CN109355399A - One kind SNP marker relevant to the more lamb characters of sheep list tire and its detection kit and application - Google Patents
One kind SNP marker relevant to the more lamb characters of sheep list tire and its detection kit and application Download PDFInfo
- Publication number
- CN109355399A CN109355399A CN201811424312.XA CN201811424312A CN109355399A CN 109355399 A CN109355399 A CN 109355399A CN 201811424312 A CN201811424312 A CN 201811424312A CN 109355399 A CN109355399 A CN 109355399A
- Authority
- CN
- China
- Prior art keywords
- sheep
- primer
- snp
- site
- extension
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of SNP marker relevant to the more lamb characters of sheep list tire and its detection kit and applications, belong to sheep SNP marker technical field, the SNP marker is located at the site 63454744bp NC_019464.1 (63452568..63681991) on No. 7 chromosome of sheep, is based on ovine genome sequence information version number Oar_v3.1；There are T/G base mutations on the site, have significant correlation with the more lambs of sheep.It can determine sheep lambing to be measured by carrying out parting to the SNP site.Method provided by the invention using SNP site genotype described in detection sheep, sensitivity, accuracy is higher, cost performance is higher, automatic detection can be realized to the SNP site, during Sheep Breeding, the GG type individual that there is single tire to produce more lamb characters can be selected and remain, to improve the reproductive capacity of sheep.
Description
Technical field
The present invention relates to molecular marker detection technologies, specifically, being related to a kind of relevant to the more lamb characters of sheep list tire
SNP marker and its detection kit and application.
Background technique
Fecundity Trait is one of important economical trait of sheep.For sheep, the litter size for improving every tire is to be promoted
The important measures of production economy benefit.It can go to filter out and silk floss in the level of whole gene group using the research of genomics method
The relevant candidate gene of sheep reproductive trait and molecular labeling, make scholars can deeper into the heredity for understanding the more lamb characters of sheep
Mechanism can will bring huge economic benefit to the sustainable development of China's sheep industry.
BMP4 gene is located on No. 7 chromosomes of sheep, includes 6 exons, and code area overall length 1229bp encodes albumen and contains
409 amino acid, the gene have very high homology between goat, yak and mouse.BMP4 gene functions master
It will be dependent on classical Bmp/Smad signal path.In Bmp/Smad access, the BMP4 maturation protein synthesized in the cell, with
Paracrine/autocrine form exocytosis, re-forms homologous/heterodimer, activates II type of BMPR, I A receptor successively.The I of activation
A receptor is by intracytoplasmic R-SMAD (SMAD receptor) phosphorylation, with Co-SMAD (common mediator
SMADs, Co-SMADs) i.e. SMAD4 combine form the different dimeric complexes of SMAD albumen, into nucleus with target gene in conjunction with, send out
Wave transcriptional control effect.The reproduction activity of mammal mainly by hypothalamus, hypophysis, gonad axis hormone control, relaxation etc. hair
Existing BMP4 can breed the variation of hormone by regulation, finally granular cell differentiation in promotion ovarian follicles, follicle maturity,
(tension and relaxation, Zhou Jianshe, Qin Nan wait the progress of bone morphogenetic protein 4 and Mammal Follicles Growth for number of eggs ovulated increase
[J] China animal and veterinary, 2010.37 (3): 141-144.).Shimasaki etc. has found that BMP4 can induce and increases granular cell pair
FSH (Follicle-stimulating hormone) sensibility, the estrogen and progesterone synthesis that regulation FSH is relied on
(Shimasaki S,Zachow R J,Li D,et al.A functional bone morphogenetic protein
system in the ovary[J].Proceedings of the National Academy of Sciences of the
United States of America,1999.96(13):7282-7287.).Tan etc. has found in mouse, in vivo or body
Outer addition BMP4 can promote primordial follicle to be converted into secondary follicle.Da has found that BMP4 gene can promote ovary in yak
The increase of primordial follicle and secondary follicle diameter, and regulate and control yak oocyte maturation (Tan S, Feng B, Yin M, et
al.Stromal Senp1promotes mouse early folliculogenesis by regulating
BMP4expression[J].Cell&Bioscience,2017.7(1):36.).Star is stored up to wait the study found that Small-fat-tail sheep
C/A mutation occurs for the 305th bit base of BMP4 gene extron 3.The BB type Small-fat-tail sheep average number of lambs ratio AB type of the mutation and
AA type is 0.61 more, and in additive effect, (storage star, Zhou Wenran, Sun Shaohua wait Small-fat-tail sheep with the more lamb characters of Small-fat-tail sheep
BMP4 gene pleiomorphism and its with prolificacy relationship [J] Journal of Agricultural Biotechnology, 2008.16 (2): 237-241.).
