CN109337942B - Method for producing L-piperidinecarboxylic acid by fermenting mixed bacteria - Google Patents

Method for producing L-piperidinecarboxylic acid by fermenting mixed bacteria Download PDF

Info

Publication number
CN109337942B
CN109337942B CN201811365167.2A CN201811365167A CN109337942B CN 109337942 B CN109337942 B CN 109337942B CN 201811365167 A CN201811365167 A CN 201811365167A CN 109337942 B CN109337942 B CN 109337942B
Authority
CN
China
Prior art keywords
lysine
fermentation
strain
producing
ala
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201811365167.2A
Other languages
Chinese (zh)
Other versions
CN109337942A (en
Inventor
陈可泉
刘易辰
应晗笑
王昕�
欧阳平凯
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Tech University
Original Assignee
Nanjing Tech University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Tech University filed Critical Nanjing Tech University
Priority to CN201811365167.2A priority Critical patent/CN109337942B/en
Publication of CN109337942A publication Critical patent/CN109337942A/en
Application granted granted Critical
Publication of CN109337942B publication Critical patent/CN109337942B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/10—Nitrogen as only ring hetero atom
    • C12P17/12—Nitrogen as only ring hetero atom containing a six-membered hetero ring
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y403/00—Carbon-nitrogen lyases (4.3)
    • C12Y403/01—Ammonia-lyases (4.3.1)
    • C12Y403/01028—L-Lysine cyclodeaminase (4.3.1.28)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a method for producing L-pipecolic acid by mixed fermentation, which takes a lysine-producing strain and a strain over expressing lysine cyclodeaminase as fermentation strains to produce the L-pipecolic acid, wherein the nucleotide sequence of the lysine cyclodeaminase is shown in SEQ ID NO. 1. The invention takes glucose as a substrate and produces the L-pipecolic acid by the co-fermentation of two bacterial strains.

