CN109371019A - For detecting the primed probe group and its application of rs6065 - Google Patents
For detecting the primed probe group and its application of rs6065 Download PDFInfo
- Publication number
- CN109371019A CN109371019A CN201810967194.0A CN201810967194A CN109371019A CN 109371019 A CN109371019 A CN 109371019A CN 201810967194 A CN201810967194 A CN 201810967194A CN 109371019 A CN109371019 A CN 109371019A
- Authority
- CN
- China
- Prior art keywords
- sequence
- component
- probe
- nucleotide
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of for detecting the primed probe group and its application of rs6065.The present invention protects a kind of primed probe group first, is made of primers F, primer R and probe P；Primers F is single strand dna shown in the sequence 1 of sequence table；Primer R is single strand dna shown in the sequence 2 of sequence table；Probe P is the single strand dna that an end has fluorescent quenching group with fluorophor and another end, and the partial nucleotide in DNA molecular is lock nucleic acid, and the nucleotides sequence of DNA molecular is classified as shown in the sequence 3 of sequence table.The present invention can be used for detecting rs6065, judge genotype of the sample to be tested based on the site, so that doctor be instructed to take corresponding therapeutic scheme to patient, have great application and popularization value.
Description
Technical field
The present invention relates to a kind of for detecting the primed probe group and its application of rs6065.
Background technique
Immune thrombocytopenia (immune thrombocytopenia, ITP) is that autoimmune disorder generates anti-blood
Platelet antibodies, so that platelet destruction increases, in addition disease caused by megakaryocytic maturation obstacle thrombocytopoiesis is reduced.Treatment
Using cortex hormone of aadrenaline, gamma globulin and immunosuppressor as main method.But clinically many age of onset it is small (earlier than
1 year old), the regular treatment still intractable infant without alleviation for many years, it is likely that or mutually opposite with blood platelet with defective platelet function
The coagulation factor functional defect answered is related.It is meaningful whether there is or not influencing on intractable ITP to inquire into these functional defects.
Platelet antibody is in fact exactly membrane glycoprotein antibody, it is now recognized that primarily directed to platelet membrane glycoprotein
(GP1BA) antibody, the variation of GP1BA make it possible to body and are also easy to produce corresponding antibody, it is also possible to so that platelet activation increases
Add, leads to platelet-type pseudohemophilia.
The generation of platelet antibody is related with virus infection, and (viral sensitization) produces antiplatelet film when body disease-resistant poison
Glycoprotein (GP1BA) antibody leads to the destruction of blood platelet in turn.It is controlled to infant using hormone, gamma globulin, immunosuppressor
After treatment, blood platelet is able to maintain that in normal state.But for intractable early infant of especially falling ill, usually gene becomes
It is different to cause to expose antigenic component, so that blood platelet is become the target cell of normal antibody, leads to the platelet destruction of immunity；
GP1BA genetic mutation may cause the antigen that GP1BA part-structure is directly becoming immune response, and induction body, which produces, to be directed to
The specific antibody substance of GP1BA, cause the immunity of blood platelet to reduce: structure change caused by the genetic mutation of GP1BA can
The exception of platelet function can be will lead to and abnormal aggregation.In addition, GP1BA hereditary variation may allow blood platelet in coagulation process
The function reduction for being attached to endothelial cell is assisted by vWF ELISA, cannot be stopped blooding in time.
Platelet membrane glycoprotein (GP) mainly includes I b- of platelet membrane glycoprotein, Ⅸ compound (I b- Ⅸ of GP), platelet membrane
II b- of glycoprotein, III a compound (II b- of GP, III a) etc..The specificity and sensibility of platelet membrane glycoprotein detection are high, therefore to examining
Disconnected bernard-Soulier syndrome and thrombasthenia have diagnostic value.
557 SNP site nucleotide of studies have shown that GP1BA gene sport T by C, so that the amino acids are by threonine
Methionine is sported, to change the property of membrane glycoprotein, blood platelet is caused to be destroyed.Base is carried out for the SNP site
Because of detection, there is great clinical value.
Summary of the invention
The object of the present invention is to provide a kind of for detecting the primed probe group and its application of rs6065.