By to 10 sheep varieties, 99 sheep individuals carry out full-length genomes resurvey sequence and be classified as single lamb group with it is more
Lamb group, and obtain a large amount of effectively SNP site by the calculating of Fst value and screen and obtain some genes, including BMP4 base
Cause.Therefore, research is carried out to it helps to excavate more evaluation of markers relevant to sheep litter size.
Summary of the invention
The purpose of the present invention is to provide a kind of SNP marker relevant to the more lamb characters of sheep list tire and its detection examinations
Agent box and application.
In order to achieve the above-mentioned object of the invention, the present invention the following technical schemes are provided:
The present invention provides a kind of SNP marker relevant to the more lamb characters of sheep list tire, the SNP marker positions
In the site 63454744bp NC_019464.1 (63452568..63681991) on No. 7 chromosome of sheep；On the site
There are T/G base mutations, have significant correlation with the more lambs of sheep list tire；The SNP marker is based on ovine genome
Sequence information version number Oar_v3.1, in September, 2012.
Sequenom is utilized the present invention provides a kind ofSNP technology detects described in above scheme
SNP primer sets, the primer sets include PCR amplification primer and extension primer；The PCR amplification primer includes upstream primer
F and downstream primer R；The nucleotide sequence of the upstream primer F is as shown in SEQ ID No.1；The nucleotide of the downstream primer R
Sequence is as shown in SEQ ID No.2；The nucleotide sequence of the extension primer is as shown in SEQ ID No.3.
Sequenom is utilized the present invention provides a kind ofSNP technology detects described in above scheme
The kit of SNP site, the kit include primer sets described in above scheme.
Preferably, the kit further includes dNTPs, Taq archaeal dna polymerase, Mg2+, PCR reaction buffer and SAP enzyme.
Preferably, the kit further includes standard positive template.
Utilize SequenomThe method that SNP technology detects SNP site described in above scheme, packet
Include following steps:
1) genomic DNA of sheep to be measured is extracted；
2) using the genomic DNA of sheep to be measured as template, using the amplimer F and R in primer sets described in above scheme,
Pcr amplification reaction is carried out, pcr amplification product is obtained；
3) pcr amplification product described in step 2) is digested with SAP enzyme, obtains digestion product；
4) using digestion product described in step 3) as template, prolonged using the extension primer in primer sets described in above scheme
Reaction is stretched, extension products are obtained；
5) extension products are analyzed using Matrix-Assisted Laser Desorption Ionization Time of Flight technology, determined SNP described
The genotype of point.
Preferably, the reaction system that pcr amplification reaction described in step 2) uses includes: 10ng/ μ L genome in terms of 5 μ L
1 μ L, 10 × PCR reaction buffer of DNA, 0.5 μ L, 25mmol/L MgCl20.4 μ L, 25 μm of ol/L dNTPs0.1 μ L, 0.5 μ
1 μ L, 5U/ μ L Taq archaeal dna polymerase of mol/L PCR Primer mix 0.2 μ L, 1.8 μ L of deionized water；
The program of the pcr amplification reaction are as follows: 95 DEG C of 2min of initial denaturation；95 DEG C of 30s are denaturalized, anneal 56 DEG C of 30s, extends 72
℃60s；After the denaturation, annealing and extension step carry out 45 circulations；72 DEG C of holding 5min.
Preferably, digestion system described in step 3) includes: 10 × SAPBuffer, 0.17 μ L, 1.7U/ μ L in terms of 2 μ L
0.3 μ L of SAPEnzyme, 1.53 μ L of deionized water；The program of the digestion are as follows: 37 DEG C, 40min；85 DEG C, 5min.
Preferably, extension system described in step 4) includes: 10 × iplex BufferPlus0.2 μ L in terms of 2 μ L,
Iplex Terminator0.2 μ L, 0.6-1.3 μm of 0.94 μ L, iplex Enzyme0.041 μ L of ol/Lprimermix, go from
Sub- 0.619 μ L of water；
The program of the extension are as follows: 94 DEG C of 30s；[94 DEG C of 5s, (52 DEG C of 5s, 80 DEG C of 5s)]；It is wherein (52 DEG C described
5s, 80 DEG C of 5s) 5 circulations are carried out, [94 DEG C of 5s, (52 DEG C of 5s, 80 DEG C of 5s)] carry out 40 circulations；72℃3min.
