CN109336976A

CN109336976A - The nano antibody of anti-human EGFR and its application

Info

Publication number: CN109336976A
Application number: CN201811129703.9A
Authority: CN
Inventors: 魏星; 刘雪; 陈涛
Original assignee: Jinan University
Current assignee: Guangzhou Sanhuan Wenyue Intellectual Property Operation Co.,Ltd.; Shenzhen Xinrui Gene Technology Co.,Ltd.
Priority date: 2018-09-27
Filing date: 2018-09-27
Publication date: 2019-02-15
Anticipated expiration: 2038-09-27
Also published as: CN109336976B; CN112457405B; CN112457404A; CN112552402A; CN112457405A; CN112521504A; CN112521504B; CN112552402B; CN112457404B

Abstract

The invention discloses the nano antibody of anti-human EGFR a kind of and its applications.The nano antibody is one of amino acid sequence aEG1B4 nano antibody as shown in SEQ ID NO:1, amino acid sequence aEG2C7 nano antibody as shown in SEQ ID NO:2, amino acid sequence aEG2E12 nano antibody as shown in SEQ ID NO:3, amino acid sequence aEG4D9 nano antibody amino acid sequence as shown in SEQ ID NO:4 aEG6B2 nano antibody as shown in SEQ ID NO:5 or the antibody that at least two combinations are formed.The nano antibody has high affinity, specificity and low immunogenicity, and has preferable stability, and structure is simple, is easy to carry out the advantages that engineered, can be preferably applied for the exploitation of antibody drug.

Description

The nano antibody of anti-human EGFR and its application

Technical field

The invention belongs to field of biotechnology, it is related to nano antibody and its application of a kind of anti-human EGFR.

Background technique

This noun of cancer was just suggested at B.C. more than 400 years, was not hacked still by more than 2000 years, nowadays right The threat of human health is further obvious.In recent years, research finds epidermal growth factor (EGFR) mistake in a variety of solid tumor cells Expression, and play an important role in the generation of cancer, development process, it is positively correlated with poor prognosis and drug resistance.EGFR exists It is overexpressed the duration activation that can lead to EGFR/EGF signal path in cancer cell, promotes proliferation, migration and the invasion of cancer cell Activity, and the secretion of the VEGF factor can also be promoted, lead to cancerous tissue microenvironment vascularization.Currently, targeting EGFR is anti- Body achieves preferable effect in the clinical treatment of non-small cell lung cancer, but due to being Chimeric antibodies, so existing centainly Immunogenicity, and since the big penetrating power of its molecular weight is poor, it not can effectively clear minimal disease.

Nano antibody (Nanobody, Nb) is a kind of genetic engineering antibody for containing only single structure domain, can be with high parent With power and specificity and antigen binding.Nano antibody is since antibody molecule amount is small, convenient for substantially reducing in expression in escherichia coli The cost of antibody producing.Meanwhile antibody structure is simple, is conducive to that it is further transformed.Nano antibody molecular volume is lesser Tissue penetration capacity during feature also improves antibody in treatment.Therefore, the nano antibody of anti-EGFR is targeted in EGFR In treatment of cancer, there is very high medical application value.

Summary of the invention

The primary purpose of the present invention is that the shortcomings that overcoming the prior art and deficiency, the nanometer for providing a kind of anti-human EGFR is anti- Body.

Another object of the present invention is to provide the applications of the nano antibody of above-mentioned anti-human EGFR.

The purpose of the invention is achieved by the following technical solution: a kind of nano antibody of anti-human EGFR, is entitled AEG1B4 nano antibody, aEG2C7 nano antibody, aEG2E12 nano antibody, aEG4D9 nano antibody and aEG6B2 nano antibody One of or at least two combination formed antibody；

The amino acid sequence of the aEG1B4 nano antibody is as shown in SEQ ID NO:1；

The amino acid sequence of the aEG2C7 nano antibody is as shown in SEQ ID NO:2；

The amino acid sequence of the aEG2E12 nano antibody is as shown in SEQ ID NO:3；

The amino acid sequence of the aEG4D9 nano antibody is as shown in SEQ ID NO:4；

The amino acid sequence of the aEG6B2 nano antibody is as shown in SEQ ID NO:5.