The present invention protects a kind of primed probe group first, is made of primers F, primer R and probe P；
Primers F is following (a1) or (a2):
(a1) single strand dna shown in the sequence 1 of sequence table；
(a2) have by sequence 1 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 1 identical
The DNA molecular of function；
Primer R is following (b1) or (b2):
(b1) single strand dna shown in the sequence 2 of sequence table；
(b2) have by sequence 2 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 2 identical
The DNA molecular of function；
Probe P is the single strand dna that an end has fluorescent quenching group with fluorophor and another end, and
Partial nucleotide in DNA molecular is lock nucleic acid, and the nucleotides sequence of DNA molecular is classified as following (c1) or (c2):
(c1) shown in the sequence 3 of sequence table；
(c2) by sequence 3 by the substitution and/or deletion and/or addition of one or several nucleotide.
Probe P is 5 ' ends with FAM fluorophor and 3 ' ends have the single stranded DNA point of BHQ1 fluorescent quenching group
Son.
Specifically, the nucleotide sequence of the probe P is as shown in the sequence 3 of sequence table, and 2-4 nucleotide and
26-28 nucleotide are lock nucleic acid.
In the primed probe group, the mol ratio of primers F, primer R, probe P are as follows: 2:15:2.
The present invention also protects the primed probe group preparing the application in the kit for detecting rs6065.
The present invention also protects a kind of for detecting the kit of rs6065, including the primed probe group.
The present invention also protects component first and component second preparing the application in the kit for detecting rs6065；Component first
For the primed probe group；Component second is that reagent or reagent combine, and the function of component second is to be used for fluorescence with blood sample preparation
The template samples of quantitative PCR.Component second includes lysate.The lysate is the NaCl aqueous solution of 1.5-2 g/100ml, specifically
It can be the NaCl aqueous solution of 1.7 g/100ml.Component second further includes saving liquid.Save the preparation method of liquid: 1. by 25 parts by volume
FG buffer and the mixing of 4 parts by volume Proteinase K Solutions, obtain mixed liquor；2. 1. mixed liquor and 5 that 1 parts by volume step is obtained
Parts by volume ddH2O mixing obtains saving liquid.
The present invention also protects a kind of for detecting the kit of rs6065, including component first and component second；Component first is institute
State primed probe group；Component second is that reagent or reagent combine, and the function of component second is to be used for fluorescent quantitation with blood sample preparation
The template samples of PCR.Component second includes lysate.The lysate is the NaCl aqueous solution of 1.5-2 g/100ml, concretely
The NaCl aqueous solution of 1.7 g/100ml.Component second further includes saving liquid.It saves the preparation method of liquid: 1. delaying 25 parts by volume FG
Fliud flushing and the mixing of 4 parts by volume Proteinase K Solutions, obtain mixed liquor；2. 1. mixed liquor that 1 parts by volume step is obtained and 5 volumes
Part ddH2O mixing obtains saving liquid.
The present invention also protects a kind of kit, including lysate.The function of the kit is with blood sample preparation for glimmering
The template samples of Fluorescent Quantitative PCR.The lysate is the NaCl aqueous solution of 1.5-2 g/100ml, concretely 1.7 g/100ml
NaCl aqueous solution.The kit further includes saving liquid.Save the preparation method of liquid: 1. by 25 parts by volume FG buffers and 4
The mixing of parts by volume Proteinase K Solution, obtains mixed liquor；2. 1. mixed liquor and 5 parts by volume ddH that 1 parts by volume step is obtained2O
Mixing obtains saving liquid.
A kind of method that the present invention also protects template samples with blood sample preparation for quantitative fluorescent PCR, including such as
Lower step:
(1) anticoagulation is taken, the lysate is added, is mixed by inversion, supernatant is abandoned in centrifugation；
(2) after completing step (1), the preservation liquid, 60-70 DEG C first (concretely 65 DEG C) water-bath, then 80-90 DEG C of (tool is added
Body can be 85 DEG C) water-bath, it is then centrifuged for, when use takes supernatant, as template samples.
The method of the template samples with blood sample preparation for quantitative fluorescent PCR, specifically comprises the following steps:
(1) 65 μ L EDTA anticoagulations are taken, lysate described in 500 μ L of addition is mixed by inversion, 12000rpm centrifugation 4min, in abandoning
Clearly；
(2) it after completing step (1), is added and saves liquid described in 120 μ L, first 65 DEG C of water-bath 10min, then 85 DEG C of water-bath 10min, then
12000rpm is centrifuged 4min, is subsequently placed in 4 DEG C and saves backup, and when use takes supernatant, as template samples.