The present invention provides application of the SNP site described in above scheme in sheep assistant breeding.
Beneficial effects of the present invention: SNP marker relevant to the more lamb characters of sheep provided by the invention, the SNP
Molecular labeling is located at the site 63454744bp NC_019464.1 (63452568..63681991) on No. 7 chromosome of sheep；
There are T/G base mutations on the site, have significant correlation with the more lambs of sheep.By dividing the SNP site
Type can determine sheep lambing to be measured.
It is provided by the invention to utilize SequenomSNP technology detects SNP site gene described in sheep
The method of type, sensitivity, accuracy is higher, and cost performance is higher, can be simultaneously to tens of to hundreds of in hundreds of to thousands of parts of samples
SNP site is detected.
Detailed description of the invention
Fig. 1 shows the Mass Spectrometer Method results of extension products in embodiment 1.
Specific embodiment
The present invention provides a kind of SNP markers relevant to the more lamb characters of sheep list tire, which is characterized in that described
SNP marker is located at the site 63454744bp NC_019464.1 on No. 7 chromosome of sheep
(63452568..63681991)；There are T/G base mutations on the site, have significant correlation with the more lambs of sheep, should
There are tri- kinds of genotype of TT, GT and GG, the individual litter sizes of GG genotype to be significantly higher than GT genotype and TT genotype for gene.
The SNP marker is based on ovine genome sequence information version number Oar_v3.1, in September, 2012.
The present invention also provides utilize SequenomSNP technology detects the primer of the SNP site
Group, the primer sets include PCR amplification primer and extension primer；The PCR amplification primer includes upstream primer F and downstream primer
R；The nucleotide sequence of the upstream primer F is specific as follows: 5 '-as shown in SEQ ID No.1
ACGTTGGATGCAGGATACTCCAGACCGATG-3'；The nucleotide sequence of the downstream primer R as shown in SEQ ID No.2,
It is specific as follows: 5 '-ACGTTGGATGCATGCGGGATCTTTACAGAC-3 '；The nucleotide sequence of the extension primer such as SEQ
It is specific as follows shown in ID No.3: S1:5 '-CCTACAGACCGATGCCCTGGA-3 '.
Sequenom of the present inventionSNP technology combination multiple PCR technique,
MassARRAYiPLEX Single base extension technology and matrix solid-dispersion flying time mass spectrum analysis mass-spectrometric technique
Parting detection is carried out to gene.Using the method automatic detection can be realized to the SNP site of BMP4 gene.
The present invention also provides utilize SequenomSNP technology detects the reagent of the SNP site
Box, the kit include primer sets described in above scheme, further include dNTPs, Taq DNA polymerase, Mg2+, PCR reaction
Buffer and SAP enzyme.
In the present invention, the use concentration of the primer sets middle and upper reaches primers F and downstream primer R preferably stands alone as 0.45~
0.55 μm of ol/L more preferably stands alone as 0.50 μm of ol/L；The concentration of extension primer in the primer sets is preferably 0.6~
1.3μmol/L.In the present invention, the use concentration of the dNTPs is preferably 20~30 μm of ol/L, more preferably 25 μm of ol/L；
The use concentration of the Taq archaeal dna polymerase is preferably 4~6U/ μ L, more preferably 5U/ μ L；The MgCl2Use concentration it is excellent
It is selected as 20~30mmol/L, more preferably 25mmol/L；The PCR reaction buffer is preferably 10 × PCR reaction buffer；Institute
The enzyme activity for stating SAP enzyme is preferably 1.7U/ μ L.Heretofore described kit preferably further includes 10 × SAPBuffer.In this hair
In bright, the kit preferably further includes the standard positive template DNA that genotype is GG；The standard positive template DNA makees
For positive control, increase the accuracy of the SNP site detection.
The present invention also provides utilize SequenomThe detection of SNP technology is related to the more lamb characters of sheep
Sheep BMP4 gene described in SNP marker site method, comprising the following steps: 1) extract the genome of sheep to be measured
DNA；2) using the genomic DNA of sheep to be measured as template, using the amplimer F and R in the primer sets, PCR amplification is carried out
Reaction obtains pcr amplification product；3) pcr amplification product described in step 2) is digested with SAP enzyme, obtains digestion product；4)
Using digestion product described in step 3) as template, extension is carried out using the extension primer in the primer sets, obtains extending production
Object；5) extension products are analyzed using Matrix-Assisted Laser Desorption Ionization Time of Flight technology, determines the base of the SNP site
Because of type.