Description

Method for producing L-piperidinecarboxylic acid by fermenting mixed bacteria
Technical Field
The invention relates to a method for producing L-piperidinecarboxylic acid by fermenting mixed bacteria, belonging to the technical field of fermentation.
Background
The piperidine formic acid is a chiral molecule and is an important precursor for producing and synthesizing various heterocyclic polyketone chiral drugs. Such as rapamycin, FK506 and FK 520. They have potent immunosuppressant, neurotrophic and antifungal activity. Rapamycin and its analogs are currently used clinically to prevent immune rejection after organ transplantation, to treat advanced kidney cancer, as a drug in the fields of dermatology and cardiology. The piperidinecarboxylic acid derivatives are responsible for the common core structural features of these compounds: FKBP12 binding motifs, this structural motif can be involved in their binding to FKBP 12. Piperidinecarboxylic acid is essential for the biosynthesis of such compounds, and the supply of piperidinecarboxylic acid is an important factor affecting the yield thereof. In 1997, LeeM.S. et al reported that increased L-lysine feeding resulted in increased levels of L-pipecolic acid and thus increased rapamycin production. In 2013, Xia et al reported that the yield of FK506 was increased by increasing the expression level of the piperidinecarboxylic acid synthesis gene in the FK 506-producing strain. In addition, the piperidinecarboxylic acid also participates in synthesizing antitumor drugs VX710, swainsonine and the like, antibiotics such as jojobin and vancomycin and the like, and has very high application value in the fields of medicine, physiology and the like. Besides being used as precursors of these important drugs, piperidinecarboxylic acid has been reported to have biological activity and clinical application of L-piperidinecarboxylic acid itself.
Before 2001, L-piperidinecarboxylic acid was produced mainly by chemical synthesis. However, the use of chemical synthesis is relatively difficult for chiral compounds, often complicated, and environmentally polluting. With the recent progress of the recognition of the enzyme producing piperidinecarboxylic acid in the two or three decades, biosynthesis has also been gradually advancing. In 2002, Fuji and colleagues discovered accidentally that a P5C reductase encoded by proC from E.coli reduced piperidine-6-carboxylic acid, while P5C reductase acted in combination with L-lysine-transaminase to convert L-lysine to L-pipecolic acid. The engineering strains over expressing the two enzymes are constructed by the method, and 3.9g/L of L-pipecolic acid is successfully produced by 159h of culture fermentation; in 2015, Yasushitani and colleagues constructed L-lysine alpha-oxidase from Scomber japonicus (Scomber japonica) and P2C reductase from Pseudomonas putida, and fermented for 45h produced 45.1g/L of highly optically pure L-piperidinecarboxylic acid. In 2016, Fernando Perrez-Garc i et al constructed L-lysine 6-dehydrogenase genes LysDH and proC from Silicibacter pomeryyi in a strain of Corynebacterium glutamicum with high lysine productivity, and first completed the conversion of L-piperidinecarboxylic acid with glucose as the starting point, with an overall yield of about 0.09 g/g.
Although there are many reports on the biological synthesis of L-pipecolic acid, most of them construct two or more enzymes to convert L-pipecolic acid. The L-piperidinecarboxylic acid is produced by using Lysine Cyclodeaminase (LCD) only one enzyme to complete the deamination, cyclization and reduction of Lysine, and the piperidinecarboxylic acid is produced. The method has great advantages in aspects of initial construction cost, subsequent transformation efficiency, strain stability and the like. However, the conversion rate of the natural LCD at normal temperature is relatively small, the reaction rate is high at high temperature (above 60 ℃) and the enzyme activity is rapidly reduced at the temperature. In 2017, Ying et al performed directional mutation transformation on LCD from s.pristinaespiralis to obtain pipA-V61-V94, which increased the enzyme activity by about 1.8 times. In the same year, the same strain introduces three recombinant plasmids with five genes including pipA-V61-V94 into the same strain, and the yield of the recombinant plasmids reaches 0.13g/g when the recombinant plasmids are used for producing L-pipecolic acid from glucose. However, the transformation method needs to express a plurality of proteins together, and has the unfavorable characteristics of high construction difficulty, poor stability and the like.
Disclosure of Invention
The technical problem to be solved by the invention is to provide a novel fermentation production method of L-piperidinecarboxylic acid, which solves the existing difficulties and can economically, simply, stably and massively produce the L-piperidinecarboxylic acid.
In order to solve the technical problems, the technical scheme adopted by the invention is as follows:
a method for producing L-pipecolic acid by mixed bacteria fermentation uses a lysine-producing strain and a lysine cyclodeaminase overexpression strain as fermentation strains to produce L-pipecolic acid, wherein the nucleotide sequence of the lysine cyclodeaminase is shown in SEQ ID No.1, and the amino acid sequence of the lysine cyclodeaminase overexpression is shown in SEQ ID No. 2.
Preferably, the lysine producing strain is e. The strain is preserved in China center for type culture Collection with the preservation number of CCTCC No. M2013239, and the specific information of the strain is disclosed in detail in the Chinese patent with the application number of 201310285525. In the examples of the present invention, the e.coli NT1003 strain was made ampicillin resistant and kanamycin resistant by introducing ampicillin resistant gene and kanamycin resistant gene into the e.coli NT1003 strain, which was collectively named as e.coli LYS in the present invention.
The invention takes lysine cyclodeaminase SpLCD from Streptomyces pristinaespiralis ATCC25486 as the basis, and obtains an amino acid sequence shown in SEQ ID NO.1 through molecular modification, and a corresponding nucleotide sequence is shown in SEQ ID NO. 2. E.coli BL21(DE3) is used as a host bacterium, and pGro7 plasmid containing molecular chaperone genes and plasmid containing lysine cyclodeaminase SpLCD (pET28a-Val61-Val94-SpLCD) are transformed into E.coli BL21(DE3), so that the E.coli LPA2 strain in the invention is obtained.
Preferably, the strain over-expressing lysine cyclodeaminase is introduced with a plasmid containing a molecular chaperone gene, and the introduction of the molecular chaperone can assist the lysine cyclodeaminase to be better expressed.
Preferably, the method comprises the following steps: the construction method of the bacterial strain for over-expressing the lysine cyclodeaminase comprises the following steps:
the lysine cyclodeaminase genes are cloned into an expression plasmid together to obtain a recombinant plasmid, and the recombinant plasmid is transformed into a host bacterium to obtain a strain over-expressing the lysine cyclodeaminase, wherein the expression plasmid is pET28a, and the host bacterium is E.coli BL21(DE 3).
Preferably, the strain overexpressing lysine cyclodeaminase is constructed as follows:
the pGro7 plasmid containing molecular chaperone gene and the recombinant plasmid containing lysine cyclodeaminase gene (SEQ ID NO.2) are co-transformed into host bacteria to obtain the bacterial strain over expressing lysine cyclodeaminase, wherein the host bacteria is E.coliBL21(DE 3).
Preferably, the fermentation produces L-pipecolic acid, and the fermentation medium comprises the following components: 1-50 g/L glucose, 1-10 g/L ammonium sulfate, 0-2g/L ferrous sulfate, 1-3 g/L yeast powder, 3-10 g/L peptone, 0.1-1 g/L potassium chloride, 0.5-2.0 g/L magnesium sulfate heptahydrate, and 130-100 mg/L vitamin B. The fermentation medium was adjusted to pH 7 using MOPOS buffer (100 mM).
