CN109337980B

CN109337980B - Application of human YTHDF1 gene

Info

Publication number: CN109337980B
Application number: CN201811412949.7A
Authority: CN
Inventors: 陈勇彬; 杨翠萍; 石玉林; 吴梦鸽; 江丽萍; 申秋硕
Original assignee: Kunming Institute of Zoology of CAS
Current assignee: Kunming Institute of Zoology of CAS
Priority date: 2018-11-23
Filing date: 2018-11-23
Publication date: 2021-11-09
Anticipated expiration: 2038-11-23
Also published as: CN109337980A

Abstract

The invention discloses a new use of human YTHDF1 gene, namely, the human YTHDF1 gene expression level detection reagent is applied to the preparation of lung cancer clinical diagnosis reagent, and the human YTHDF1 gene is applied to the preparation of lung cancer treatment drug, compared with normal lung epithelial cells, the YTHDF1 gene is highly expressed in lung cancer cells, RNA interference slow virus designed aiming at YTHDF1 gene inhibits YTHDF1 expression, can obviously inhibit the proliferation of lung cancer cells, leads the division of tumor cells to be retarded at G0/G1 stage, promotes the apoptosis of cells, inhibits the formation of nude mouse transplanted tumor, and further can achieve the purpose of treating lung cancer, YTHDF1 gene knockout mouse tumorigenicity detection experiment shows that the cell proliferation is obviously inhibited, and the apoptosis of cells is obviously improved; the human YTHDF1 gene can be used as a target point for treating lung cancer, and provides a wide prospect for developing lung cancer treatment medicines based on YTHDF1 gene in the future.

Description

Application of human YTHDF1 gene

Technical Field

The invention relates to a new application of a gene, in particular to a new application of a human YTHDF1 gene.

Background

The acquired modification includes methylation, acetylation, ubiquitination and the like. RNA modification is one of the acquired modifications. To date, over 100 chemical modifications have been found in different intracellular RNAs such as tRNA, rRNA, mRNA and long non-coding RNAs. N6-methyidenosine, which was discovered in the 70's of the 20 th century, is the most common type of modification of intracellular mRNA and long non-coding RNAs, and is widespread from viruses to yeasts, and even mammals. Recent studies have shown that aberrant m6A modifications can lead to brain dysplasia and other diseases, including cancer. RNA-binding proteins (RNA-binding proteins) are key factors in post-transcriptional processing, which regulate RNA splicing, stability, localization and translation, and many RBPs are aberrantly expressed in different cancer types, resulting in dysfunction of oncoproteins and tumor suppressors.

Enzymes participating in the methylation of m 6A-there are three general classes of enzymes, Writers, Erases and Readers, respectively. Writers refers to methylases METTL3, METTL14, WTAP and the like in the process of DNA → RNA, and methylation modification of N at the sixth site of adenylate is carried out under the action of the methylases METTL3, METTL14, WTAP and the like. These bases, which have undergone m6A modification, undergo demethylation by the action of two enzymes, FTO and ALKBH, and are therefore called Erases. Wherein FTO can be combined with ALKBH5 to allow RNA methylation to be a reversible reaction. Finally, these methylation-modified RNA base sites require a specific enzyme, i.e., readers, to recognize. The YTHDF families including YTHDF1, YTHDF2, YTHDF3, Mrb1 genes in Saccharomyces cerevisiae and Mmi1 genes in Schizosaccharomyces pombe are known to be readers proteins. These enzymes can recognize the base methylated at m6A, and participate in downstream translation, mRNA degradation, mRNA nucleation speed acceleration and the like.

m6A modifications and their related regulatory proteins play a key role in a variety of tumors. An important discovery of m6A demethylase ALKBH5 in the combination of the Flankun cloud topic of the Anderson cancer center in USA and the Hokka topic of Chicago university indicates that ALKBH5 plays a role in maintaining the dryness of cells in malignant glioma cells, and specifically discloses that ALKBH 5-mediated m6A modification on FOXM1 gene mRNA participates in maintaining the dryness of tumor cells.

Lung cancer is one of the most rapidly growing malignancies that threaten human health and life. The latest tumor statistics in the United states in 2017 show that 84590 deaths of men and 71280 deaths of women account for 27% and 25% of deaths of various tumors respectively and are the first deaths of various tumors. According to biological properties, lung cancer is classified into Small Cell Lung Cancer (SCLC) and non-small cell lung cancer (NSCLC). The former accounts for about 15-20% of lung cancer, and the latter accounts for about 80-85% of lung cancer. The existing treatment of lung cancer comprises surgical resection, combined chemotherapy based on platinum (such as cisplatin or carboplatin), radiotherapy, targeted drug therapy and the like, but the clinical curative effect is still not ideal, the 5-year survival rate does not exceed 15%, and the main reason is that the occurrence and development of lung cancer cells are not completely clear.

Therefore, exploring new key molecules in the process of lung cancer generation and development has important significance for determining the molecular mechanism of lung cancer generation and targeting treatment by taking the molecular mechanism as a target, and is beneficial to improving the survival rate of lung cancer patients and improving the survival quality of the lung cancer patients.