In the present invention, the genomic DNA of sheep to be measured is extracted first.The present invention does not have the type of the sheep to be measured
Particular/special requirement, any kind of sheep, in embodiments of the present invention using Small-fat-tail sheep sheep；The present invention is to described
The extracting method of ovine genome to be measured is not particularly limited, and the zooblast Extraction Methods of Genome using this field routine is
It can.
In specific implementation process of the present invention, the Extraction Methods of Genome the following steps are included:
A) Sheep Blood is taken to mix with erythrocyte cracked liquid, obtains DNA crude extract；
B) the DNA crude extract in the step A) is mixed with albumen precipitation liquid, through isopropanol precipitating, precipitating is redissolved, obtained
To DNA extracting solution.
In the application, Sheep Blood is taken to mix with erythrocyte cracked liquid, obtains DNA crude extract；The Sheep Blood preferably takes
From jugular vein；The Sheep Blood preferably uses EDTA to carry out anticoagulation；In the anticoagulation, the body of Sheep Blood and EDTA
Product mass ratio is preferably 1:1.5；The erythrocyte cracked liquid is purchased from Geneode, 1 × erythrocyte cracked liquid of model；It is described red
The volume ratio of cell pyrolysis liquid and Sheep Blood is preferably 3:1；The mixed time is preferably 5~10min；The mixed temperature
Preferably 15~30 DEG C of degree.In the present invention, the effect of the erythrocyte cracked liquid is the red blood cell that removal is free of DNA, is split simultaneously
Solution cell releases genomic DNA.
For the application after obtaining DNA crude extract, DNA crude extract is mixed with sodium acetate makes its final concentration of 0.3mol/L,
The 0.6-0.7 times of volume propyl alcohol precipitating of above-mentioned mixed liquor is added, adds appropriate TE (PH=8.0) and re-dissolves DNA precipitating, obtain
To DNA extracting solution.
The present invention is after obtaining the ovine genome DNA to be measured, using the genomic DNA of sheep to be measured as template, utilizes
Upstream amplification primer F and downstream amplification primer R in the primer sets carry out pcr amplification reaction and obtain pcr amplification product.This hair
The reaction system that pcr amplification reaction described in bright uses includes: 1 μ L, 10 × PCR reaction of 10ng/ μ L genomic DNA in terms of 5 μ L
0.5 μ L, 25mmol/L MgCl of buffer20.4 μ L, 25 μm of ol/L dNTPs 0.1 μ L, 0.5 μm of ol/L PCR Primer
Mix1 μ L, 5U/ μ LTaqDNA polymerase 0.2 μ L, 1.8 μ L of deionized water；
The program of the pcr amplification reaction are as follows: 95 DEG C of 2min of initial denaturation；95 DEG C of 30s are denaturalized, anneal 56 DEG C of 30s, extends 72
℃60s；After the denaturation, annealing and extension step carry out 45 circulations；72 DEG C of holding 5min.The present invention is in the PCR amplification
After the completion, pcr amplification product is preferably stored in 4 DEG C.After pcr amplification reaction of the present invention, the PCR amplification is produced
Contain the DNA fragmentation where the site target SNPs in object.
The present invention carries out digestion acquisition with pcr amplification product of the SAP enzyme to acquisition after obtaining the pcr amplification product
Postdigestive product.The digestion system includes: 10 × SAPBuffer, 0.17 μ L, 1.7U/ μ L in terms of 2 μ L in the present invention
0.3 μ L of SAP Enzyme, 1.53 μ L of deionized water；In the present invention, the program of the digestion are as follows: 37 DEG C, 40min；85 DEG C,
5min.Heretofore described postdigestive product is preferably stored in 4 DEG C.The effect of heretofore described digestion is to digest
Primer sequence and remaining dNTPs in pcr amplification reaction system.
The present invention, using digestion product as template, is drawn after obtaining the digestion product using the extension in the primer sets
Object carries out extension and obtains extension products.In the present invention, the extension system includes: 10 × iplex in terms of 2 μ L
0.2 μ L, iplex Terminator of BufferPlus 0.2 μ L, 0.6-1.3 μm of ol/L primermix 0.94 μ L, iplex
0.041 μ L of Enzyme, 0.619 μ L of deionized water；The program of the extension are as follows: 94 DEG C of 30s；[94 DEG C of 5s, (52 DEG C of 5s,
80℃5s)]；Wherein (52 DEG C of 5s, 80 DEG C of 5s) carry out 5 circulations, and [94 DEG C of 5s, (52 DEG C of 5s, 80 DEG C of 5s)] are carried out
40 circulations；72℃3min.