Preferably, the DCW ratio of the lysine-producing strain to the strain overexpressing lysine cyclodeaminase is 3: 1-1: 3, preferably 1: 1.
Preferably, the method for producing L-pipecolic acid by fermentation comprises the following steps:
(1) respectively activating a lysine-producing strain and a lysine cyclodeaminase overexpression strain, and inoculating the lysine-producing strain and the lysine cyclodeaminase overexpression strain into a fermentation culture medium according to the DCW ratio of 3: 1-1: 3;
(2) adding an inducer to induce the expression of lysine cyclodeaminase and induce the lysine-producing strain to produce lysine; the induction conditions are 18-30 ℃ and 100-400 rpm;
(3) the L-pipecolic acid is produced by fermentation under the conditions of 25-47 ℃ and 100-400 rpm.
The method for producing the L-piperidinecarboxylic acid by fermenting the mixed bacteria comprises the following specific steps:
(1) inoculating E.coli LYS into LB culture medium containing chloramphenicol and kanamycin, culturing at 37 deg.C and 200rpm for 8-36 h to obtain E.coli LYS primary seed solution;
(2) inoculating E.coli LPA2 into LB culture medium containing chloramphenicol and kanamycin, culturing at 37 deg.C and 200rpm for 8-36 h to obtain E.coli LPA2 first-level seed solution;
(3) inoculating the primary seed liquid of the E.coli LYS strain and the E.coli LPA2 into a fermentation culture medium containing chloramphenicol and kanamycin at a DCW ratio of 3: 1-1: 3, and culturing at 37 ℃ and 200rpm for 2 h;
(4) adding an L-arabinose solution, inducing molecular chaperone expression, and culturing at 18-30 ℃ and 100-400 rpm for 1-8 h;
(5) then adding IPTG solution, inducing lysine cyclodeaminase to express, and culturing for 1-8 h at 18-30 ℃ and 100-400 rpm;
(6) fermenting and producing the L-pipecolic acid under the fermentation condition of 25-47 ℃ and culturing for 48-72h at 100-400 rpm.
The detection method of the L-pipecolic acid by High Performance Liquid Chromatography (HPLC) comprises the following steps:
firstly, amino acid derivatization of Phenyl Isothiocyanate (PITC):
(1) preparing a 14% triethylamine-acetonitrile solution and a 1.25% PITC-acetonitrile solution; (2) sampling 400 mu L of sample, adding 200 mu L of prepared 14% triethylamine-acetonitrile solution, adding 200 mu L of 1.25% PITC-acetonitrile solution, mixing uniformly, and standing for 1 h; (3) adding 800 μ L of hexane, shaking fully, and standing for 10 min; (4) the mixture was layered and the lower layer solution was removed and filtered through a 0.22 μm filter for subsequent analysis.
Secondly, an HPLC analysis detection method:
the column was Grace Alltima C185 u (250 mm. times.4.6 mm); the detector is UV detector, detectingThe wavelength is 254 nm. The column temperature was set at 40 ℃ during operation, the flow rate was 1mL/min, and the sample volume was 5. mu.L. The mobile phase A is 0.1 mol.L-1A mixed solution of sodium acetate water solution and acetonitrile with the ratio of 93:7 (v/v); mobile phase B was 80% acetonitrile; the flow phase gradient is given in the table below.
Table 1 gradient of flow phase ratio as follows
Figure GDA0002640150410000041
Has the advantages that:
the L-pipecolic acid is produced by fermenting the E.coli NT1003 serving as a strain for producing lysine and the strain for over-expressing lysine cyclodeaminase serving as a fermentation strain, so that the operation is simpler and more convenient, and the large-scale production is facilitated; glucose is used as a substrate instead of lysine, so that the method is more economical; the method for producing the strain mixture by using multiple strains enables each strain to be simpler to construct, the strain burden to be lower and the genetic property to be more stable.
Drawings
FIG. 1 is a mimetic diagram of the substrate binding and product release structure of lysine cyclodeaminase.
FIG. 2 lysine cyclodeaminase Ile61 with NAD+And (5) a structural simulation diagram.
Detailed Description
The invention will be better understood from the following examples. The specific material ratios, process conditions and results described in the examples are illustrative of the invention and should not be construed as limiting the invention.
Example 1: construction of a recombinant plasmid expressing lysine cyclodeaminase.
Cloning of lysine cyclodeaminase gene (SpLCD) from S.pristinaespiralis (ATCC25486) (the gene is synthesized by September, the amino acid sequence is shown as SEQ ID NO.3, and the nucleotide sequence is shown as SEQ ID NO. 4.) both ends are added with XhoI and NcoI enzyme cutting sites, and the gene fragment is inserted into the corresponding enzyme cutting site of expression vector pET28a through double enzyme cutting and connection and is placed under the control of T7 promoter, thus obtaining recombinant plasmid pET28 a-SpLCD.
Example 2: modification of lysine cyclodeaminase Ile 61.
Through the analysis of the SpLCD structure, a bottleneck amino acid site Ile61 in the processes of substrate binding and product release is found. As can be seen from FIG. 1b, the distance between Ile61 and Asp236 is the narrowest of the entire channel, which acts as a bottleneck limiting the access of the substrate small molecule lysine to the active center. As can be seen from FIG. 2a, Ile61 is associated with NAD+The distance between the two is caused by larger steric hindrance of a product release site 1, and the product is limited to be away from an active center by small-molecule L-pipecolic acid. The optimal mutant strain Val61-SpLCD and the recombinant plasmid pET28a-Val61-SpLCD are obtained through full plasmid PCR and saturation mutation screening.
Example 3: modification of lysine cyclodeaminase Ile 94.
Through the analysis of the SpLCD structure, a bottleneck amino acid site Ile94 in the processes of substrate binding and product release is found. As can be seen from FIG. 2b, Ile94 is associated with NAD+The distance between the two is caused by larger steric hindrance of a product release site 2, and the product is limited to be away from an active center by small-molecule L-pipecolic acid. Through whole plasmid PCR and saturation mutation screening, the optimal mutant strain Val94-SpLCD and the recombinant plasmid pET28a-Val94-SpLCD are obtained.
Example 4: modification of lysine cyclodeaminase Ile61 and Ile 94.
Through the analysis of SpLCD structure, bottleneck amino acid sites Ile94 and Ile61 in the processes of substrate combination and product release are found, and through whole plasmid PCR and saturation mutation screening, an optimally combined mutant strain Val61-Val94-SpLCD and a recombinant plasmid pET28a-Val61-Val94-SpLCD are obtained (a nucleotide sequence shown in SEQ ID NO.2 is cloned in pET28a plasmid, and a corresponding amino acid sequence is shown in SEQ ID NO. 1).
Example 5: and (3) constructing a recombinant genetic engineering strain expressing a lysine cyclodeaminase-containing mutant strain.
pET28a-Val61-SpLCD, pET28a-Val94-SpLCD and pET28a-Val61-Val94-SpLCD were passed through CaCl2Transformation into E.coli BL21(DE3) by chemical transformation method to obtain genetically engineered recombinant expressing modified lysine cyclodeaminaseColi BL21(DE3) -pET28a-Val61-SpLCD, E coli BL21(DE3) -pET28a-Val94-SpLCD and E coli BL21(DE3) -pET28a-Val61-Val 94-SpLCD.
Example 6: recombinant escherichia coli is fermented at high density to obtain resting cells serving as a catalyst.
Recombinant E.coli BL21(DE3) -pET28a-Val61-SpLCD, E.coli BL21(DE3) -pET28a-Val94-SpLCD and E.coli BL21(DE3) -pET28a-Val61-Val94-SpLCD were inoculated into LB liquid seed medium containing 100. mu.g/mL kanamycin, respectively.