The nucleotide sequence for encoding the nano antibody of above-mentioned anti-human EGFR is the core of the coding aEG1B4 nano antibody The nucleosides of aEG2E12 nano antibody described in the nucleotide sequence of aEG2C7 nano antibody, coding described in nucleotide sequence, coding The nucleotide of aEG6B2 nano antibody described in the nucleotide sequence of aEG4D9 nano antibody described in acid sequence, coding and coding The nucleotide sequence that one of sequence or at least two combinations are formed.

The nucleotide sequence of the coding aEG1B4 nano antibody is preferably as shown in SEQ ID NO:8.

The nucleotide sequence of the coding aEG2C7 nano antibody is preferably as shown in SEQ ID NO:9.

The nucleotide sequence of the coding aEG2E12 nano antibody is preferably as shown in SEQ ID NO:10.

The nucleotide sequence of the coding aEG4D9 nano antibody is preferably as shown in SEQ ID NO:11.

The nucleotide sequence of the coding aEG6B2 nano antibody is preferably as shown in SEQ ID NO:12.

The coding aEG1B4 nano antibody, aEG2C7 nano antibody, aEG2E12 nano antibody, aEG4D9 nanometer resist The nucleotide sequence of body and aEG6B2 nano antibody by 375,393,375,381 and 372 base compositions, corresponds to coding respectively Amino acid is respectively 125,131,125,127 and 124.AEG1B4 antibody contains 3 complementary determining regions (CDR), wherein coding The amino acid of CDR1 is VNVSNEVMS, and the amino acid for encoding CDR2 is TIANHS, and the amino acid for encoding CDR3 is TLYSGATKQLEY.AEG2C7 antibody contains 3 complementary determining regions, wherein the amino acid for encoding CDR1 is FTFNNEIMA, is compiled The amino acid of code CDR2 is SIAANN, and the amino acid for encoding CDR3 is RYAAEPHTYSMGNKSLRY.AEG2E12 antibody contains 3 A complementary determining region, wherein the amino acid for encoding CDR1 is YSSNNEFMA, and the amino acid for encoding CDR2 is AISTRN, coding The amino acid of CDR3 is GVSYRRPQQLKY.AEG4D9 antibody contains 3 complementary determining regions, wherein encodes the amino acid of CDR1 For DMLSPDNMT, the amino acid for encoding CDR2 is TIHKTD, and the amino acid for encoding CDR3 is GLRSRGLSSKYLEY.aEG6B2 Antibody contains 3 CDR, wherein the amino acid for encoding CDR1 is FNVNPKYMT, and the amino acid for encoding CDR2 is SIRSPG, coding The amino acid of CDR3 is SVSRDEKYMRF.

The nano antibody of the anti-human EGFR contains identical skeleton area: the amino acid for encoding FR1 is

MAQVQLLESGGGLVQPGGSLR LSCAASG, the amino acid for encoding FR2 is WVRQAPGKGLEWVS, encodes FR3 Amino acid be GSTYYADSVKGRFTIS RDNSKNTLYLQMNSLRAEDTAVYYCA, the amino acid for encoding FR4 is

WGQGTLVTVSSAAA。

The preparation method of the nano antibody of the anti-human EGFR, comprising the following steps: the side synthesized by gene (DNA) The nucleotide of the nano antibody of anti-human EGFR described in method composite coding, is then cloned on expression plasmid carrier, and conversion is extremely It expressed, purified in host cell, obtain the nano antibody of anti-human EGFR；It can also be by the method for Peptide systhesis, directly Synthesis obtains the nano antibody of anti-human EGFR.

The nano antibody of the anti-human EGFR is overexpressed in the antibody drug for being characterized disease in preparation treatment EGFR Using.

It includes but is not limited to autoimmunity disease and cancer that the EGFR, which is overexpressed the disease being characterized,.

The cancer is that EGFR high expresses tumour.

The EGFR high expresses tumour concretely lung cancer, head and neck cancer, colon cancer and brain tumor.

