ID NO: 1, and the following components: TTGCTATGTTACTAAGCGTGAG, respectively;

the downstream primer is shown as SEQ ID NO: 2, as shown in the figure: GGTGCTATAATAAACCCTTGAC, respectively;

the PAX8 primer sequence is as follows:

the upstream primer is shown as SEQ ID NO: 3, showing: GAAGCAATAGCCGAGGAA, respectively;

the downstream primer is shown as SEQ ID NO: 4, and (2) is as follows: TGTAGAAAGAGCCAAGCAAA, respectively;

the sequence of the P53 primer is as follows:

the upstream primer is shown as SEQ ID NO: and 5, as follows: ACCTATGGAAACTACTTCCTGAAA, respectively;

the downstream primer is shown as SEQ ID NO: 6, showing: ACCATCGCTATCTGAGCAGC, respectively;

the endometrial cancer antibody is an anti-EpCAM monoclonal antibody, an anti-MUC 1 monoclonal antibody and an anti-CK 20 monoclonal antibody.

Wherein the 2 Xmultiplex PCR mixture contains 5U/. mu.L of HotStarTaq DNA Polymerase.

Wherein the formula of the buffer solution A is as follows: 10mM Tris-HCl, pH 7.5; 0.15M LiCl; 1mM EDTA; 0.1% LiDS.

Wherein the formula of the buffer solution B is as follows: 10mM Tris-HCl, pH 7.5; 0.15M LiCl; 1mM EDTA.

Wherein the lysis/binding buffer formulation: 100mM Tris-HCl, pH 7.5; 500mM LiCl; 10mM EDTA, pH 8; 1% LiDS; 5mM dithioritol.

The tumor markers used for enriching endometrial cancer cells in circulating blood are EpCAM and CK 20; and markers for endometrial cancer identified were EpCAM, KRT19, and MUC 16.

Preparing a primer:

the primers were each first diluted to 10. mu.M (i.e., 10. mu. mol/L), and then the primer mix was added with water to a concentration of 2. mu.M per primer and a final concentration of 0.2. mu.M per primer in the multiplex PCR reaction system.

In use, 25. mu.L of the antibody-labeled magnetic beads were used per 1mL of blood.

And (3) analyzing a reaction result:

analysis of PCR products using Agilent 2100 bioanalyzer:

the invention has the beneficial effects that:

the invention provides a kit for detecting endometrial cancer markers in peripheral blood, which has the advantages of small sample detection amount, small damage to patients, high detection sensitivity, low detection amount of cancer cells to 2-cell level, namely 2 free cancer cells in a sample can be detected, the endometrial cancer cells or endometrial cancer stem cells can be determined and detected according to the content of the endometrial cancer tumor markers, the detection rate can reach 80%, and theoretical basis and experimental evidence are provided for the individualized treatment of recurrence and relapse of endometrial cancer patients after treatment.

Drawings

FIG. 1 is a diagram showing the result of the effectiveness test of the kit provided by the present invention.

FIGS. 2 and 3 show the results of the expression of PAX8, ER and P53 in CTC of pancreatic cancer patients in the kit provided by the present invention.

Detailed Description

Materials and instruments used in the present invention:

material

1. The human endometrial cancer cell line RL95-2 was purchased from the Chinese academy of sciences cell bank.

2. Magnetic beads for binding antibodies

M-450Tosylactivated was purchased from Invitrogen, USA.

3. Magnetic beads for binding oligonucleotides are

Oligo (dT)25 was purchased from Invitrogen, USA.

4. Three monoclonal antibodies, an anti-EpCAM monoclonal antibody, an anti-MUC 1 monoclonal antibody and an anti-CK 20 monoclonal antibody, were purchased from abcam, usa.

5.10 × buffer: the reaction Buffer was a Sensiccript Reverse Transcriptase reaction Buffer (10 Xbuffer RT) from QIAGEN, USA.

dNTPs, reverse transcriptase, RNase inhibitor were purchased from QIAGEN, USA.

7. Primer synthesis was performed by beijing oko.

8. Agilent 2100 bioanalyzer.

9. The test tube rotates the mixer.

Reagent:

1. phosphate balanced salt solution (PBS, pH7.4)

2. Magnetic bead sorting related reagent

mRNA magnetic bead enrichment related reagent

Example 1: preparation of magnetic beads binding endometrial cancer antibodies:

the dosage is as follows: about every 25 μ L (1X 10)⁷) Dynabeads labeled 5ug antibody

Below, 1mL (4X 10) of the combination⁸) Dynabeads procedure:

1. magnetic beads resuspending 1mL of liquid

M-450 Tosyllactivated into EP tubes;

2. placing the EP tube on the magnetic bead enricher for 1min, discarding the supernatant, and taking the EP tube off the magnetic bead enricher;