The culture medium comprises the following components: peptone 10 g/L; J. after yeast powder 5g/L, NaCl 10g/L is cultured overnight at 37 ℃ and 200rpm, the components of a culture medium (containing kanamycin with the same concentration) inoculated into a high-density fermentation liquid culture medium according to the inoculation amount of 1% (ml/ml) are as follows: 30g/L glucose and 20g/L, K yeast powder2HPO48.7g/L；NaH2PO44.2g/L、(NH4)2SO45.5g/L；MgSO42.5g/L, 1.6g/L (CaCl) of trace nutrient solution2·2H2O10g/L、ZnSO4·7H2O 0.50g/L、CuCl2·2H2O 0.25g/L、MnSO4·H2O 2.5g/L、CoCl2·6H2O1.75g/L、H3BO30.125g/L、AlCl3·6H2O 2.5g/L、Na2MoO4·2H2O 0.5g/L、FeSO4·7H2Culturing at 37 deg.C and 200rpm until OD600 is 10 (about 5 hr), adding inducer 0.1mM IPTG, inducing expression at 25 deg.C for 16 hr, centrifuging the bacterial liquid at 8000rpm and 4 deg.C for 5min, discarding supernatant, washing the precipitate with neutral buffer solution for 2-3 times to obtain resting cells, and freezing at-20 deg.C in freezer.
Example 7: and (3) comparing the enzymatic properties of the lysine cyclodeaminase and the mutant strain thereof.
The enzyme activity and apparent kinetic detection of genetically engineered recombinant Escherichia coli E.coli BL21(DE3) -pET28a-Val61-SpLCD containing lysine cyclodeaminase mutant strain and E.coli BL21(DE3) -pET28a-Val94-SpLCD and E.coli BL21(DE3) -pET28a-Val61-Val94-SpLCD resting cell catalyst are carried out under the conditions of 37 ℃ and 1g/L lysine and 100mM HEPES buffer solution (pH 7.2), the results are shown in Table 2, compared with wild type (WT-LCD, other conditions are the same, but the lysine cyclodeaminase is not mutated Escherichia coli recombinant strain), the enzyme activity and catalytic conversion number of all mutant strains are obviously improved, the enzymology of E.coli BL21(DE3) -pET28a-Val61-Val94-SpLCD is best, the enzyme activity is improved by about 1.84 times compared with the wild type, and the catalytic conversion number is improved by about 9 times compared with the wild type.
TABLE 2 comparison of enzymatic Properties of lysine cyclodeaminase wild type and its mutant strains
Figure GDA0002640150410000071
Example 8: coli LYS strain and e.coli LPA2 strain.
E.coli NT1003 was transformed with pET28a plasmid and pACYC plasmid to obtain e.coli LYS strain producing lysine while having ampicillin resistance gene and kanamycin resistance gene.
The E.coli LPA2 strain was obtained by transforming E.coli BL21(DE3) -pET28a-Val61-Val94-SpLCD with pGro7 plasmid.
Example 9:
(1) inoculating E.coli LYS into LB culture medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, and culturing under culture condition for 24 hr to obtain primary seed solution of E.coli LYS; (2) inoculating E.coli LPA2 to LB medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, culturing for 12h under culture conditions to obtain E.coli LPA2 primary seed solution; (3) inoculating the primary seed liquid of the two strains into 30mL of fermentation medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, and culturing the inoculated fermentation liquid under culture conditions for 2 h; (4) adding L-arabinose to ensure that the concentration of the L-arabinose in the fermentation liquor is 1g/L, and culturing the fermentation liquor for 1h under the culture condition; (5) adding IPTG to make the concentration of IPTG in the fermentation liquor be 100mg/L, and placing the fermentation liquor under the induction condition to induce and express for 12 h; (7) and fermenting the fermentation liquor for 48 hours under the fermentation condition.
The main components of the fermentation medium comprise 30g/L glucose, 10g/L ammonium sulfate, 0.3g/L ferrous sulfate, 2g/L yeast powder, 5g/L peptone, 0.5g/L potassium chloride, 1.6g/L magnesium sulfate heptahydrate and 160 mg/L vitamin B;
the fermentation medium uses MOPOS buffer solution (100mM), and the pH value is adjusted to 7;
the DCW ratio of the primary seed liquid of the E.coli LYS and the E.coli LPA2 inoculated in the fermentation medium is 1: 3;
the induction conditions are 25 ℃ and 200 rpm; the fermentation conditions were 37 ℃ and 200 rpm;
the yield of L-pipecolic acid was 471.70mg/L as determined by HPLC analysis.
Example 10:
(1) inoculating E.coli LYS into LB culture medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, and culturing under culture condition for 24 hr to obtain primary seed solution of E.coli LYS; (2) inoculating E.coli LPA2 to LB medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, culturing for 12h under culture conditions to obtain E.coli LPA2 primary seed solution; (3) inoculating the primary seed liquid of the two strains into 30mL of fermentation medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, and culturing the inoculated fermentation liquid under culture conditions for 2 h; (4) adding L-arabinose to ensure that the concentration of the L-arabinose in the fermentation liquor is 1g/L, and culturing the fermentation liquor for 1h under the culture condition; (5) adding IPTG to make the concentration of IPTG in the fermentation liquor be 100mg/L, and placing the fermentation liquor under the induction condition to induce and express for 12 h; (7) and fermenting the fermentation liquor for 48 hours under the fermentation condition.
The main components of the fermentation medium comprise 30g/L glucose, 10g/L ammonium sulfate, 0.3g/L ferrous sulfate, 2g/L yeast powder, 5g/L peptone, 0.5g/L potassium chloride, 1.6g/L magnesium sulfate heptahydrate and 160 mg/L vitamin B;
the fermentation medium uses MOPOS buffer solution (100mM), and the pH value is adjusted to 7;
the DCW ratio of the primary seed liquid of the E.coli LYS and the E.coli LPA2 inoculated in the fermentation medium is 1: 1;
the induction conditions are 25 ℃ and 200 rpm; the fermentation conditions were 37 ℃ and 200 rpm;
the yield of L-pipecolic acid was 545.99mg/L as determined by HPLC analysis.
Example 11:
(1) inoculating E.coli LYS into LB culture medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, and culturing under culture condition for 24 hr to obtain primary seed solution of E.coli LYS; (2) inoculating E.coli LPA2 to LB medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, culturing for 12h under culture conditions to obtain E.coli LPA2 primary seed solution; (3) inoculating the primary seed liquid of the two strains into 30mL of fermentation medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, and culturing the inoculated fermentation liquid under culture conditions for 2 h; (4) adding L-arabinose to ensure that the concentration of the L-arabinose in the fermentation liquor is 1g/L, and culturing the fermentation liquor for 1h under the culture condition; (5) adding IPTG to make the concentration of IPTG in the fermentation liquor be 100mg/L, and placing the fermentation liquor under the induction condition to induce and express for 12 h; (7) and fermenting the fermentation liquor for 48 hours under the fermentation condition.
The main components of the fermentation medium comprise 30g/L glucose, 10g/L ammonium sulfate, 0.3g/L ferrous sulfate, 2g/L yeast powder, 5g/L peptone, 0.5g/L potassium chloride, 1.6g/L magnesium sulfate heptahydrate and 160 mg/L vitamin B;
the fermentation medium uses MOPOS buffer solution (100mM), and the pH value is adjusted to 7;
the DCW ratio of the primary seed liquid of the E.coli LYS and the E.coli LPA2 inoculated in the fermentation medium is 1: 3;
the induction conditions are 25 ℃ and 200 rpm; the fermentation conditions were 37 ℃ and 200 rpm;
the yield of L-pipecolic acid was 249.84mg/L as determined by HPLC analysis.
Example 12:
(1) inoculating E.coli LYS into LB culture medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, and culturing under culture condition for 24 hr to obtain primary seed solution of E.coli LYS; (2) inoculating E.coli LPA2 to LB medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, culturing for 12h under culture conditions to obtain E.coli LPA2 primary seed solution; (3) inoculating the primary seed liquid of the two strains into 30mL of fermentation medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, and culturing the inoculated fermentation liquid under culture conditions for 2 h; (4) adding L-arabinose to ensure that the concentration of the L-arabinose in the fermentation liquor is 1g/L, and culturing the fermentation liquor for 1h under the culture condition; (5) adding IPTG to make the concentration of IPTG in the fermentation liquor be 100mg/L, and placing the fermentation liquor under the induction condition to induce and express for 12 h; (7) and fermenting the fermentation liquor for 48 hours under the fermentation condition.