Disclosure of Invention

The invention aims to provide a new application of human YTHDF1 gene, namely applying a human YTHDF1 gene expression level detection reagent in preparing a lung cancer clinical diagnosis reagent; the detection result of human YTHDF1 gene expression is used as the basis for clinical treatment of lung cancer patients.

The detection of the human YTHDF1 gene expression level is realized by designing a primer sequence of human YTHDF1mRNA by using a human YTHDF1 gene sequence, and detecting the level of the human YTHDF1mRNA by a real-time quantitative PCR method; the primer sequence of the mRNA is as follows:

SEQ ID NO:7︰TGATCTAATGTGAAATGTAAG；

SEQ ID NO:8︰CTTACATTTCACATTAGATCA。

aiming at the high expression of the human YTHDF1 gene in a lung cancer patient, the invention also aims to apply the human YTHDF1 gene as an action target spot of a lung cancer cell to prepare a medicament for treating the lung cancer, wherein the action target spot aiming at the lung cancer cell is an RNA interference action target spot.

The RNA interference target is selected from the following nucleotide sequences:

SEQ ID NO:1︰ACAGACAGTGTGATGGATGAT；

SEQ ID NO:2︰TCACTTCCTCTGAACTGTTAC。

cloning shRNA sequence inhibiting human YTHDF1 gene expression into a lentiviral vector to obtain RNA interference lentivirus for preparing a gene therapy medicament for lung cancer; the sequence for expressing shRNA comprises two inverted repeat sequences of coding DNA of a targeted human YTHDF1 gene, and the middle of the inverted repeat sequences is separated by a stem-loop sequence; wherein, the two inverted repeat sequences are shRNA target sequences of human YTHDF1 gene and complementary sequences thereof respectively; the shRNA target nucleotide sequence of the human YTHDF1 gene is selected from the following nucleotide sequences:

SEQ ID NO:1︰ACAGACAGTGTGATGGATGAT；

SEQ ID NO:2︰TCACTTCCTCTGAACTGTTAC。

the sequence of the sense strand of the sequence for expressing the shRNA is shown as SEQ ID NO. 3, and the sequence of the antisense strand is shown as SEQ ID NO. 4; or the sequence of the sense strand is shown as SEQ ID NO. 5 and the sequence of the antisense strand is shown as SEQ ID NO. 6.

Forward oligo:YTHDF1FO1(SEQ ID NO:3)

CCGGACAGACAGTGTGATGGATGATCTCGAGATCATCCATCACACTGTCTGTTTTTTG；

Reverse oligo:YTHDF1RO1(SEQ ID NO:4)

AATTCAAAAAACAGACAGTGTGATGGATGATCTCGAGATCATCCATCACACTGTCTGT；

Or

Forward oligo:YTHDF1FO2(SEQ ID NO:5)

CCGGTCACTTCCTCTGAACTGTTACCTCGAGGTAACAGTTCAGAGGAAGTGATTTTTG；

Reverse oligo:YTHDF1RO2(SEQ ID NO:6)

AATTCAAAAATCACTTCCTCTGAACTGTTACCTCGAGGTAACAGTTCAGAGGAAGTGA；

YTHDF1 gene is binding protein of mRNA modified by m6A, and is a candidate gene screened by plateau hypoxia adaptive convergent evolution in our laboratory;

according to the invention, through comparison and analysis of Tibetan population and 6 plateau domestic mammals with the plain Han nationality and plain allied species, a large number of plateau hypoxia adaptive specific genes are enriched, and meanwhile, a plurality of tumor-related genes and genes with unknown functions are also enriched, YTHDF1 is one of the genes, and preliminary data analysis shows that the gene is highly expressed in various tumors, but the action mechanism of the gene is unclear. Therefore, the laboratory analyzes the role in the occurrence and development of lung cancer, and through real-time PCR detection, the RNA level of YTHDF1 is obviously increased in the lung cancer cell line compared with the normal lung epithelial cells of a control group, and the protein level of YTHDF1 is higher in the lung cancer cell line compared with the normal lung epithelial cells by a protein immunoblotting (WB) method. The clinical tissue samples are also detected to show that YTHDF1 is in a high expression trend in lung cancer patients, so that YTHDF1 is presumed to play an important role in the occurrence and development of lung cancer; therefore, we found the sequence of human YTHDF1 from NCBI database, and the nucleotide sequence of human YTHDF1 gene is shown in genebank under the accession number of 295..1974 of NM _ 017798.

Based on the fact that the expression level of the YTHDF1 gene in lung cancer cells is obviously higher than that of normal human lung epithelial cells (Beas-2B), and the phenomenon of YTHDF1 gene amplification exists in lung cancer patients, the lung cancer cell proliferation, in-vivo xenograft tumors and the formation of mouse lung adenocarcinoma in an in-vivo spontaneous induction lung cancer tumor model can be inhibited by reducing the expression of YTHDF1, and the experiment of detecting the tumor forming capability of YTHDF1 gene knockout mice shows that the cell proliferation is obviously inhibited, and the apoptosis of the cells is obviously increased; the human YTHDF1 gene can be used as a target point for cancer treatment; the RNA interference lentivirus designed aiming at the human YTHDF1 gene reduces the expression of YTHDF1 in cancer cells, can obviously inhibit the proliferation of lung cancer cells, blocks the cells in the G0/G1 stage, promotes the apoptosis of the cells, inhibits the formation of xenograft tumors, further can achieve the aim of treating the lung cancer, and simultaneously provides possibility for the development of lung cancer treatment drugs based on the YTHDF1 gene in the future.