10 × iplex Buffer Plus, iplex Terminator, 0.6- in the present invention, in the extension system
1.3 μm of ol/Lprimermix and iplex enzyme sources inGold Reagent Set kit.It is of the present invention to prolong
It stretches in reaction process, Single base extension is carried out to the SNP site to be checked in extension system, the extension primer of locus specificity will be
Extend a base at mutational site and terminates.Extension primer will connect upper different dNTPs according to the difference of mutation type,
Form molecular weight difference.The extension products are preferably passed through purifying resin after obtaining the extension products by the present invention, this
Invention is not particularly limited the method for the purifying resin, using the purifying resin of this field routine.
The present invention utilizes Matrix-Assisted Laser Desorption Ionization Time of Flight technology point after obtaining the extension products
Extension products are analysed, determine the genotype of the SNP site.The extension products point sample to target on piece is used matter by the present invention
Spectrometer detects the molecular weight difference of different extension products, is analyzed by data, so that it may obtain the specific of each mutational site
Genotype.In the present invention, the mass spectrum point sample is related to be carried out using MassARRAYNanodispenserRS1000；The matter
Spectrum analysis preferably uses MassARRAYCompact System to carry out；The present invention is preferred to utilize after the mass spectral analysis
Typer4.0 software detection mass spectra peak, and according to each sample target site genotype of mass spectra peak map interpretation.
Heretofore described SequenomThe basic principle of SNP technology are as follows: expanded first using upstream
DNA fragmentation where increasing primers F and downstream amplification primer R amplification target SNPs, is added SAP enzymic digestion reactant in amplified production
Then primer sequence and remaining dNTPs in system carry out Single base extension simultaneously to SNP site to be checked using extension primer,
The extension primer of locus specificity will extend a base and be terminated at mutational site.Extension products will be according to mutation type
Difference and connect different ddNTPs, formed molecular weight difference.Extension products are after purifying resin, by point sample to target piece
On, and detected using molecular weight difference of the mass spectrograph to different extension products, it is analyzed by data, so that it may obtain each mutation
The specific genotype in site.
The present invention also provides application of the SNP site in sheep assistant breeding.During Sheep Breeding, sieve
The sheep that the SNP site is G base is selected to carry out subsequent breeding.The screening of the SNP site preferably uses in the present invention
Above-mentioned SequenomSNP technology；Preferred screening SNP site is that the sheep of GG genotype carries out subsequent educate
Kind.Genotype GG homozygous individual with more lamb characters can be selected and remain by application of the present invention, improve sheep lambing
Can, while the rutting rate of sheep is improved, there is very big application value to sheep large-scale molecular breeding.
Technical solution provided by the invention is described in detail below with reference to embodiment, but they cannot be understood
For limiting the scope of the present invention.
The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..Unless otherwise specified, embodiment
According to conventional laboratory conditions, such as Sambrook molecular cloning experiment handbook (Sambrook J&Russell DW,
Molecular cloning:a laboratorymanual, 2001), or according to the condition of manufacturer's specification suggestion.
Embodiment 1
It is a kind of to utilize SequenomSNP technology detects sheep BMP4 genotype and predicts to be produced female
The method of sheep nest average number of lambs
1, experimental material
Choosing 380 Small-fat-tail sheep sheep is test object.
2, reagent and instrument
Reagent: Complete Genotyping Reagent Kit forCompact 384；
Gene magnification: ABI9700384Dual；
Mass spectrum point sample: MassARRAYNanodispenserRS1000；
Mass spectral analysis: MassARRAY Compact System；
All reagents and instrument are purchased from Beijing Kang Pusen Bioisystech Co., Ltd (Beijing Compass
Biotechnology Co.,Ltd)。
3, the extraction of genomic DNA
Sheep jugular vein blood collection 1ml, with EDTA anticoagulation.Erythrocyte cracked liquid cracking removal is without the red of DNA first
Cell, nucleus lysate lytic cell release genomic DNA, and then albumen precipitation liquid selective precipitation removes removing protein, most
Pure genomic DNA is laid equal stress on by isopropanol precipitating afterwards is dissolved in DNA lysate.