The main components of the fermentation medium comprise 40g/L glucose, 10g/L ammonium sulfate, 0.3g/L ferrous sulfate, 2g/L yeast powder, 5g/L peptone, 0.5g/L potassium chloride, 1.6g/L magnesium sulfate heptahydrate and 160 mg/L vitamin B;
the fermentation medium uses MOPOS buffer solution (100mM), and the pH value is adjusted to 7;
the DCW ratio of the primary seed liquid of the E.coli LYS and the E.coli LPA2 inoculated in the fermentation medium is 1: 1;
the induction conditions are 25 ℃ and 200 rpm; the fermentation conditions were 37 ℃ and 200 rpm;
the yield of L-pipecolic acid was 343.43mg/L as determined by HPLC analysis.
Example 13:
(1) inoculating E.coli LYS into LB culture medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, and culturing under culture condition for 24 hr to obtain primary seed solution of E.coli LYS; (2) inoculating E.coli LPA2 to LB medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, culturing for 12h under culture conditions to obtain E.coli LPA2 primary seed solution; (3) inoculating the primary seed liquid of the two strains into 30mL of fermentation medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, and culturing the inoculated fermentation liquid under culture conditions for 2 h; (4) adding L-arabinose to ensure that the concentration of the L-arabinose in the fermentation liquor is 1g/L, and culturing the fermentation liquor for 1h under the culture condition; (5) adding IPTG to make the concentration of IPTG in the fermentation liquor be 100mg/L, and placing the fermentation liquor under the induction condition to induce and express for 12 h; (7) and fermenting the fermentation liquor for 48 hours under the fermentation condition.
The main components of the fermentation medium comprise 50g/L glucose, 10g/L ammonium sulfate, 0.3g/L ferrous sulfate, 2g/L yeast powder, 5g/L peptone, 0.5g/L potassium chloride, 1.6g/L magnesium sulfate heptahydrate and 160 mg/L vitamin B;
the fermentation medium uses MOPOS buffer solution (100mM), and the pH value is adjusted to 7;
the DCW ratio of the primary seed liquid of the E.coli LYS and the E.coli LPA2 inoculated in the fermentation medium is 1: 1;
the induction conditions are 25 ℃ and 200 rpm; the fermentation conditions were 37 ℃ and 200 rpm;
the yield of L-pipecolic acid was 241.54mg/L by HPLC analysis.
Example 14:
(1) inoculating E.coli LYS into LB culture medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, and culturing under culture condition for 24 hr to obtain primary seed solution of E.coli LYS; (2) inoculating E.coli LPA2 to LB medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, culturing for 12h under culture conditions to obtain E.coli LPA2 primary seed solution; (3) inoculating the primary seed liquid of the two strains into 30mL of fermentation medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, and culturing the inoculated fermentation liquid under culture conditions for 2 h; (4) adding L-arabinose to ensure that the concentration of the L-arabinose in the fermentation liquor is 1g/L, and culturing the fermentation liquor for 1h under the culture condition; (5) adding IPTG to make the concentration of IPTG in the fermentation liquor 200mg/L, and placing the fermentation liquor under the induction condition for induction expression for 12 h; (7) and fermenting the fermentation liquor for 48 hours under the fermentation condition.
The main components of the fermentation medium comprise 30g/L glucose, 10g/L ammonium sulfate, 0.3g/L ferrous sulfate, 2g/L yeast powder, 5g/L peptone, 0.5g/L potassium chloride, 1.6g/L magnesium sulfate heptahydrate and 160 mg/L vitamin B;
the fermentation medium uses MOPOS buffer solution (100mM), and the pH value is adjusted to 7;
the DCW ratio of the primary seed liquid of the E.coli LYS and the E.coli LPA2 inoculated in the fermentation medium is 1: 1;
the induction conditions are 18 ℃ and 200 rpm; the fermentation conditions were 37 ℃ and 200 rpm;
the yield of L-pipecolic acid was 309.83mg/L as determined by HPLC analysis.
Example 15:
(1) inoculating E.coli LYS into LB culture medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, and culturing under culture condition for 24 hr to obtain primary seed solution of E.coli LYS; (2) inoculating E.coli LPA2 to LB medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, culturing for 12h under culture conditions to obtain E.coli LPA2 primary seed solution; (3) inoculating the primary seed liquid of the two strains into 30mL of fermentation medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, and culturing the inoculated fermentation liquid under culture conditions for 2 h; (4) adding L-arabinose to ensure that the concentration of the L-arabinose in the fermentation liquor is 1g/L, and culturing the fermentation liquor for 1h under the culture condition; (5) adding IPTG to make the concentration of IPTG in the fermentation liquor be 100mg/L, and placing the fermentation liquor under the induction condition to induce and express for 12 h; (7) and fermenting the fermentation liquor for 48 hours under the fermentation condition.
The main components of the fermentation medium comprise 30g/L glucose, 10g/L ammonium sulfate, 0.3g/L ferrous sulfate, 2g/L yeast powder, 5g/L peptone, 0.5g/L potassium chloride, 1.6g/L magnesium sulfate heptahydrate and 160 mg/L vitamin B;
the fermentation medium uses MOPOS buffer solution (100mM), and the pH value is adjusted to 7;
the DCW ratio of the primary seed liquid of the E.coli LYS and the E.coli LPA2 inoculated in the fermentation medium is 1: 1;
the induction conditions are 25 ℃ and 200 rpm; the fermentation conditions were 25 ℃ and 200 rpm;
the yield of L-pipecolic acid was 299.16mg/L as determined by HPLC analysis.
Example 16:
(1) inoculating E.coli LYS into LB culture medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, and culturing under culture condition for 24 hr to obtain primary seed solution of E.coli LYS; (2) inoculating E.coli LPA2 to LB medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, culturing for 12h under culture conditions to obtain E.coli LPA2 primary seed solution; (3) inoculating the primary seed liquid of the two strains into 30mL of fermentation medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, and culturing the inoculated fermentation liquid under culture conditions for 2 h; (4) adding L-arabinose to ensure that the concentration of the L-arabinose in the fermentation liquor is 1g/L, and culturing the fermentation liquor for 1h under the culture condition; (5) adding IPTG to make the concentration of IPTG in the fermentation liquor be 100mg/L, and placing the fermentation liquor under the induction condition to induce and express for 12 h; (7) and fermenting the fermentation liquor for 48 hours under the fermentation condition.
The main components of the fermentation medium comprise 30g/L glucose, 10g/L ammonium sulfate, 0.3g/L ferrous sulfate, 2g/L yeast powder, 5g/L peptone, 0.5g/L potassium chloride, 1.6g/L magnesium sulfate heptahydrate and 160 mg/L vitamin B;
the fermentation medium uses MOPOS buffer solution (100mM), and the pH value is adjusted to 7;
the DCW ratio of the primary seed liquid of the E.coli LYS and the E.coli LPA2 inoculated in the fermentation medium is 1: 1;
the induction conditions are 25 ℃ and 200 rpm; the fermentation conditions were 30 ℃ and 200 rpm;
the yield of L-pipecolic acid was 384.46mg/L as determined by HPLC analysis.
Example 17:
(1) inoculating E.coli LYS into LB culture medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, and culturing under culture condition for 24 hr to obtain primary seed solution of E.coli LYS; (2) inoculating E.coli LPA2 to LB medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, culturing for 12h under culture conditions to obtain E.coli LPA2 primary seed solution; (3) inoculating the primary seed liquid of the two strains into 30mL of fermentation medium containing 34mg/L chloramphenicol and 50mg/L kanamycin, and culturing the inoculated fermentation liquid under culture conditions for 2 h; (4) adding L-arabinose to ensure that the concentration of the L-arabinose in the fermentation liquor is 1g/L, and culturing the fermentation liquor for 1h under the culture condition; (5) adding IPTG to make the concentration of IPTG in the fermentation liquor be 100mg/L, and placing the fermentation liquor under the induction condition to induce and express for 12 h; (7) and fermenting the fermentation liquor for 48 hours under the fermentation condition.
The main components of the fermentation medium comprise 30g/L glucose, 10g/L ammonium sulfate, 0.3g/L ferrous sulfate, 2g/L yeast powder, 5g/L peptone, 0.5g/L potassium chloride, 1.6g/L magnesium sulfate heptahydrate and 160 mg/L vitamin B;
the fermentation medium uses MOPOS buffer solution (100mM), and the pH value is adjusted to 7;
the DCW ratio of the primary seed liquid of the E.coli LYS and the E.coli LPA2 inoculated in the fermentation medium is 1: 1;
the induction conditions are 25 ℃ and 200 rpm; the fermentation conditions were 47 ℃ and 200 rpm;
the yield of L-pipecolic acid was 399.95mg/L as determined by HPLC analysis.
Sequence listing
<110> Nanjing university of industry
<120> method for producing L-piperidinecarboxylic acid by mixed bacteria fermentation
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>355
<212>PRT
<213>2 Ambystoma laterale x Ambystoma jeffersonianum
<400>1
Met Glu Thr Trp Val Leu Gly Arg Arg Asp Val Ala Glu Val Val Ala
1 5 10 15
Ala Val Gly Arg Asp Glu Leu Met Arg Arg Ile Ile Asp Arg Leu Thr
20 2530
Gly Gly Leu Ala Glu Ile Gly Arg Gly Glu Arg His Leu Ser Pro Leu
35 40 45
Arg Gly Gly Leu Glu Arg Ser Glu Pro Val Pro Gly Val Trp Glu Trp
50 55 60
Met Pro His Arg Glu Pro Gly Asp His Ile Thr Leu Lys Thr Val Gly
65 70 75 80
Tyr Ser Pro Ala Asn Pro Gly Arg Phe Gly Leu Pro Thr Val Leu Gly
85 90 95
Thr Val Ala Arg Tyr Asp Asp Thr Thr Gly Ala Leu Thr Ala Leu Met
100 105 110
Asp Gly Val Leu Leu Thr Ala Leu Arg Thr Gly Ala Ala Ser Ala Val
115 120 125
Ala Ser Arg Leu Leu Ala Arg Pro Asp Ser His Thr Leu Gly Leu Ile
130 135 140
Gly Thr Gly Ala Gln Ala Val Thr Gln Leu His Ala Leu Ser Leu Val
145 150 155 160
Leu Pro Leu Gln Arg Ala Leu Val Trp Asp Thr Asp Pro Ala His Arg
165 170 175
Glu Ser Phe Ala Arg Arg Ala Ala Phe Thr Gly Val Ser Val Glu Ile
180 185 190
Ala Glu Pro Ala Arg Ile Ala Ala Glu Ala Asp Val Ile Ser Thr Ala
195 200 205
Thr Ser Val Ala Val Gly Gln Gly Pro Val Leu Pro Asp Thr Gly Val
210 215 220
Arg Glu His Leu His Ile Asn Ala Val Gly Ala Asp Leu Val Gly Lys
225 230 235 240
Thr Glu Leu Pro Leu Gly Leu Leu Glu Arg Ala Phe Val Thr Ala Asp
245 250 255
His Pro Glu Gln Ala Leu Arg Glu Gly Glu Cys Gln Gln Leu Ser Ala
260 265 270
Asp Arg Leu Gly Pro Gln Leu Ala His Leu Cys Ala Asp Pro Ala Ala
275 280 285
Ala Ala Gly Arg Gln Asp Thr Leu Ser Val Phe Asp Ser Thr Gly Phe
290 295 300
Ala Phe Glu Asp Ala Leu Ala Met Glu Val Phe Leu Glu Ala Ala Ala
305 310 315 320
Glu Arg Asp Leu Gly Ile Arg Val Gly Ile Glu His His Pro Gly Asp
325 330 335
Ala Leu Asp Pro Tyr Ala Leu Gln Pro Leu Pro Leu Pro Leu Ala Ala
340 345 350
Pro Ala His
355
<210>2
<211>1068
<212>DNA
<213>2 Ambystoma laterale x Ambystoma jeffersonianum
<400>2
atggaaactt gggttttagg tcgtcgtgat gttgcagaag ttgttgcagc agttggtcgt 60
gatgaattaa tgcgtcgtat tatcgatcgt ttaactggtg gtttagcaga aattggtcgt 120
ggtgaacgtc atttatctcc attacgtggt ggtttagaac gttctgaacc agttccaggt 180
gtgtgggaat ggatgccaca tcgtgaacca ggtgatcata ttactttaaa aactgttggt 240
tattctccag caaatccagg tcgttttggt ttaccaactg tgttaggtac cgttgcacgt 300
tatgatgata ctactggtgc attaactgca ttaatggatg gtgttttatt aactgcatta 360
cgtactggtg cagcatctgc tgttgcatct cgtttattag cacgtccaga ttctcatact 420
ttaggtttaa ttggtactgg tgcacaagca gttactcaat tgcatgcatt atctttagtt 480
ttaccattac aacgtgcatt agtttgggat actgatccag cacatcgtga atcttttgca 540
cgtcgtgcag catttactgg tgtttctgtt gaaattgcag aaccagcacg tattgcagca 600
gaagcagatg ttatttctac tgcaacttct gttgcagttg gtcaaggtcc agttttacca 660
gatactggtg ttcgtgaaca tttacatatt aatgcagttg gtgcagattt agttggtaaa 720
actgaattac cattaggttt attagaacgt gcatttgtta ctgcagatca tccagaacaa 780
gcattacgtg aaggtgaatg tcaacaatta tctgctgatc gtttaggtcc acaattagca 840
catttatgtg cagatccagc agcagcagca ggtcgtcaag atactttatc tgtttttgat 900
tctactggtt ttgcatttga agatgcatta gcaatggaag tttttttaga agcagcagca 960
gaacgtgatt taggtattcg tgttggtatt gaacatcatc caggtgatgc attagatcca 1020
tatgcattac aaccattacc attaccatta gcagcaccag cacattaa 1068
<210>3
<211>355
<212>PRT
<213>2 Ambystoma laterale x Ambystoma jeffersonianum
<400>3
Met Glu Thr Trp Val Leu Gly Arg Arg Asp Val Ala Glu Val Val Ala
1 5 10 15
Ala Val Gly Arg Asp Glu Leu Met Arg Arg Ile Ile Asp Arg Leu Thr
20 25 30
Gly Gly Leu Ala Glu Ile Gly Arg Gly Glu Arg His Leu Ser Pro Leu
35 40 45
Arg Gly Gly Leu Glu Arg Ser Glu Pro Val Pro Gly Ile Trp Glu Trp
50 55 60
Met Pro His Arg Glu Pro Gly Asp His Ile Thr Leu Lys Thr Val Gly
65 70 75 80
Tyr Ser Pro Ala Asn Pro Gly Arg Phe Gly Leu Pro Thr Ile Leu Gly
85 90 95
Thr Val Ala Arg Tyr Asp Asp Thr Thr Gly Ala Leu Thr Ala Leu Met
100 105 110
Asp Gly Val Leu Leu Thr Ala Leu Arg Thr Gly Ala Ala Ser Ala Val
115 120 125
Ala Ser Arg Leu Leu Ala Arg Pro Asp Ser His Thr Leu Gly Leu Ile
130 135 140
Gly Thr Gly Ala Gln Ala Val Thr Gln Leu His Ala Leu Ser Leu Val
145 150 155 160
Leu Pro Leu Gln Arg Ala Leu Val Trp Asp Thr Asp Pro Ala His Arg
165 170 175
Glu Ser Phe Ala Arg Arg Ala Ala Phe Thr Gly Val Ser Val Glu Ile
180 185 190
Ala Glu Pro Ala Arg Ile Ala Ala Glu Ala Asp Val Ile Ser Thr Ala
195 200 205
Thr Ser Val Ala Val Gly Gln Gly Pro Val Leu Pro Asp Thr Gly Val
210 215 220
Arg Glu His Leu His Ile Asn Ala Val Gly Ala Asp Leu Val Gly Lys
225 230 235 240
Thr Glu Leu Pro Leu Gly Leu Leu Glu Arg Ala Phe Val Thr Ala Asp
245 250 255
His Pro Glu Gln Ala Leu Arg Glu Gly Glu Cys Gln Gln Leu Ser Ala
260 265 270
Asp Arg Leu Gly Pro Gln Leu Ala His Leu Cys Ala Asp Pro Ala Ala
275 280 285
Ala Ala Gly Arg Gln Asp Thr Leu Ser Val Phe Asp Ser Thr Gly Phe
290 295 300
Ala Phe Glu Asp Ala Leu Ala Met Glu Val Phe Leu Glu Ala Ala Ala
305 310 315 320
Glu Arg Asp Leu Gly Ile Arg Val Gly Ile Glu His His Pro Gly Asp
325 330 335
Ala Leu Asp Pro Tyr Ala Leu Gln Pro Leu Pro Leu Pro Leu Ala Ala
340 345 350
Pro Ala His
355
<210>4
<211>1068
<212>DNA
<213>2 Ambystoma laterale x Ambystoma jeffersonianum
<400>4
atggaaactt gggttttagg tcgtcgtgat gttgcagaag ttgttgcagc agttggtcgt 60
gatgaattaa tgcgtcgtat tatcgatcgt ttaactggtg gtttagcaga aattggtcgt 120
ggtgaacgtc atttatctcc attacgtggt ggtttagaac gttctgaacc agttccaggt 180
atttgggaat ggatgccaca tcgtgaacca ggtgatcata ttactttaaa aactgttggt 240
tattctccagcaaatccagg tcgttttggt ttaccaacta ttttaggtac cgttgcacgt 300
tatgatgata ctactggtgc attaactgca ttaatggatg gtgttttatt aactgcatta 360
cgtactggtg cagcatctgc tgttgcatct cgtttattag cacgtccaga ttctcatact 420
ttaggtttaa ttggtactgg tgcacaagca gttactcaat tgcatgcatt atctttagtt 480
ttaccattac aacgtgcatt agtttgggat actgatccag cacatcgtga atcttttgca 540
cgtcgtgcag catttactgg tgtttctgtt gaaattgcag aaccagcacg tattgcagca 600
gaagcagatg ttatttctac tgcaacttct gttgcagttg gtcaaggtcc agttttacca 660
gatactggtg ttcgtgaaca tttacatatt aatgcagttg gtgcagattt agttggtaaa 720
actgaattac cattaggttt attagaacgt gcatttgtta ctgcagatca tccagaacaa 780
gcattacgtg aaggtgaatg tcaacaatta tctgctgatc gtttaggtcc acaattagca 840
catttatgtg cagatccagc agcagcagca ggtcgtcaag atactttatc tgtttttgat 900
tctactggtt ttgcatttga agatgcatta gcaatggaag tttttttaga agcagcagca 960
gaacgtgatt taggtattcg tgttggtatt gaacatcatc caggtgatgc attagatcca 1020
tatgcattac aaccattacc attaccatta gcagcaccag cacattaa 1068