Drawings

FIG. 1 is a graph showing the results of mRNA expression of YTHDF1 in different lung cancer cell lines;

FIG. 2 is a graph showing the expression of YTHDF1 protein in different lung cancer cell lines;

FIG. 3 is a graph (A) and a statistical chart (B) showing the protein expression of YTHDF1 in different clinical lung cancer tissues; wherein P in panel A represents a tissue adjacent to cancer, and T represents a cancer tissue;

FIG. 4 shows the staining results of immunohistochemical experiments and the results of detecting the expression of YTHDF1 in lung cancer and non-cancer tissues by lung cancer tissue chip (TMA), wherein, A is a diagram showing different expression intensities of YTHDF1 in different lung cancer tissues, negative; weak positive; modete, moderate intensity positive signal; strong positive; SCC is squamous cell carcinoma of the lung; ADC lung adenocarcinoma, B picture IHC quantitative data (NCLT: non-cancerous lung tissue, NSCLC: non-small cell lung cancer tissue);

FIG. 5 shows that YTHDF1shRNA knockdown or overexpression efficiency is verified by real-time PCR (B picture: A549 and D picture: H1299) and YTHDF1, beta-actin, Flag antibody immunoblotting (A picture: A549 and C picture: H1299), wherein YTHDF1 is YTHDF1 antibody detection result, and Flag detects Flag-YTHDF1, namely the expression level of over-expressed YTHDF 1; beta-actin is the detection result of actin antibody and is used as the sample loading internal reference;

FIG. 6 shows the results of experiments on inhibition of YTHDF1 expression and cell proliferation; a is A549 related cell line, B is H1299 related cell line;

FIG. 7 shows the results of EdU insertion experiments, wherein A is the result of inhibition of DNA synthesis in A549 cells after YTHDF1 knockdown in the EdU binding assay; panel B shows the inhibition of DNA synthesis in H1299 cells following knockdown of YTHDF 1;

FIG. 8 shows the results of cell cycle assays; graph A is 549 cell flow analysis detection result, graph B is quantitative analysis graph, p <0.01, t-test;

FIG. 9 shows the results of cell cycle assays; a is H1299 cell flow analysis detection result, B is quantitative analysis diagram, p <0.01, t-test;

FIG. 10 shows the result of detecting cyclin-related proteins after knockdown of YTHDF 1;

FIG. 11 shows the results of a nude mouse tumorigenicity test; a picture is the growth of tumor 6 weeks after A549 stably expressing Ctr or YTHDF1shRNAs is transplanted into a nude mouse; panel B is a result of weight reduction of YTHDF1 significantly inhibited xenograft tumors, # p <0.05, # p <0.01, # p <0.001, t-test; panel C shows that knockdown of YTHDF1 significantly reduced the growth of subcutaneous transplanted tumors in male nude mice, <0.05, <0.01, <0.001, t-test;

FIG. 12 shows YTHDF1 knockout mice and Kras^G12D/P53^lox/loxLung cancer mouse model hybridization and experimental flow chart;

FIG. 13 is a photograph (left) of lung tissue taken from mice after they had been induced to develop lung cancer by nasal instillation with Adeno-Cre for 12 weeks, and lung tissue from KP and KPY mice stained by HE (in the panorama (middle), on a 200 Xmagnification (right)), and the histogram is a statistical chart;

FIG. 14 is a result of YTHDF1 staining in KP and KPY lung cancer tissues;

FIG. 15 is a graph showing the results of tumor types induced by a mouse model of KP lung cancer;

FIG. 16 shows the proliferation and apoptosis of KP mice tested by YTHDF1 gene with different expression levels, and the histogram is the statistical result;

FIG. 17 is the result of YTHDF1 staining in K and KY lung cancer tissues;

FIG. 18 is a panoramic image (left) of lung tissue taken out 22 weeks after lung cancer induction by nasal drip of mice, and HE staining (200 Xmagnification (right)); the histogram is a statistical result graph;

FIG. 19 is a bar graph showing statistical results of detecting proliferation and apoptosis of YTHDF1 gene at different expression levels in different K mice;

in the figure, the Ctr shRNA is a scramble shRNA control cell strain; YTHDF1sh #1 is a stable cell strain for knocking down shRNA # 1; YTHDF1sh #2 is a stable cell strain with knockdown shRNA # 2.

Detailed Description

The substance of the present invention will be further described below by way of examples, but the substance of the present invention is not limited thereto, and the methods in the examples are all conventional methods unless otherwise specified, and the reagents used are all conventional time-sold reagents or reagents formulated according to conventional methods unless otherwise specified.