The present invention also protects specific probe carrying out the application in fluorescence quantitative PCR detection；The specific probe be with
The molecular beacon of lock nucleic acid modification.
The present invention also protects a kind of specific probe for fluorescence quantitative PCR detection, for the molecule modified with lock nucleic acid
Beacon.
Any description above rs6065 is the 47th nucleosides of nucleotide shown in the sequence 4 of sequence table in human gene group DNA
Acid.
Nucleotide shown in sequence 4 of any description above rs6065 for sequence table in the GP1BA gene in human genome
47th nucleotide.
The present invention is directed to detect the Genotyping of most important mononucleotide polymorphism site in GP1BA gene, determine to suffer from
Person's whether there is gene mutation, so that doctor be helped correctly to select have targetedly therapeutic scheme.
Primed probe group provided by the invention using molecular beacon as probe, and introduces several lock nucleic acids.Molecule
Beacon is a kind of fluorescence probe, by ring-shaped area and stem district's groups at the 5' end mark fluorophor in stem area, the end 3' is marked
Remember quencher, is in hairpin structure when closure, the fluorescence that fluorophor issues is quenched group absorptions, whole not issue fluorescence letter
Number.In the presence of target sequence, in conjunction with target sequence, stem part is forced to open ring portion, fluorophor far from quenching group,
Issue fluorescence.Δ Tm value very little between nucleotide chain with mononucleotide difference, general detection means are difficult to differentiate between.Lock nucleic acid
It is a kind of double-ring oligonucleotide derivative, base pair complementarity principle can be followed in conjunction with nucleic acid, the β-D- in structure
2'-O and 4'-C of ribofuranose act on forming Oxymethylene bridge, sulphur methylene bridge or amine methylene bridge by shrink, and even
It is connected into annular, this annular bridge has locked the N configuration of furanose C3'- inner mold, reduces the flexibility of ribose structure, increases
The stability of phosphate backbone partial structurtes.In LNA/DNA heteroduplex, one LNA monomer of every increase, Tm improves 2-6 DEG C.
The application method of primed probe group provided by the invention: template samples are prepared with blood sample, then use primer
Probe groups carry out unbalanced fluorescent quantitative PCR, judge genotype by observing melting curve.Imbalance amplification: it is added
The excessive and reversed primer of probe, a small amount of primer in the same direction with probe and suitable probe P, after amplification, due to
Side primer is present in excess, and the template strand that participation amplification obtains is extra far more than the chain obtained with other side primer amplification
The not formed double-strand of template strand, the individualism in system.
The method of template samples provided by the invention with blood sample preparation for quantitative fluorescent PCR, it is easy to operate,
Product may be implemented to carry out effective fluorescent quantitative PCR as template.
Provided by the present invention for the specific probe of fluorescence quantitative PCR detection, for the molecular beacon modified with lock nucleic acid.
The Tm value of nucleotide combination double-strand can be significantly improved due to introducing lock nucleic acid.By controlling the temperature change of melting curve,
To control the closure of molecular beacon, analyzes to obtain fluorescence curve by data and change corresponding peak value map and distinguish open country well
The mutation chain of raw chain and unit point.In addition, will appear two peaks in the peak value map of melting curve for heterozygous sample
Value, avoids general PCR and expands the cumbersome of definitive result twice.
The present invention can be used for detecting rs6065, judge genotype of the sample to be tested based on the site, to instruct doctor couple
The treatment of patient has great application and popularization value.
Detailed description of the invention
Fig. 1 is the melting curve of exemplary sample (CC is homozygous).
Fig. 2 is the melting curve of exemplary sample (TT is homozygous).
Fig. 3 is the melting curve (CT heterozygous) of exemplary sample.
Fig. 4 is the melting curve of exemplary sample (CC is homozygous).
Fig. 5 is the melting curve of exemplary sample (TT is homozygous).
Fig. 6 is the melting curve (CT heterozygous) of exemplary sample.
Fig. 7 is the melting curve of exemplary sample (CC is homozygous).
Fig. 8 is the melting curve of exemplary sample (TT is homozygous).
Fig. 9 is the melting curve (CT heterozygous) of exemplary sample.
Specific embodiment
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly
What routine biochemistry reagent shop was commercially available.Quantitative test in following embodiment is respectively provided with three repeated experiments, as a result makes even
Mean value.Unless otherwise specified, each nucleotide in primer, probe and target sequence is the nucleotide on conventional meaning.