Claims (4)

1. A method for producing L-piperidinecarboxylic acid by mixed fermentation is characterized in that a lysine-producing strain and a strain over-expressing lysine cyclodeaminase are used as fermentation strains to produce L-piperidinecarboxylic acid by fermentation;
wherein the content of the first and second substances,
the lysine-producing strain is a CCTCC NO. M2013239 strain introduced with ampicillin resistance genes and kanamycin resistance genes;
the construction method of the bacterial strain for over-expressing the lysine cyclodeaminase comprises the following steps:
cloning the lysine cyclodeaminase gene into an expression plasmid to obtain a recombinant plasmid, and co-transforming the recombinant plasmid and pGro7 plasmid into a host bacterium to obtain a strain over-expressing the lysine cyclodeaminase, wherein the expression plasmid is pET28a, and the host bacterium is pET28aE.coliBL21(DE3), wherein the nucleotide sequence of the lysine cyclodeaminase is shown in SEQ ID NO. 2.
2. The method for producing L-pipecolic acid by fermenting mixed bacteria according to claim 1, wherein the fermentation medium for producing L-pipecolic acid comprises the following components:
1-50 g/L glucose, 1-10 g/L ammonium sulfate, 0-2g/L ferrous sulfate, 1-3 g/L yeast powder, 3-10 g/L peptone, 0.1-1.0 g/L potassium chloride, 0.5-2.0 g/L magnesium sulfate heptahydrate, and 130-100 mg/L vitamin B.
3. The method for producing L-pipecolic acid by fermenting the mixed bacteria according to claim 1, wherein the DCW ratio of the lysine-producing strain to the strain over-expressing lysine cyclodeaminase is 3: 1-1: 3.
4. The method for producing L-pipecolic acid by fermenting mixed bacteria according to claim 1, wherein the method for producing L-pipecolic acid by fermenting comprises the following steps:
(1) respectively activating a lysine-producing strain and a lysine cyclodeaminase overexpression strain, and inoculating the lysine-producing strain and the lysine cyclodeaminase overexpression strain into a fermentation culture medium according to the DCW ratio of 3: 1-1: 3;
(2) adding an inducer to induce the expression of lysine cyclodeaminase; the induction condition is 18-30 ℃ and 100-400 rpm;
(3) the L-pipecolic acid is produced by fermentation under the conditions of 25-47 ℃ and 100-400 rpm.
CN201811365167.2A 2018-11-16 2018-11-16 Method for producing L-piperidinecarboxylic acid by fermenting mixed bacteria Active CN109337942B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811365167.2A CN109337942B (en) 2018-11-16 2018-11-16 Method for producing L-piperidinecarboxylic acid by fermenting mixed bacteria