KP is Kras in the examples below^G12D/P53^lox/loxMouse Lung tissue (left), KPY is Kras^G12D/P53^lox/lox/YTHDF1^lox/loxMouse Lung tissue, K is Kras^G12DMouse Lung tissue, KY is Kras^G12D/YTHDF1^lox/loxLung tissue of mice, YTHDF1 knockout mice and Kras^G12D/P53^lox/loxThe lung cancer mouse model hybridization and experimental flow chart is shown in figure 12;

example 1: RT-PCR experiment for detecting expression of YTHDF1 in lung cancer cell line

1. Total RNA extraction from cells

(1) When the normal lung epithelial cells and the lung cancer cells grow to 80% coverage, removing the supernatant, washing the serum with PBS, adding 1mL of TRizol, horizontally placing for 5 minutes to ensure that the TRizol is uniformly distributed on the cell surface and lyses the cells, blowing the cells to make the cells fall off from a culture dish, transferring all the liquid into a centrifugal tube, and repeatedly blowing until no obvious large precipitate exists in the lysate; standing at room temperature for 5 min;

(2) centrifuging at 12,000g for 5min in a 4 ℃ centrifuge and transferring the supernatant to a new 1.5mL centrifuge tube;

(3) adding 200 μ L chloroform, shaking with a vortex apparatus, centrifuging at 12,000g for 15min in a 4 deg.C centrifuge, and separating the liquid into three layers;

(4) sucking the upper aqueous phase (paying attention not to touch the middle protein layer), and transferring into a new centrifuge tube of RNAase free;

(5) adding isopropanol with the same volume, gently turning upside down for 5 times, and standing at room temperature for 10 min;

(6) centrifuging at 12,000rpm at 4 deg.C for 10min to obtain white precipitate;

(7) discarding the supernatant, adding 1mL of 75% ethanol treated by DEPC, and reversing the mixture from top to bottom for several times to wash and precipitate; 7500g, centrifuging for 5 minutes, discarding the supernatant and keeping the precipitate;

(8) drying RNA at room temperature, and adding RNase-free water for dissolving;

(9) OD was measured to determine the concentration and quality of RNA, which was then stored at-80 ℃.

2. Reverse Transcription Reaction (RT)

Mu.g of the RNA extracted above was reverse transcribed using TAKARA kit. The method comprises the following specific steps: preparing a reaction mixed solution on ice according to the following components, subpackaging the reaction mixed solution into each reaction tube, and finally adding an RNA sample; mixing gently, and reacting at 42 deg.C for 2min (or 5min at room temperature);

components	Volume (μ L)
		5×gDNA Eraser Buffer	2
gDNA Eraser	1
		Total RNA	1μg
RNase Free dH₂O	To 10
		Total volume	10

After the reaction, the sample was placed on ice, mixed Mix was prepared according to the following table, and then dispensed into each reaction tube at 10 uL:

and (3) carrying out reverse transcription reaction immediately after soft and uniform mixing: 15min at 37 ℃, 5s at 85 ℃ and 4 ℃.

3、qPCR

Three replicate wells were set for each sample, formulated as follows:

components	Volume (uL)
		Syber Green Mix	10
cDNA template	1
		10uM upstream and downstream primers Mix	0.6
Sterilization double distilled water	8.4
		Total volume	20

；

Mixing the above components, adding into each hole of a 96-well plate, sealing membrane, centrifuging to collect liquid at the bottom of the tube; the PCR reaction was performed according to the following conditions, with the thermal cycling parameters as follows: at 50 ℃ for 2 min; at 95 ℃ for 2 min; at 95 ℃ for 10 min; 95 ℃, 15s, 60 ℃ for 1min, 40 cycles.

The primers used were as follows: YTHDF1_ F: TGATCTAATGTGAAATGTAAG; YTHDF1_ R: CTTACATTTCACATTAGATCA; AAGTGTGACGTGGACATCCGC, beta-actin _ F; CCGGACTCGTCATACTCCTGCT, wherein the beta-actin is used as an internal reference.

The results are shown in FIG. 1 for the expression of YTHDF1mRNA in different lung cell lines, normal human lung epithelial cells (Beas-2B) and lung cancer cell lines (H1975, A549, H838, H1299, GLC-82, SPC-A1 and H1650) as controls; the experimental result shows that the expression of YTHDF1mRNA in the lung cancer cell is obviously up-regulated compared with the normal lung epithelial cell.

Example 2: western blotting detection of YTHDF1 protein expression

1. WB (Western blotting) assay

1.1 extraction of Total cellular protein

Removing a supernatant culture medium from the cells treated according to a specific experiment, and washing the cells for 1 time by using PBS; adding corresponding cell lysis solution according to the amount of cell precipitate, repeatedly freezing and thawing for 3 times, and blowing continuously during the period; centrifuging at 12000rpm for 10min at 4 deg.C, collecting supernatant, and discarding precipitate for subsequent experiment.

1.2 protein concentration detection and denaturation treatment

The protein concentration detection kit is a Biyuntian BCA protein concentration determination kit (enhanced type), and the cargo number is as follows: P0010S, the method is as follows:

adding the standard substance into standard substance wells of a 96-well plate according to 0, 1, 2, 4, 8, 12, 16 and 20 muL, and adding the standard substance diluent to make up to 20 muL so that the concentrations of the standard substance are 0, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4 and 0.5mg/mL respectively; adding an appropriate volume of sample to the sample wells of a 96-well plate; adding 200 μ LBCA working solution into each well, standing at 37 deg.C for 20 min; measuring absorbance of A562 wavelength by using a microplate reader; the protein concentration of the sample was calculated from the standard curve and the sample volume used.