4、SequenomSNP technology carries out Genotyping
For the site 63454744bp (NC_019464.1 on No. 7 chromosome of sheep
(63452568..63681991) is based on ovine genome sequence information version number Oar_v3.1, in September, 2012) design primer
Combination.
The nucleotide sequence of PCR amplification primer is as follows:
2nd-PCRP:ACGTTGGATGCAGGATACTCCAGACCGATG；
1st-PCRP:ACGTTGGATGCATGCGGGATCTTTACAGAC；
Extension primer sequence and extension products are as shown in table 1.
1 extension primer sequence of table and extension products
Above-mentioned primer is synthesized by Beijing Kang Pusen Bioisystech Co., Ltd.
Testing process is as follows:
1, the genomic DNA of sheep to be measured is extracted；
2, using the genomic DNA of sheep to be measured as template, PCR expansion is carried out using above-mentioned primer 2 nd-PCRP and 1st-PCRP
Increase reaction；
3, pcr amplification product is digested with SAP enzyme；
4, using postdigestive pcr amplification product as template, extension is carried out using the extension primer S1；
5, extension products are analyzed, to determine sheep BMP4 genotype.
Wherein, the reaction system that pcr amplification reaction uses is calculated as with 5 μ L: 1 μ L, 10 × PCR of 10ng/ μ L genomic DNA are anti-
Answer buffer 0.5 μ L, 25mmol/LMgCl20.4 μ L, 25 μm of ol/L dNTPs0.1 μ L, 0.5 μm of 1 μ of ol/LPCRPrimermix
L, 5U/ μ LTaq archaeal dna polymerase 0.2 μ L, 1.8 μ L of deionized water；
The amplification program of pcr amplification reaction are as follows: 95 DEG C of 2min；95 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 60s, 45 circulations；72
℃5min；4 DEG C of preservations.
Pcr amplification product is digested, the SAP enzymic digestion system used is calculated as with 2 μ L: 10 × SAP Buffer
0.17 μ L, 1.7U/ μ L SAP Enzyme 0.3 μ L, 1.53 μ L of deionized water；
Reaction condition are as follows: 37 DEG C of 40min, 85 DEG C of 5min, 4 DEG C of preservations.
Extension system is calculated as with 2 μ L: 10 × iplex BufferPlus, 0.2 μ L, iplex Terminator 0.2
μ L, 0.6-1.3 μm of 0.94 μ L, iplex Enzyme of ol/L primer mix 0.041 μ L, 0.619 μ L of deionized water；
Reaction condition are as follows: 94 DEG C of 30s；94 DEG C of 5s, 52 DEG C of 5s, 80 DEG C of 5s, 5 circulations, 40 circulations；72℃3min；4℃
It saves.
Extension products after purifying resin are moved on 384 hole SpectroCHIP (Sequenom) chips, MALDI- is carried out
TOF-MS (Matrix-Assisted Laser Desorption Ionization Time of Flight) reaction, using Typer4.0 software detection mass spectra peak, and root
According to each sample target site genotype of mass spectra peak map interpretation.
Obtaining pcr amplification product size through mass spectral analysis is 103bp, and the Mass Spectrometer Method result of extension products is as shown in Figure 1.
Statistical result:
The site 63454744bp different genes type analysis statistical result is shown in Table 2 on No. 7 chromosome of sheep to be measured.
The site 63454744bp different genes type analysis counts on table No. 7 chromosome of 2 sheep to be measured
Sequenom is used to 380 Small-fat-tail sheep blood DNA samplesThe discovery of SNP technology parting,
There are three kinds of genotype, respectively Wild homozygous in Small-fat-tail sheep in the site 63454744bp on No. 7 chromosome of sheep
TT, heterozygous GT, mutated homozygous GG.Three kinds of genotype frequencies are TT (0.84), GT (0.15) and GG (0.01).
The site 63454744bp different genotype is associated with point with Small-fat-tail sheep litter size on No. 7 chromosome of sheep to be measured
Analysis statistical result is shown in Table 3.
The site 63454744bp different genotype and Small-fat-tail sheep litter size close on table No. 7 chromosome of 3 sheep to be measured
Connection analysis
Note: the different lowercase of subscript represents significant difference.
As shown in Table 3, the statistical data of the first tire of Small-fat-tail sheep litter size is shown, on No. 7 chromosome of sheep
TT the and GT genotype in the site 63454744bp be 2.21 ± 0.08 and 2.26 ± 0.20 be substantially less than GG type 4.00 ±
0.44(P<0.05).The litter size statistical data of second fetus and third tire also shows that the GG genotype after mutation is significantly high
In wild type TT and heterozygote GT (P < 0.05).To sum up, illustrate that the site increases Small-fat-tail sheep lambing energy to a certain extent
Power.