Embodiment 1, the design of primed probe group for detecting rs6065
By largely designing, preliminary experiment, effect compare, obtain one group for detecting the primed probe group of rs6065.
Primers F: 5'- TACCTGAAAGGCAATGAGCTGAAGA -3'；
Primer R:5'- CTCAGTCAAGTTGTTGTTAGCCAGA -3'；
Probe P:5'-FAM- AGACGCCCACACCCAAGCAGGAATAGTCA -BHQ1-3'。
Primers F is single strand dna shown in the sequence 1 of sequence table.Primer R is single-stranded shown in the sequence 2 of sequence table
DNA molecular.Probe P is 5 ' ends with FAM fluorophor and 3 ' ends have the single stranded DNA point of BHQ1 fluorescent quenching group
Son, the nucleotide sequence of DNA molecular is as shown in the sequence 3 of sequence table, nucleotide (i.e. the 2nd, the 3rd, the of underscore mark
4, the 26th, the 27th and the 28th) it is lock nucleic acid (LNA).
The target sequence of primers F and primer R are as shown in the sequence 4 of sequence table.
The application of embodiment 2, primed probe group for detecting rs6065
One, blood sample processing (processing method of single blood sample)
1,65 μ L EDTA anticoagulations are taken, 500 μ L lysates are added, are mixed by inversion, 12000rpm is centrifuged 4min, abandons supernatant.
Lysate are as follows: 1.7g/100ml NaCl aqueous solution.
2, after completing step 1,120 μ L is added and save liquid, first 65 DEG C of water-bath 10min, then 85 DEG C of water-bath 10min, then
12000rpm is centrifuged 4min, is subsequently placed in 4 DEG C and saves backup, and when use takes supernatant, as template samples.
It saves the preparation method of liquid: 1. 25 parts by volume FG buffers and 4 parts by volume Proteinase K Solutions being mixed, are mixed
Close liquid；2. 1. mixed liquor and 5 parts by volume ddH that 1 parts by volume step is obtained2O mixing obtains saving liquid.
FG buffer: the Buffer FG in poba gene group DNA extraction system (0.1-20ml) (DP319) kit.Egg
White enzyme K solution: the Proteinase K in poba gene group DNA extraction system (0.1-20ml) (DP319) kit, concentration are
20mg/ml.The producer of poba gene group DNA extraction system (0.1-20ml) (DP319) is that Tiangeng biochemical technology (Beijing) is limited
Company.
Two, the amplification of PCR and the acquisition of fluorescence signal
1, it takes EP to manage, each component is added, prepare reaction system.
Reaction system: 7.5 μ L 2 × Reaction Buffer, 0.12 μ L Taq archaeal dna polymerase solution (Taq containing 0.6U
Archaeal dna polymerase), 0.09 μ L dNTP solution (in dNTP solution contain dATP, dCTP and dGTP, dATP, dCTP and dGTP exist
Concentration in dNTP solution is 33mmol/L), (in dUTP solution, the concentration of dUTP is 100mmol/ to 0.06 μ L dUTP solution
L), 0.06 μ L UDG enzyme solutions (enzyme of UDG containing 0.12U), 3 μ L 5 × PCR Enhancer, 0.3 μ L primers F solution, 0.3 μ L draw
DdH is added in the template samples that object R solution, 0.3 μ L probe P solution, 1 μ L step 1 obtain2O to 15 μ L.In reaction system, draw
The concentration of object F is 2 μM, and the concentration of primer R is 15 μM, and the concentration of probe P is 2 μM.
Buffer: Fei Peng Biological Co., Ltd. of 2 × Reaction.Taq archaeal dna polymerase solution, that is, AnstartTaq
DNA Polymerase, 5U/ μ L, Fei Peng Biological Co., Ltd..UDG enzyme solutions, that is, Uracil-DNA Glycosylase,
2U/ μ L, Fei Peng Biological Co., Ltd..5 × PCR Enhancer: Tiangeng biochemical technology Co., Ltd, article No. RP202.
2, the EP pipe for taking into step 1, is added 25 μ L paraffin.
3, the EP pipe for taking into step 2, carries out quantitative fluorescent PCR.