Taking a proper amount of protein sample, adding 5 times of loading buffer solution, and placing in a metal dry heat instrument at 100 ℃ for boiling for 10 min; taking out, cooling, subpackaging, and storing at-80 deg.C or directly performing SDS-PAGE (polyacrylamide gel) electrophoresis.

1.3 SDS-polyacrylamide gel electrophoresis

(1) Cleaning a glass plate for preparing gel by electrophoresis, drying and fixing on a gel preparation frame; preparing 8-12% of separation gel with different concentrations according to the requirements, adding the concentrated gel according to the formula after the gel is fully solidified, and inserting the gel into a sample groove comb; after the gel is solidified, taking out the gel, pulling out the comb, and cleaning the surface gel with distilled water; fixing the glass plate and the gel on an electrophoresis frame, and adding Tris-glycine electrophoresis buffer solution to ensure that the electrophoresis buffer solution is about 0.5cm above the short glass plate; adding 30-50 μ g of protein into each well, performing electrophoresis at 80V for running out concentrated gel, and performing electrophoresis at 120V; placing the film transferring frame in the film transferring liquid, placing a sponge pad above the black surface, and placing two pieces of filter paper above the sponge pad, wherein the black plastic plate is downward and white; gently taking the gel off the electrophoresis glass plate, putting the gel on filter paper, putting the PVDF membrane above the gel, putting two pieces of filter paper, putting a sponge pad above the filter paper, firmly fixing the black plastic plate and the white plastic plate, and putting the filter paper and the black plastic plate into the pre-cooled membrane transfer buffer solution; under the ice-bath condition, the film is rotated for 3h at 83V voltage; putting the PVDF membrane into TBST containing 5% skimmed milk powder, slowly shaking on a shaking table, and sealing at room temperature for 2 h; adding primary antibody diluted by TBST containing 5% skimmed milk powder, and incubating overnight at 4 deg.C while slowly shaking; washing membrane with TBST for 10min × 3 times; adding HRP-labeled secondary antibody (anti-mouse: 1:20000, anti-rabbit: 1:2000 dilution), and incubating at room temperature for 1 h; washing membrane with TBST for 10min × 3 times; transferring the PVDF membrane to a luminescent plate, adding ECL reagent (mixing the solution A and the solution B in equal amount before use) under the condition of keeping out of the light, developing, and photographing after fixing.

The results are shown in figure 2 expression of YTHDF1 protein in different lung cell lines; cell lysates were tested for expression of YTHDF1 and β -actin, respectively, with β -actin as a control; the experimental result shows that compared with normal lung epithelial cells, the expression of YTHDF1 protein in the lung cancer cells is obviously up-regulated. FIG. 3 expression of YTHDF1 protein in paracarcinoma and carcinoma tissues of 18 lung cancer patients; the tissue lysate is used for respectively detecting the expression of YTHDF1 and beta-actin, and the beta-actin is used as a control; the experimental result shows that compared with normal lung epithelial cells, the expression of YTHDF1 protein in lung cancer tissues is obviously up-regulated. FIG. 5 shows that YTHDF1, Flag and beta-actin are respectively detected in cell lysates of A549 cells, H1299 cells with stably knocked-down expression cells and overexpression exogenous Flag-YTHDF1 cells, and the beta-actin is used as a control, and the result shows that YTHDF1 is knocked-down and overexpressed; FIG. 10 shows that the expression of CDK2, CDK4 and Cyclin D1 proteins is significantly reduced and the expression of P27 protein is significantly increased in A549 and H1299 stably-knocked-down expression cell strains of cell cycle-associated proteins; CDK6 was not significantly different.

Example 3: clinical experiments

1. Immunohistochemical assay

Lung cancer tissue chips and lung cancer pathological tissue slices are obtained by cooperating with hospitals such as Hunan ya Hospital pathology department of the university of China, nude mice tumor samples are prepared by formalin fixation and wax immersion slicing, the samples are placed in 80 ℃ for 2 hours of baking, xylene is used for immersion dewaxing, gradient alcohol dehydration is carried out, the samples are immersed in 0.3% hydrogen peroxide (prepared by methanol and water) solution for 15 minutes to remove tissue peroxidase, Tris Buffer Saline (TBS) is used for rinsing, the samples are subjected to 95 ℃ antigen repair for 20 minutes in a microwave oven, and the samples are recovered for 1 hour at room temperature; TBS was then washed three times, 5% goat serum was incubated for 30min to remove non-specific binding, primary anti-YTHDF1(Proteintech, 11515-1-AP, 1:200), anti-clear-caspase 3(CC3: CST, 9661S, 1:1000), anti-Ki67(MAXIM Biotechnologies, MAB-0005, ready to use), anti-Napsin A (MAXIM Biotechnologies, MAB-0704, ready to use), anti-TTF (MAXIM Biotechnologies, MAB-0599, ready to use), incubated at 4 ℃ for two hours, TBS washed three times, HRP-labeled secondary antibody (Santa cruz, USA) for 30 min; diaminobenzidine (DAB) visualization, further hematoxylin staining, then sections were dehydrated, xylene cleared, and Dibutylphthalate xylene (DPX) coverslips; photographs were taken with a microscope (Olympus, Tokyo, Japan) and analyzed; the expression of YTHDF1 is scored by using an H-scores method, and the comprehensive evaluation is carried out from the aspects of tumor expression intensity and expression positive rate. The staining intensity was divided into: negative (0), weak positive (1), moderate positive (2) and strong positive (3). According to the proportion of positive staining cells: negatives (0), 1-25% (1), 26-50% (2), 51-75% (3), 76-100% (4); the final index of staining of each specimen was judged as intensity x positive rate. Score < 8 was assigned as the low expression YTHDF1 group and > 8 was assigned as the high expression YTHDF1 group, the results are shown in A, B of FIG. 4.