3. resuspending the magnetic beads with buffer1, placing on a magnetic bead enricher for 1min, discarding the supernatant, repeating for three times, and finally resuspending in buffer 1;

4. add 200. mu.L of antibody to 1mL of magnetic beads resuspended in buffer 1;

incubating at 5.37 ℃ for 16-24 hours with gentle inclined rotation;

6. placing the EP tube on a magnetic bead enrichment device for 1min, and discarding the supernatant;

7. washing with 1mL buffer2 at 2-8 deg.C for 5min, placing on a magnetic bead concentrator for 1min, discarding supernatant, and repeating for 3 times;

8. resuspend the magnetic beads in 1mL buffer 2;

9. adding 2% NaN ₃10 μ L, which is to prevent bacterial growth.

The antibodies used were an anti-EpCAM monoclonal antibody, a MUC1 monoclonal antibody and an anti-CK 20 monoclonal antibody, and the 3 antibodies were labeled and then the 3 labeled magnetic beads were mixed in equal amounts.

Example 2: isolation of endometrial cancer cells:

2.1 sample treatment:

5mL of peripheral blood of patients with endometrial cancer suffering from primary disease or relapse is taken, EDTA is used for anticoagulation, and the endometrial cancer is stored at 4 ℃ and used within 48 hours.

2.2 magnetic bead treatment:

repeatedly washing the magnetic beads combined with the endometrial cancer antibodies (antibody-labeled magnetic beads are mixed magnetic beads for labeling three antibodies, and the antibody-labeled magnetic beads are prepared according to the proportion of adding 25 mu L of magnetic beads into 1mL of samples) with buffer2 for three times, separating the magnetic beads, and keeping on ice for later use;

the specific operation is as follows: sucking 125 mu L of magnetic beads marked with antibodies, adding the magnetic beads into a centrifugal tube with the volume of 1.5mL, slightly blowing and sucking the mixture by a liquid shifter, uniformly mixing (paying attention to the fact that a vortex mixer cannot be used), placing the mixture on a magnetic bead enricher, standing for 1min to enable the magnetic beads to be attached to the wall of the centrifugal tube, and removing supernatant; then adding 200 mu L of buffer2, resuspending and uniformly mixing magnetic beads, placing on a magnetic bead concentrator for 1min to ensure that the magnetic beads are attached to the wall of the centrifugal tube, and removing the supernatant; washing with buffer2 for 3 times in the same way; finally, the supernatant was removed and 200. mu.L of buffer2 was added and kept on ice until use.

And magnetic bead enrichment devices are used for separating magnetic beads in the subsequent steps.

2.3 sorting of endometrial cancer cells:

adding a peripheral blood sample and antibody-labeled magnetic beads into a 15mL conical centrifuge tube (reaction tube), placing the reaction tube on a test tube rotary mixer at 4 ℃, incubating for 30min at the speed of 10rpm, placing the reaction tube on a magnetic bead enricher after incubation (note that blood on the cover is also collected into the tube), and standing for 5 min; then using a pasteur pipette or a 10ml pipette to completely remove the blood, without touching the magnetic beads; separating magnetic beads, and removing supernatant; adding 5ml of buffer2, covering the tube cap, turning upside down for washing (no direct blowing and sucking by a pipette), and finally adding the residual liquid on the tube cap into the tube; placing the reaction tube on a magnetic bead enrichment device, standing for 1min, and discarding the supernatant; repeating the steps for three times (total four times of washing), and adding 3ml, 1ml and 1ml of washing liquid for the last three times; taking down the reaction tube, adding 200 μ l of lysis solution, washing adherent magnetic beads, repeatedly blowing and sucking for at least five times, placing on a magnetic bead enrichment device, and standing for 1 min; the lysed supernatant was aspirated into a new 1.5ml tube and kept on ice until needed (the lysed supernatant was either stored at-80 ℃ for no more than 2 weeks).

Example 3: detection of endometrial cancer cell markers:

3.1 magnetic bead extraction of mRNA

Resuspending and mixing magnetic beads by using pipettor

Oligo (dT)25, and pipette 40. mu.l into a 1.5ml tube; standing on a small magnetic bead enricher, and after 30s, removing the supernatant; taking down the 1.5ml tube, adding 40 mul of binding solution, resuspending and uniformly mixing magnetic beads, standing on a small magnetic bead enricher, and discarding the supernatant after 30 s; take down 1.5An ml tube, adding the lysis supernatant into a 1.5ml tube filled with magnetic beads; placing 1.5ml tube on a test tube rotary mixer, incubating at 10rpm for 15min at room temperature; standing for 2min on a small magnetic bead enricher, removing the supernatant, and taking down; adding 200 mul of buffer solution A, resuspending and uniformly mixing magnetic beads, placing on a small magnetic bead enricher for 30s, removing the supernatant, and taking down the centrifugal tube; adding 200 mul of buffer solution A, re-suspending and uniformly mixing the magnetic beads, placing the mixture on a small magnetic bead enrichment device for 30s, removing the supernatant, and taking down the centrifugal tube; adding 200 mul of buffer solution B, resuspending and uniformly mixing magnetic beads, placing on a small magnetic bead enrichment device for 30s, removing a supernatant, and taking down a centrifugal tube; add 100. mu.l of H₂O, resuspending and uniformly mixing the magnetic beads, placing the mixture on a small magnetic bead enrichment device for 30s, removing the supernatant, and taking down the centrifugal tube; 29.5. mu. l H was added₂O, resuspending and uniformly mixing the magnetic beads, and placing the mixture in a water bath (or metal bath) at the temperature of 55 ℃ for 5 min; the 1.5ml tube was then immediately placed on ice for at least 2 min.

The mRNA/magnetic bead mixture could not be stored and reverse transcription was performed immediately.

3.2 reverse transcription:

the reverse transcription step is as follows:

reverse transcription procedure:

storing at 37 deg.C for 60min and 4 deg.C.

The reverse transcribed cDNA was stored on ice or at-20 deg.C (up to 2 weeks).

The reaction was performed while RNase-free water was used instead of the sample as a negative control.

3.3 multiplex PCR

The primer sequence is as follows:

the positive controls were: collecting an endometrial cancer cell line RL95-2, extracting RNA, performing reverse transcription and translation to obtain positive control cDNA;

negative controls were: high purity water.

Reaction system

PCR procedure

15min at 95 ℃; 45s at 94 ℃, 90s at 58 ℃, 60s at 72 ℃ and 35 cycles; 30min at 60 ℃; infinity at 4 ℃

The PCR product was stored on ice or at-20 ℃.

3.5 analysis of results

The PCR products were analyzed by Agilent bioanalyzer for all experimental configurations.

1) All patient samples must have a band for the Actin gene (internal standard);

2) negative controls for reverse transcription failed to have bands greater than 80 nucleotides;

3) if the product is larger than 1kb, contamination by genomic DNA (introns) is indicated;

4) in the experiment, any one of 3 positive bands in the PCR product is positive, and the result can be judged to be positive;

5) in the PCR result, 3 PCR products except Actin exist in the tumor cells, and the PCR product of EpCAM is related to the epithelial cells which are the sources of the tumor cells;

6) in the PCR result, other 3 bands than Actin are necessary to appear at each time, and can randomly appear. However, the lowest PCR detection should be 2 cells, i.e. any of 3 PCR products can be detected as long as 2 or more than 2 tumor cells or tumor stem cells are present in the sample to be detected.

The reliability of three identified markers was first determined by multiplex PCR, and FIG. 1 shows the results of identifying three markers in the RL95-2 endometrial cancer cell line. After RNA reverse transcription cDNA is extracted from the endometrial cancer cell line RL95-2, multiple PCR results of PAX8, ER and P53 are respectively carried out, and Actin is selected as an internal reference.

67 primary diagnoses or recurrent pathological diagnoses of patients with endometrial cancer are taken, and the average age is 56.1 years (21-81 years); 20 healthy volunteers, excluding systemic malignancies, served as a negative control group with an average age of 53.3 years (25-72 years). 53 patients with type I endometrial cancer (79.1%), 5 patients with type II endometrial cancer (7.5%), and 9 patients with mixed type endometrial cancer (13.4%). 18 cases of high-differentiation endometrial cancer (26.9%), 31 cases of medium-differentiation endometrial cancer (46.3%), and 18 cases of low-differentiation endometrial cancer (26.9%). 49 patients in stage IA (73.1%), 4 patients in stage IB (6.0%), 4 patients in stage II (6.0%), 1 patient in stage IIIA (1.5%), 1 patient in stage IIIB (1.5%), 1 patient in stage IIIC1 (1.5%), 4 patients in stage IIIC 2 (6.0%), and 4 patients in stage IV (6.0%). As less patients are in the stage IB and later stages of the FIGO, the clinical stages are statistically processed into three groups of stages IA, IB-II and IIIA-IVB according to the FIGO stage judgment indexes, and the number of cases in each group is as follows: 49 cases (73.1%) in early stage-IA stage, 8 cases (11.9%) in middle stage-IB-II stage, and 10 cases (14.9%) in late stage-IIIA-IVB stage.

In order to detect the sensitivity of three markers in the kit to the peripheral blood samples of patients, an endometrial cancer cell line RL95-2 is taken as a positive control, healthy volunteers are taken as a negative control, the peripheral blood of the patients is selected, CTC is enriched according to the experimental process, RNA is extracted, the RNA is subjected to reverse transcription to form cDNA, and then the results of the three markers are verified by multiplex PCR. The results showed that CTCs were detected in 41 of 67 patients with endometrial cancer with a positive detection rate of 61.2% (41/67), and no CTCs were detected in 20 normal peripheral blood. The positive expression rate of the PCR product is: PAX 870.1% (29/41), ER 48.8% (29/41), P5329.3% (12/41). FIGS. 2 and 3 show the results of the experiment in which a part of the clinical specimens, the endometrial cancer cell line RL95-2, and the negative control were tested.