①50℃ 2min,95℃ 10min；
2. 95 DEG C of 15s, 55 DEG C of 15s, 72 DEG C of 20s, 50 circulations；
③95℃ 5min,20℃ 5min；45 DEG C of 1s, it is then heated up for interval up to 75 DEG C (every since 45 DEG C with 0.3 DEG C
A temperature acquisition fluorescence obtains melting curve) and then 75 DEG C of 15s.
If being shown as unimodal in melting curve, and the corresponding Tm value of peak value is 61.81 DEG C -62.90 DEG C, sample is based on
The genotype of rs6065 is that CC is homozygous.
If being shown as unimodal in melting curve, and the corresponding Tm value of peak value is 47.5 DEG C -48.60 DEG C, sample is based on
The genotype of rs6065 is that TT is homozygous.
If being shown as bimodal in melting curve, and the peak value at two peaks respectively corresponds 61.81 DEG C -62.90 DEG C and 47.5
DEG C -48.60 DEG C, genotype of the sample based on rs6065 is CT heterozygous.
To volunteer's EDTA anticoagulation of 500 informed consents, then detected according to above-mentioned steps, 451
The genotype of volunteer is that CC is homozygous, genotype of 4 volunteers are that TT is homozygous, genotype of 45 volunteers are CT miscellaneous
Mould assembly.It extracts the anticoagulant genomic DNA of EDTA and carries out sequence verification, sequencing result shows the accurate of above-mentioned steps identification
Rate is 100%.
In volunteer's EDTA anticoagulation of 500 informed consents, the result is shown in Figure 1s of 3 exemplary samples, Fig. 2 and
Fig. 3.It is shown as unimodal in the melting curve of exemplary sample in Fig. 1, the corresponding Tm value of peak value is 61.95 DEG C, the volunteer's
Genotype is that CC is homozygous.It is shown as unimodal in the melting curve of exemplary sample in Fig. 2, the corresponding Tm value of peak value is 47.99
DEG C, the genotype of the volunteer is that TT is homozygous.It is shown as bimodal in the melting curve of exemplary sample in Fig. 3, peak value is corresponding
Tm value be respectively 61.99 DEG C and 48.05 DEG C, the genotype of the volunteer is CT heterozygous.
Comparative example 1,
One, blood sample is handled
With the step of embodiment 2 one.
Two, the amplification of PCR and the acquisition of fluorescence signal
1, it takes EP to manage, each component is added, prepare reaction system.
Replace probe P with probe DP, other with the step of embodiment 2 two 1.
Probe DP:5'-FAM-TGACGCCCACACCCAAGCTGGAGAAGCTC-BHQ1-3'.
2, the EP pipe for taking into step 1, is added 25 μ L paraffin.
3, the EP pipe for taking into step 2, carries out quantitative fluorescent PCR.
Response procedures with the step of embodiment 2 one 3.
To 500 parts of EDTA anticoagulations in embodiment 2, then detected according to above-mentioned steps.
The sample standard deviation of each genotype is shown without effective peak.
The result of 3 exemplary samples is shown in Fig. 4 (CC is homozygous), Fig. 5 (TT is homozygous) and Fig. 6 (CT heterozygous).
Comparative example 2,
One, blood sample is handled
With the step of embodiment 2 one.
Two, the amplification of PCR and the acquisition of fluorescence signal
1, it takes EP to manage, each component is added, prepare reaction system.
Replace primers F with primer DF, and replace primer R with primer DR, other with the step of embodiment 2 two 1.
DF:5'-CAAGAGCTCTACCTGAAAGG-3'；
DR:5'-GGGAGCTCAGTCAAGTTG-3'.
2, the EP pipe for taking into step 1, is added 25 μ L paraffin.
3, the EP pipe for taking into step 2, carries out quantitative fluorescent PCR.
Response procedures with the step of embodiment 2 one 3.
To 500 parts of EDTA anticoagulations in embodiment 2, then detected according to above-mentioned steps.
The sample standard deviation of each genotype is shown without effective peak.
The result of 3 exemplary samples is shown in Fig. 7 (CC is homozygous), Fig. 8 (TT is homozygous) and Fig. 9 (CT heterozygous).