Fig. 13, 14, 15, 16, 17, 18, 19 are results of various staining in mouse models of lung cancer, fig. 13, 18 show HE staining patterns of lung tissue of mice of different origin, and the results show that tumor number and size are significantly reduced in YTHDF1 knockout mice; FIG. 15 shows that the tumor nature inducing lung cancer in mice is lung adenocarcinoma, and staining results of two markers of lung adenocarcinoma, Napsin A and TTF-1, show positive; FIG. 14 shows that YTHDF1 protein was high in KP mice, while YTHDF1 protein expression was not detected in KPY mice; FIG. 17 shows that YTHDF1 protein was high in K mice, while YTHDF1 protein expression was not detected in KY mice; FIGS. 16 and 19 show that the proliferation and apoptosis of YTHDF1 gene in different K and KP mice are inhibited, and FIG. 16 shows that the cell proliferation (Ki67) is inhibited and the apoptosis (cleared-caspase 3) is increased obviously in YTHDF1 knock-out KP mice; fig. 19 shows that cell proliferation (Ki67) was significantly inhibited and apoptosis (cleared-caspase 3) was significantly increased in YTHDF1 knockout K mice.

Table 1: clinical and case characteristics of 487 patients

Example 4: plasmid construction and establishment of stable cell line

Designing two shRNA targets for independent knockdown expression aiming at human YTHDF1, wherein the two shRNA targets are ACAGACAGTGTGATGGATGAT (shRNA #1) or TCACTTCCTCTGAACTGTTAC (shRNA # 2); control shRNA was script shRNA: GCACTACCAGAGCTAACTCA, respectively;

after Oligo sequences were synthesized, diluted to a concentration of 20. mu.M; the Oligo sequence is as follows:

Forward oligo:YTHDF1FO1(SEQ ID NO:3)

CCGGACAGACAGTGTGATGGATGATCTCGAGATCATCCATCACACTGTCTGTTTTTTG

Reverse oligo:YTHDF1RO1(SEQ ID NO:4)

AATTCAAAAAACAGACAGTGTGATGGATGATCTCGAGATCATCCATCACACTGTCTGT

or

Forward oligo:YTHDF1FO2(SEQ ID NO:5)

CCGGTCACTTCCTCTGAACTGTTACCTCGAGGTAACAGTTCAGAGGAAGTGATTTTTG

Reverse oligo:YTHDF1RO2(SEQ ID NO:6)

AATTCAAAAATCACTTCCTCTGAACTGTTACCTCGAGGTAACAGTTCAGAGGAAGTGA

The reaction was carried out under the following conditions: 5 μ L Forward oligo, 5 μ L LReverse oligo, 5 μ L10 XNEB buffer, 35 μ L ddH₂O; boiling in a water bath for 4 minutes, and slowly cooling to room temperature; carrying out enzyme digestion on pLKO.1 by using EcoRI and Age I, carrying out electrophoresis and recovering a carrier fragment; connecting the Oligo reaction mixed solution with the carrier fragment recovered by enzyme digestion at 16 ℃ overnight under the catalysis of T4 ligase; the ligation products were transformed into Stbl 3 by heat shock, spread on LB plates containing ampicillin, and cultured overnight at 37 ℃ in an inverted manner; selecting a single clone in a liquid LB containing ampicillin, carrying out shaking culture at 37 ℃ for 18h, extracting plasmids for enzyme digestion identification (EcoRI and Nco I), and carrying out sequencing verification on a positive clone; amplifying positive target plasmids;

the target plasmid was introduced into HEK-293T by calcium phosphate transfection for virus preparation: preparing a transfection solution: solution A: ddH₂O 420μL、Cacl ₂60 mu L (2mol/L), psPAX27.5 mu g, pMD2.G 5 mu g and pLKO.1-shRNA 12.5 mu g; and B, liquid B: 2 × HEPES 500. mu.L. Mixing, adding solution A into solution B dropwise, shaking, reacting at room temperature for 30min, adding into HEK-293T with coverage rate of 70%, and adding 5% CO₂Culturing in an incubator at 37 ℃; changing the liquid after 8h after transfection, collecting the virus after 48h and 72h, and filtering with a 0.45 mu M filter membrane to obtain virus supernatant; fresh virus liquid is infected into target cells (A549 and H1299), and 4 mug/mL polybrene is used for promoting the infection efficiency; after 72h of infection, positive cells are screened for at least three times by puromycin with corresponding concentration; amplifying and identifying the knocking efficiency of the target gene, and finding that the mRNA and protein level of YTHDF1 is successfully knocked down after the obtained stable transgenic cell strain is identified by real-time PCR (see figure 5).