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811365167.2A CN109337942B (en) 2018-11-16 2018-11-16 Method for producing L-piperidinecarboxylic acid by fermenting mixed bacteria

Publications (2)

Publication Number Publication Date
CN109337942A CN109337942A (en) 2019-02-15
CN109337942B true CN109337942B (en) 2020-10-23

Family

ID=65315669

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811365167.2A Active CN109337942B (en) 2018-11-16 2018-11-16 Method for producing L-piperidinecarboxylic acid by fermenting mixed bacteria

Country Status (1)

Country Link
CN (1) CN109337942B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113512571B (en) * 2021-07-13 2023-02-24 浙江华睿生物技术有限公司 Method for synthesizing L-pipecolic acid by ornithine cyclodeaminase catalysis

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
"Expanding metabolic pathway for de novo biosynthesis of the chiral pharmaceutical intermediate l‑pipecolic acid in Escherichia coli ";Hanxiao Ying等;《Microb Cell Fact》;20170327;第16卷;第1-11页 *
微反应器在酶催化合成哌啶甲酸中的研究;张瑞等;《食品与生物技术学报》;20180331;第37卷(第3期);第262-267页 *

Also Published As

Publication number Publication date
CN109337942A (en) 2019-02-15

Similar Documents

Publication Publication Date Title
CA2731760C (en) Pyripyropene a biosynthetic gene
CN106929521B (en) Aldehyde ketone reductase gene recombination co-expression vector, engineering bacterium and application thereof
CN107699536B (en) Genetically engineered bacterium and application thereof in production of D-1,2, 4-butanetriol
CN108949706B (en) L-proline-4-hydroxylase, gene engineering bacterium thereof, construction method and application
Piasecki et al. Structural and functional studies of a trans‐acyltransferase polyketide assembly line enzyme that catalyzes stereoselective α‐and β‐ketoreduction
CN112592880B (en) Pseudouridine-producing engineering bacterium and application thereof
Sun et al. Efficient biosynthesis of high-value succinic acid and 5-hydroxyleucine using a multienzyme cascade and whole-cell catalysis
CN114107152B (en) Construction method and application of high-yield 3-fucosyllactose microorganism
CN109337942B (en) Method for producing L-piperidinecarboxylic acid by fermenting mixed bacteria
CN113755354A (en) Recombinant saccharomyces cerevisiae for producing gastrodin by using glucose and application thereof
US11098287B2 (en) 17β-hydroxysteroid dehydrogenase mutants and application thereof
CN113444701A (en) Saccharomyces cerevisiae endogenous squalene monooxygenase mutant and application thereof
CN111748535B (en) Alanine dehydrogenase mutant and application thereof in fermentation production of L-alanine
CN110904062A (en) Strain capable of producing L-alanine at high yield
CN112375725B (en) Metabolic engineering strain for producing vitamin B6 and construction method and application thereof
CN109402099B (en) Lysine cyclodeaminase and application thereof
JP2015000015A (en) Method for producing para-aminobenzoic acid
CN110484576B (en) Method for increasing yield of duricin and duricin B
KR100679759B1 (en) Transformant producing secondary metabolite modified with functional group and novel biosynthesis genes
EP3406724B1 (en) Recombinant mutant microorganisms having acrylic acid productivity and method for producing acrylic acid using same
KR102238654B1 (en) Mutant strain of Streptomyces sp. having enhanced biosynthetic ability to produce Ohmyungsamycin A, and method for preparing Ohmyungsamycin A using the same
CN112410274B (en) Genetic engineering bacterium for producing ascomycin and preparation method and application thereof
CN113249281B (en) Recombinant bacterium for producing phloroglucinol by using ethanol and construction method and application thereof
CN113444702B (en) Enone reductase mutant and application thereof
CN114410659B (en) Phaeodactylum tricornutum CRTISO5 gene, protein and application thereof in fucoxanthin synthesis

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
EE01 Entry into force of recordation of patent licensing contract
EE01 Entry into force of recordation of patent licensing contract

Application publication date: 20190215

Assignee: Wuhan Kaiming Biotechnology Co.,Ltd.

Assignor: NANJING University OF TECHNOLOGY

Contract record no.: X2024980000326

Denomination of invention: A method for producing L-piperidine formic acid through mixed bacterial fermentation

Granted publication date: 20201023

License type: Common License

Record date: 20240110