Sequence table
<110>Shandong De-Nol Biotechnology Co., Ltd
<120>for detecting the primed probe group and its application of rs6065
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
tacctgaaag gcaatgagct gaaga 25
<210> 2
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
ctcagtcaag ttgttgttag ccaga 25
<210> 3
<211> 29
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
agacgcccac acccaagcag gaatagtca 29
<210> 4
<211> 99
<212> DNA
<213> Homo sapiens
<220>
<221> misc_feature
<222> (47)
<223> y=c or t
<400> 4
tacctgaaag gcaatgagct gaagaccctg cccccagggc tcctgaygcc cacacccaag 60
ctggagaagc tcagtctggc taacaacaac ttgactgag 99
Claims (10)
1. primed probe group is made of primers F, primer R and probe P；
Primers F is following (a1) or (a2):
(a1) single strand dna shown in the sequence 1 of sequence table；
(a2) have by sequence 1 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 1 identical
The DNA molecular of function；
Primer R is following (b1) or (b2):
(b1) single strand dna shown in the sequence 2 of sequence table；
(b2) have by sequence 2 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 2 identical
The DNA molecular of function；
Probe P is the single strand dna that an end has fluorescent quenching group with fluorophor and another end, and
Partial nucleotide in DNA molecular is lock nucleic acid, and the nucleotides sequence of DNA molecular is classified as following (c1) or (c2):
(c1) shown in the sequence 3 of sequence table；
(c2) by sequence 3 by the substitution and/or deletion and/or addition of one or several nucleotide.
2. primed probe group as described in claim 1, it is characterised in that: the nucleotide sequence such as sequence table of the probe P
Shown in sequence 3, and 2-4 nucleotide and 26-28 nucleotide are lock nucleic acid.
3. primed probe group as claimed in claim 1 or 2 is preparing the application in the kit for detecting rs6065.
4. a kind of for detecting the kit of rs6065, including primed probe group as claimed in claim 1 or 2.
5. component first and component second are preparing the application in the kit for detecting rs6065；Component first is claims 1 or 2
The primed probe group；Component second is that reagent or reagent combine, and the function of component second is fixed for fluorescence with blood sample preparation
Measure the template samples of PCR.
6. a kind of for detecting the kit of rs6065, including component first and component second；Component first is as claimed in claim 1 or 2
Primed probe group；Component second is that reagent or reagent combine, and the function of component second is to be used for quantitative fluorescent PCR with blood sample preparation
Template samples.
7. a kind of kit of the template samples with blood sample preparation for quantitative fluorescent PCR, including lysate；The cracking
Liquid is the NaCl aqueous solution that the lysate is 1.5-2 g/100ml.
8. a kind of method of the template samples with blood sample preparation for quantitative fluorescent PCR, includes the following steps:
(1) anticoagulation is taken, lysate described in claim 7 is added, is mixed by inversion, supernatant is abandoned in centrifugation；
(2) it after completing step (1), is added and saves liquid, first 60-70 DEG C of water-bath, then 80-90 DEG C of water-bath is then centrifuged for, and when use takes
Supernatant, as template samples.
9. specific probe is carrying out the application in fluorescence quantitative PCR detection；The specific probe is point modified with lock nucleic acid
Sub- beacon.
10. a kind of specific probe for fluorescence quantitative PCR detection, for the molecular beacon modified with lock nucleic acid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810967194.0A CN109371019A (en) | 2018-08-23 | 2018-08-23 | For detecting the primed probe group and its application of rs6065 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810967194.0A CN109371019A (en) | 2018-08-23 | 2018-08-23 | For detecting the primed probe group and its application of rs6065 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109371019A true CN109371019A (en) | 2019-02-22 |
Family
ID=65403831
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810967194.0A Pending CN109371019A (en) | 2018-08-23 | 2018-08-23 | For detecting the primed probe group and its application of rs6065 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109371019A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019085278A1 (en) * | 2017-11-03 | 2019-05-09 | 深圳市前海安测信息技术有限公司 | System and method for controlling infusion notification robot on the basis of infrared scanning |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050089914A1 (en) * | 2002-04-12 | 2005-04-28 | Osaka Industrial Promotion Organization | Methods for determining and measuring risk of arteriosclerotic disease, microarray, apparatus and program for determining risk of arteriosclerotic disease |