Example 5: cell proliferation inhibition assay

1. Taking stably knocked-down cell strains growing in logarithmic phase for measuring cell proliferation capacity, digesting the stably knocked-down cell strains into single cells by pancreatin, stopping digestion to prepare cell suspension, and measuring the concentration; according to the desired number of cells (A549: 2.0X 10)⁴Hole, H1299: 2.0X 10⁴Perwell), the corresponding cell suspension was seeded in 12-well plates (1.5 mL/well) with complete medium at 37 ℃ with 5% CO₂Culturing for 6 days; counting is carried out every day: discarding the supernatant, digesting 500 μ L pancreatin, and counting; respectively calculating the number of cells according to the concentration, and drawing a growth curve;

the results of the experiments showed that when YTHDF1 was knocked down, the proliferation of the cells was inhibited (fig. 6).

2. An EdU insertion experiment, which is to use 10M EdU to replace thymine to dope DNA and use an EdU antibody to detect the incorporation ratio of the EdU to verify the proliferation capacity of cells;

a549 and/or H1299 stably knocked-down cells grown to 80% coverage, supernatant was removed, serum was washed out with PBS, 1mL of 0.25% pancreatin was digested for 3 minutes, then 5mL of medium was added to stop, blown into single cell suspension, counted with a Countstar cell counter, and 5X 10 cells were grown at 500. mu.L/well⁴The total amount of cells (c) was seeded in 8-well plates and placed at 37 ℃ in 5% CO₂Standing overnight in a carbon dioxide incubator, adding 10 μ M EdU (final concentration) after 24 hours, incubating in the incubator, taking out from the incubator after 20min, removing the culture medium, and rinsing with PBS once; fixing with 200 μ L of 4% Paraformaldehyde (PFA), washing with PBS once after 20min, dyeing with EdU according to the reagent and operation procedure provided in the kit, finishing dyeing, storing at 4 deg.C, photographing with a fluorescence microscope, and counting.

Incorporation of EdU in the stably transfected YTHDF 1-knockdown cell lines was significantly reduced compared to the control (see fig. 7).

Example 6: cell cycle assay

1. Sample preparation

A549 and H1299 stably knock-down cells to grow to 80% coverage, removing culture medium supernatant, washing with PBS once, digesting with 1mL of 0.25% pancreatin for 3 minutes, then adding 5mL of culture medium to stop, blowing to form single cell suspension, counting with countstar, and counting according to 2mL of culture medium volume per well and 3 multiplied by 10 of total cell amount⁵-4×10⁵One, seeded in 6-well plates, with three replicate wells per sample, gently mixed to ensure uniform cell distribution, then placed at 37 ℃ with 5% CO₂Standing overnight in a carbon dioxide incubator; after 24 hours, the medium supernatant was removed, starved with 2mL of serum-free medium, placed at 37 ℃ and 5% CO₂Carbon dioxide in incubatorAt night; removing the serum-free culture medium, and adding a complete culture medium containing serum for releasing for 6-8 hours; removing culture medium supernatant, washing with PBS once, digesting with 0.5mL of 0.25% pancreatin for 3 min, adding 2mL of culture medium, stopping, and gently blowing to obtain single cell suspension; collecting cells into a centrifuge tube, and centrifuging for 5 minutes at 1500 rpm; adding 5mL of PBS for washing once, centrifuging at 1500rpm for 5 minutes, and repeating once; remove PBS liquid, resuspend cell pellet with 500 μ LPBS, take care gently; adding 4.5mL of precooled 75% ethanol into a new centrifuge tube, and clearly marking the name of the sample; dropwise adding the resuspended cell suspension into precooled 75% ethanol, and shaking the tube filled with ethanol after dropwise adding to ensure full fixation, wherein the samples are required to correspond one to one; the centrifugal tube cover is tightly covered, and the mixture is stored at 4 ℃ before being put into a machine.

2. Flow assay

The sample was removed from 4 ℃ and centrifuged at 1500rpm for 5 minutes; removing the fixing solution, adding 5mL of PBS for washing, centrifuging at 1500rpm for 5 minutes, and repeating once; staining was performed by adding 500. mu.L of PBS containing RNAase (1:500) plus 0.1% Trion X-100+ 10. mu.L of LPI to each tube; detecting the change of the cell cycle by using a flow cytometer after 15-30 minutes; and (5) carrying out sorting analysis on the data, and drawing a cell cycle distribution diagram and a statistical chart.

Cell cycle experiments show that YTHDF1 knockdown stable transformants have cell arrest at G0/G1 (see FIGS. 8 and 9).