As seen from the above embodiment, the present invention provides a kind of SNP markers relevant to the more lamb characters of sheep list tire
And its detection kit and application, and specifically provide and a kind of utilize SequenomThe detection of SNP technology
The method of SNP site genotype described in sheep, this method have sensitivity, the higher advantage of accuracy.
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered
It is considered as protection scope of the present invention.
Sequence table
<110>Institute of Animal Sciences, Chinese Academy of Agricultural Sciences
<120>a kind of SNP marker relevant to the more lamb characters of sheep list tire and its detection kit and application
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 30
<212> DNA
<213> sheet
<400> 1
acgttggatg caggatactc cagaccgatg 30
<210> 2
<211> 30
<212> DNA
<213> sheet
<400> 2
acgttggatg catgcgggat ctttacagac 30
<210> 3
<211> 21
<212> DNA
<213> sheet
<400> 3
cctacagacc gatgccctgg a 21
Claims (10)
1. a kind of SNP marker relevant to the more lamb characters of sheep list tire, which is characterized in that the SNP marker is located at
The site 63454744bp NC_019464.1 (63452568..63681991) on No. 7 chromosome of sheep；It is deposited on the site
In T/G base mutation, there is significant correlation with the more lambs of sheep list tire；The SNP marker is based on ovine genome sequence
Column information version number Oar_v3.1, in September, 2012.
2. utilizing SequenomSNP technology detects SNP described in claim 1 primer sets, special
Sign is that the primer sets include PCR amplification primer and extension primer；The PCR amplification primer includes upstream primer F and downstream
Primer R；The nucleotide sequence of the upstream primer F is as shown in SEQ ID No.1；The nucleotide sequence of the downstream primer R is such as
Shown in SEQ ID No.2；The nucleotide sequence of the extension primer is as shown in SEQ ID No.3.
3. utilizing SequenomSNP technology detects the kit of SNP site described in claim 1, special
Sign is that the kit includes primer sets described in claim 2.
4. kit according to claim 3, which is characterized in that the kit further includes dNTPs, TaqDNA polymerization
Enzyme, Mg2+, PCR reaction buffer and SAP enzyme.
5. kit according to claim 3 or 4, which is characterized in that the kit further includes standard positive template.
6. utilizing SequenomThe method that SNP technology detects SNP site described in claim 1, it is special
Sign is, comprising the following steps:
1) genomic DNA of sheep to be measured is extracted；
2) using the genomic DNA of sheep to be measured as template, using the amplimer F and R in primer sets described in claim 2, into
Row pcr amplification reaction obtains pcr amplification product；
3) pcr amplification product described in step 2) is digested with SAP enzyme, obtains digestion product；
4) using digestion product described in step 3) as template, extended using the extension primer in primer sets described in claim 2
Reaction, obtains extension products；
5) extension products are analyzed using Matrix-Assisted Laser Desorption Ionization Time of Flight technology, determines the SNP site
Genotype.
7. according to the method described in claim 6, it is characterized in that,
The reaction system that pcr amplification reaction described in step 2) uses includes: 1 μ L of 10ng/ μ L genomic DNA in terms of 5 μ L, and 10
0.5 μ L, 25mmol/L MgCl of × PCR reaction buffer20.4 μ L, 25 μm of ol/L dNTPs 0.1 μ L, 0.5 μm of ol/L PCR
1 μ L, 5U/ μ L Taq archaeal dna polymerase of Primer mix 0.2 μ L, 1.8 μ L of deionized water；
The program of the pcr amplification reaction are as follows: 95 DEG C of 2min of initial denaturation；95 DEG C of 30s are denaturalized, anneal 56 DEG C of 30s, extends 72 DEG C
60s；After the denaturation, annealing and extension step carry out 45 circulations；72 DEG C of holding 5min.
8. according to the method described in claim 6, it is characterized in that, digestion system described in step 3) include: 10 in terms of 2 μ L ×
0.17 μ L, 1.7U/ μ L SAP Enzyme of SAP Buffer 0.3 μ L, 1.53 μ L of deionized water；The program of the digestion are as follows: 37
DEG C, 40min；85 DEG C, 5min.