| US8979753B2 (en) * | 2006-05-31 | 2015-03-17 | University Of Rochester | Identifying risk of a medical event |
| CN108060230A (en) * | 2018-02-07 | 2018-05-22 | 山东德诺生物科技有限公司 | For detecting the primed probe group of rs1045642 and its application |
| CN108070646A (en) * | 2017-06-23 | 2018-05-25 | 安徽安龙基因医学检验所有限公司 | A kind of accurate medication genetic test Solid phase PCR kit of cardiovascular and cerebrovascular disease |
-
2018
- 2018-08-23 CN CN201810967194.0A patent/CN109371019A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050089914A1 (en) * | 2002-04-12 | 2005-04-28 | Osaka Industrial Promotion Organization | Methods for determining and measuring risk of arteriosclerotic disease, microarray, apparatus and program for determining risk of arteriosclerotic disease |
| US8979753B2 (en) * | 2006-05-31 | 2015-03-17 | University Of Rochester | Identifying risk of a medical event |
| CN108070646A (en) * | 2017-06-23 | 2018-05-25 | 安徽安龙基因医学检验所有限公司 | A kind of accurate medication genetic test Solid phase PCR kit of cardiovascular and cerebrovascular disease |
| CN108060230A (en) * | 2018-02-07 | 2018-05-22 | 山东德诺生物科技有限公司 | For detecting the primed probe group of rs1045642 and its application |
Non-Patent Citations (4)
| Title |
|---|
| B. VELDHUISEN等: "Blood group genotyping； from patient to high-throughput donor screening", 《VOX SANGUINIS》 * |
| INGRID RANDEN等: "Rapid and reliable genotyping of human platelet antigen (HPA)-1,-2,-3,-4, and -5 a/b and Gov a/b by melting curve analysis", 《TRANSFUSION》 * |
| 沈彤等: "使用Taqman PCR技术建立人类血小板抗原-1~5、15分型体系", 《中国输血杂志》 * |
| 陈渝宁等: "血小板抗原HPA-2基因分型熔解曲线法分析", 《中国公共卫生》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019085278A1 (en) * | 2017-11-03 | 2019-05-09 | 深圳市前海安测信息技术有限公司 | System and method for controlling infusion notification robot on the basis of infrared scanning |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108060230A (en) | For detecting the primed probe group of rs1045642 and its application | |
| US7914986B2 (en) | Detection of amplicon contamination during PCR exhibiting two different annealing temperatures | |
| KR101153058B1 (en) | Primer set for amplification of ugt1a1 gene, reagent for amplification of ugt1a1 gene comprising the same, and use of the same | |
| AU2015246128A1 (en) | Methods for detecting fetal nucleic acids and diagnosing fetal abnormalities | |
| PT1856257E (en) | Processes using dual specificity oligonucleotide and dual specificity oligonucleotide | |
| JP5818018B2 (en) | Circular primer using nucleic acid amplification and its application | |
| MX2007010875A (en) | Processes using dual specificity oligonucleotide and dual specificity oligonucleotide. | |
| JP5224526B2 (en) | Gene amplification primer set, gene amplification reagent containing the same, and use thereof | |
| WO2001034838A1 (en) | Method of detecting variation or polymorphism | |
| KR20020064896A (en) | Method for synthesizing nucleic acid | |
| KR20100080621A (en) | Method for amplification of target nucleic acid sequence, method for detection of mutation by using the method, and reagents for use in the methods | |
| CN109844137A (en) | For identifying the bar coded cyclic annular library construction of chimeric product | |
| KR950010188B1 (en) | Gaucher's disease detection of a new mutation in intron 2 of the glucocerebrosidase gene | |
| CN109371019A (en) | For detecting the primed probe group and its application of rs6065 | |
| WO2011090154A1 (en) | Target sequence amplification method, polymorphism detection method, and reagents for use in the methods | |
| JPWO2008066163A1 (en) | CYP2C9 gene amplification primer set, CYP2C9 gene amplification reagent containing the same, and use thereof | |
| CN108929906A (en) | For detecting the primed probe group and its application of rs1799889 | |
| US20030008307A1 (en) | Methods for diagnosing activated protein C resistance associated with a factor V genetic mutation and compositions thereof | |
| WO1996030546A9 (en) | Methods for identifying a factor v gene mutation | |
| CN108949964A (en) | For detecting the primed probe group and its application of rs12041331 | |
| WO2013157625A1 (en) | Method and kit for detecting hla-a*24:02 | |
| CN108949966A (en) | For detecting the primed probe group and its application of rs1801133 | |
| EP0910662B1 (en) | Methods and reagents for typing hla class i genes | |
| CN109371115A (en) | For detecting the primed probe group and its application of rs5918 | |
| CN108929913A (en) | For detecting the primed probe group and its application of rs2032582 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190222 |
|
| WD01 | Invention patent application deemed withdrawn after publication |