Example 7: nude mouse tumorigenesis experiment

Male BALB/C nude mice at 5 weeks of age were purchased from the Shanghai Slek laboratory animal center (animal license number SYXK (Yue) 2010-0102). The nude mice are raised in SPF level environment and adapted for 2-3 days. On the day of nude mouse beating, A549 stable knockdown cells grow to 80% coverage, culture medium supernatant is removed, PBS is washed once, 1mL of 0.25% pancreatin is digested for 3 minutes, then 5mL of culture medium is added for stopping, the solution is blown into single cell suspension, counting is carried out by a countstar cell counter, and the solution is diluted to 1 × 10⁷density/mL and prepare 1.5mL of cell suspension on ice. Nude mice were randomly divided into 3 groups and numbered. After sterilizing the axillary skin of nude mice with iodophor, pancreatin digested single cell suspension YTHDF1scramble, YTHDF1shRNA1# and YTHDF1shRNA2# were inoculated respectivelyThe mice are inoculated with 100 μ L of the vaccine (containing 1.0X 10 of the vaccine) per mouse, and the vaccine is applied to the axilla of each group of nude mice⁶Individual cells). The general condition of nude mice was observed every 3 days starting one week after inoculation, and the maximum diameter (L: tumor length) and the minimum diameter (W: tumor width) of the tumor volume were measured with a vernier caliper according to the formula V ═ L × W²The approximate volume of the tumor was calculated. Meanwhile, the tumor weight is weighed by an electronic balance, and the growth, weight and tumor weight curves of the transplanted tumor of the nude mouse are drawn. Nude mice were sacrificed at 6 weeks, dissected and tumor mass was removed intact and photographed. The transplanted tumor tissue is taken out and stored at-80 ℃ or fixed in formalin.

A549 cells knocked down with YTHDF1 were able to significantly inhibit tumor growth in nude mice (FIG. 11).

Sequence listing

<110> Kunming animal research institute of Chinese academy of sciences

Application of <120> human YTHDF1 gene

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial sequence (Artificial)

<400> 1

acagacagtg tgatggatga t 21

<210> 2

<211> 21

<212> DNA

<213> Artificial sequence (Artificial)

<400> 2

tcacttcctc tgaactgtta c 21

<210> 3

<211> 58

<212> DNA

<213> Artificial sequence (Artificial)

<400> 3

ccggacagac agtgtgatgg atgatctcga gatcatccat cacactgtct gttttttg 58

<210> 4

<211> 58

<212> DNA

<213> Artificial sequence (Artificial)

<400> 4

aattcaaaaa acagacagtg tgatggatga tctcgagatc atccatcaca ctgtctgt 58

<210> 5

<211> 58

<212> DNA

<213> Artificial sequence (Artificial)

<400> 5

ccggtcactt cctctgaact gttacctcga ggtaacagtt cagaggaagt gatttttg 58

<210> 6

<211> 58

<212> DNA

<213> Artificial sequence (Artificial)

<400> 6

aattcaaaaa tcacttcctc tgaactgtta cctcgaggta acagttcaga ggaagtga 58

<210> 7

<211> 21

<212> DNA

<213> Artificial sequence (Artificial)

<400> 7

tgatctaatg tgaaatgtaa g 21

<210> 8

<211> 21

<212> DNA

<213> Artificial sequence (Artificial)

<400> 8

cttacatttc acattagatc a 21

<210> 9

<211> 21

<212> DNA

<213> Artificial sequence (Artificial)

<400> 9

aagtgtgacg tggacatccg c 21

<210> 10

<211> 22

<212> DNA

<213> Artificial sequence (Artificial)

<400> 10

ccggactcgt catactcctg ct 22

Claims

1. The application of the human YTHDF1 gene expression level detection reagent in preparing a lung cancer clinical diagnosis reagent.

2. Use according to claim 1, characterized in that: the detection of the human YTHDF1 gene expression level is realized by designing a primer sequence of human YTHDF1mRNA by using a human YTHDF1 gene sequence, and detecting the level of the human YTHDF1mRNA by a real-time quantitative PCR method; the primer sequence of the mRNA is as follows:

SEQ ID NO:7︰TGATCTAATGTGAAATGTAAG；

SEQ ID NO:8︰CTTACATTTCACATTAGATCA。

3. the application of the interfering RNA with human YTHDF1 gene as target in preparing the medicine for treating lung cancer.

4. Use according to claim 3, characterized in that: cloning shRNA sequence inhibiting human YTHDF1 gene expression into a lentiviral vector to obtain RNA interference lentivirus for preparing a gene therapy medicament for lung cancer; the sequence for expressing shRNA comprises two inverted repeat sequences of coding DNA of a targeted human YTHDF1 gene, and the middle of the inverted repeat sequences is separated by a stem-loop sequence; wherein, the two inverted repeat sequences are shRNA target sequences of human YTHDF1 gene and complementary sequences thereof respectively; the shRNA target nucleotide sequence of the human YTHDF1 gene is selected from the following nucleotide sequences:

SEQ ID NO:1︰ACAGACAGTGTGATGGATGAT；

SEQ ID NO:2︰TCACTTCCTCTGAACTGTTAC。

5. use according to claim 4, characterized in that: the sequence of the sense strand of the sequence for expressing the shRNA is shown as SEQ ID NO. 3, and the sequence of the antisense strand is shown as SEQ ID NO. 4; or the sequence of the sense strand is shown as SEQ ID NO. 5, and the sequence of the antisense strand is shown as SEQ ID NO. 6.