9. according to the method described in claim 6, it is characterized in that, extension system described in step 4) includes: in terms of 2 μ L
10 × iplex Buffer Plus, 0.2 μ L, iplex Terminator 0.2 μ L, 0.6-1.3 μm of ol/L primer mix
0.94 μ L, iplex Enzyme 0.041 μ L, 0.619 μ L of deionized water；
The program of the extension are as follows: 94 DEG C of 30s；[94 DEG C of 5s, (52 DEG C of 5s, 80 DEG C of 5s)]；Wherein described (52 DEG C of 5s, 80
DEG C 5s) 5 circulations are carried out, [94 DEG C of 5s, (52 DEG C of 5s, 80 DEG C of 5s)] carry out 40 circulations；72℃3min.
10. application of the SNP site described in claim 1 in sheep assistant breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811424312.XA CN109355399A (en) | 2018-11-27 | 2018-11-27 | One kind SNP marker relevant to the more lamb characters of sheep list tire and its detection kit and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811424312.XA CN109355399A (en) | 2018-11-27 | 2018-11-27 | One kind SNP marker relevant to the more lamb characters of sheep list tire and its detection kit and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109355399A true CN109355399A (en) | 2019-02-19 |
Family
ID=65342871
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811424312.XA Pending CN109355399A (en) | 2018-11-27 | 2018-11-27 | One kind SNP marker relevant to the more lamb characters of sheep list tire and its detection kit and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109355399A (en) |
-
2018
- 2018-11-27 CN CN201811424312.XA patent/CN109355399A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| NC_019464.1: "rs416697440", 《ENSEMBL GENOME BROWSER》 * |
| 储明星等: "小尾寒羊BMP4基因多态性及其与高繁殖力关系", 《农业生物技术学报》 * |
| 博奥生物有限公司: "Sequenom SNP实验过程说明书", 《百度文库》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110029178B (en) | SNP molecular marker related to single-fetus and multiple-lamb characters of sheep, detection primer group, detection kit and application thereof | |
| CN110004236A (en) | SNP marker relevant to the more lamb characters of sheep and its detection ESR1 genotyping primer group, kit and application | |
| CN109234442B (en) | SNP molecular marker related to sheep multi-lamb characters and detection kit and application thereof | |
| CN111996265B (en) | SNP molecular marker influencing wool fiber diameter of fine wool sheep and application thereof | |
| CN112251518B (en) | Molecular marker associated with lambing number and growth traits in goat RSAD2 gene and application thereof | |
| CN112921102B (en) | SNP (Single nucleotide polymorphism) marker related to fine wool sheep wool character and detection primer group, kit, detection method and application thereof | |
| CN112481392B (en) | SNP molecular marker related to multiple lambs of sheep and application thereof | |
| CN113502335A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN107447000B (en) | SNP molecular marker related to multiple lambs of sheep and application thereof | |
| CN108913787A (en) | SNP marker relevant to the more lambs of sheep and its application | |
| CN112176076A (en) | NFAT5 gene molecular marker related to goat growth traits and application thereof | |
| CN109182559B (en) | SNP molecular marker related to single-fetus and multiple-lamb characters of sheep, detection kit and application thereof | |
| CN106755371B (en) | Method for detecting sheep PCNP gene single nucleotide polymorphism by PCR-RFLP and application thereof | |
| CN113430285B (en) | Molecular marker related to Muscovy duck breeding traits and application | |
| CN108866206B (en) | SNP molecular marker related to multiple lambs of sheep and application thereof | |
| CN107988385B (en) | Method for detecting marker of PLAG1 gene Indel of beef cattle and special kit thereof | |
| CN111088369B (en) | Detection method, primer pair and application of sheep RORA gene insertion/deletion polymorphism | |
| CN109295240A (en) | One kind SNP marker relevant to the more lamb characters of sheep list tire and SMAD1 gene parting detecting reagent and application | |
| CN108315435B (en) | SNP molecular marker related to sheep lambing number trait and application thereof | |
| CN111269990A (en) | Marker of multiparous sheep, product for detecting multiparous sheep and detection method | |
| CN109355399A (en) | One kind SNP marker relevant to the more lamb characters of sheep list tire and its detection kit and application | |
| CN115109856A (en) | Molecular marker related to sheep stage body weight, detection method and application thereof | |
| CN109439773B (en) | SNP molecular marker for sheep multiple lambs character and primer group, kit and application for detection thereof | |
| CN107779517A (en) | A kind of molecular labeling for influenceing Duroc kind pig lean meat percentage character and its application | |
| CN109207611B (en) | SNP molecular marker related to sheep oestrus character and detection kit and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190219 |