The embodiment shows that the kit for detecting the endometrial cancer cells in the peripheral blood has the advantages of simple detection method, small detection sample size, small damage to patients, high detection sensitivity, detection accuracy rate reaching 61.2 percent and credible detection result.

CTCs are detectable in peripheral blood of patients with endometrial cancer; CTC positive is related to tumor differentiation degree, clinical pathological stage, tumor focus size and myometrial involvement; higher positive rates in cases of lymph node metastasis or recurrence; the positive rate of the CTC is related to the high-risk factor of the endometrial cancer, and the CTC can be used as an index for judging the prognosis of the endometrial cancer and guides the selection of postoperative adjuvant therapy to a certain extent. The kit provided by the invention is mainly used for monitoring the endometrial cancer patient after treatment, and provides reliable experimental data for the doctor to evaluate whether the endometrial cancer patient relapses after treatment and the treatment effect.

SEQUENCE LISTING

<110> Beijing cattle Gene technology Co., Ltd

Peking University

Peking University Third Hospital

<120> kit for detecting endometrial cancer cell markers in peripheral blood

<130> DEMO

<160> 8

<170> PatentIn version 3.3

<210> 1

<211> 22

<212> DNA

<213> Artificial sequence

<400> 1

ttgctatgtt actaagcgtg ag 22

<210> 2

<211> 22

<212> DNA

<213> Artificial sequence

<400> 2

ggtgctataa taaacccttg ac 22

<210> 3

<211> 18

<212> DNA

<213> Artificial sequence

<400> 3

gaagcaatag ccgaggaa 18

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence

<400> 4

tgtagaaaga gccaagcaaa 20

<210> 5

<211> 24

<212> DNA

<213> Artificial sequence

<400> 5

acctatggaa actacttcct gaaa 24

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence

<400> 6

accatcgcta tctgagcagc 20

<210> 7

<211> 19

<212> DNA

<213> Artificial sequence

<400> 7

gaaatcgtgc gtgacatta 19

<210> 8

<211> 18

<212> DNA

<213> Artificial sequence

<400> 8

aggcagctcg tagctctt 18

Claims

1. A kit for detecting endometrial cancer cell markers in peripheral blood is characterized by comprising the following components:

magnetic beads to which endometrial cancer antibodies are bound;

magnetic beads to which oligonucleotide oligo (dT) is bound;

a buffer solution A; 100-;

and (3) buffer solution B: 100-;

lysis/binding buffer 150-250 mL;

4.0-5.0mL of 10 Xbuffer solution;

dNTPs，5mM each 4.0-5.0mL；

reverse transcriptase, 10000U/mu L2.0-3.0 mL;

RNase inhibitor, 40U/. mu.L 0.4-0.6 mL;

2-3mL of 2X multiplex PCR mixed solution;

1-2mL of RNase-free water;

endometrial cancer tumor marker primer 10 mu mol/L3.0-5.0 mL;

wherein the endometrial cancer tumor markers are ER, PAX8, and P53;

the ER primer sequence is as follows:

the upstream primer is shown as SEQ ID NO: 1 is shown in the specification;

the downstream primer is shown as SEQ ID NO: 2 is shown in the specification;

the PAX8 primer sequence is as follows:

the upstream primer is shown as SEQ ID NO: 3 is shown in the specification;

the downstream primer is shown as SEQ ID NO: 4 is shown in the specification;

the sequence of the P53 primer is as follows:

the upstream primer is shown as SEQ ID NO: 5 is shown in the specification;

the downstream primer is shown as SEQ ID NO: 6 is shown in the specification;

the endometrial cancer antibody is an anti-EpCAM monoclonal antibody, an anti-MUC 1 monoclonal antibody and an anti-CK 20 monoclonal antibody;

the formula of the buffer solution A is as follows: 10mM Tris-HCl, pH 7.5; 0.15M LiCl; 1mM EDTA; 0.1% LiDS;

the formula of the buffer solution B is as follows: 10mM Tris-HCl, pH 7.5; 0.15M LiCl; 1mM EDTA.

2. The kit of claim 1, wherein the 2 x multiplex PCR mix comprises hot star taq DNA Polymerase 5U/μ L.

3. The kit of claim 1, wherein the lysis/binding buffer formulation: 100mM Tris-HCl, pH 7.5; 500mM LiCl; 10mM EDTA, pH 8; 1% LiDS; 5mM DTT.