The present invention has the following advantages and effects with respect to the prior art:

1. the present invention filtered out in source of people nano antibody library by the method for phage display with the extracellular portion EGFR The nano antibody of separation structure domain (domain) III interaction can obtain full people in the case where human body is immunized without using antigen Resource monoclonal nano antibody, molecular weight are about 13kDa, contain only single structure domain, have high affinity, specificity and low Degree causes people's immunity, also, the highly expressed prokaryotic hosts of binding protein carry out antibody expression, can significantly reduce being produced into for antibody This, promotes the application of antibody.

2. nano antibody provided by the invention, have that stability is good, is easy to be transformed, there is preferable tissue penetration capacity etc. Advantage.

3. nano antibody provided by the invention is source of people, thus in human body non-immunogenicity, it can be preferably applied for resisting The exploitation of tumour antibody drug.

4. the highly expressed prokaryotic hosts of nano antibody binding protein provided by the invention carry out antibody expression, can significantly reduce The production cost of antibody promotes the application of antibody.

Detailed description of the invention

Fig. 1 is that the screening in polyclonal elisa assay nano antibody library is enriched with result figure；Wherein, the hole PBS is blank control, The hole EGFR has been coated with the EGFR polypeptide of synthesis；Primary antibody is the polyclonal phage antibody of amplification purification acquisition after the screening of each wheel library, Secondary antibody is the antibody of the antiphagin M13 of HRP label.

Fig. 2 is positive colony result figure of the monoclonal phage ELISA screening in conjunction with EGFR polypeptide；Wherein, Mei Gedan Clone includes: PBS (blank control wells), CXCR4 polypeptide (irrelevant antigen control wells), EGFR polypeptide (purpose antigen hole).

Fig. 3 is SDS-PAGE protein electrophoresis figure after antibody protein expression and purification；Wherein, figure A is the electrophoretogram of aEG1B4, figure B is the electrophoretogram of aEG2C7, and figure C is the electrophoretogram of aEG2E12, and figure D is the electrophoretogram of aEG4D9, and figure E is aEG6B2, schemes A-E In: swimming lane 1 is Marker, and swimming lane 2 is the holoprotein not induced, and swimming lane 3 is the holoprotein of induction, and swimming lane 4 is the broken of induction Precipitating, swimming lane 5 are the broken supernatants of induction, and swimming lane 6 was that column liquid eggs is white, and swimming lane 7 is to wash that miscellaneous liquid eggs is white, and swimming lane 8-12 is to wash De- protein pipe.

Fig. 4 is the combination situation map of the anti-EGFR nano antibody and EGFR polypeptide using ELISA method detection purifying；Its In, each antibody includes blank control wells PBS, 7 irrelevant antigen control wells: VEGF, CAMPH, BMP2, ENDOF1, FGF21, HER2 and CXCR4 peptide fragment, purpose antigen hole: EGFR polypeptide.

Fig. 5 is the anti-EGFR nano antibody and the complete extracellular fragment of EGFR using the detection purifying of Western Blotting method Combination situation map；Wherein, figure A is aEG1B4, and figure B is aEG2C7, and figure C is aEG2E12, and figure D is aEG4D9, and figure E is AEG6B2 schemes in A-E: swimming lane 1 is albumen marker, and swimming lane 2 is the complete Extracellular domain protein of EGFR；Primary antibody is the anti-EGFR of purifying Antibody, secondary antibody proteinA-HRP.

Fig. 6 is that mtt assay detects influence result figure of the anti-EGFR nano antibody to cancer cell multiplication；Wherein, figure A is that nanometer is anti- Influence result figure of the body to A549 cell Proliferation, figure B is influence result figure of the nano antibody to MCF-7 cell Proliferation, and figure C is to receive Influence result figure of the meter Kang Ti to DU145 cell Proliferation；AVE201 and aHer2-13C1 are as negative control antibody；*: p < 0 *: p < 0.01vs of μ g/mL, * of 0.05vs, 0 μ g/mL (n=3).

Fig. 7 is that flow cytometer and Annexin V/PI double-staining detect influence knot of the nano antibody to cancer cell-apoptosis Fruit figure；Wherein, figure A, C, E is the two-dimentional scatter plot of A549, MCF-7 and DU145 cell of apoptosis respectively, and figure B, D, F are respectively The apoptosis ratio obtained from figure A, C, E；Every kind of cell includes no antibody control group (control), experimental antibodies group (50 μ g/ ML): aEG1B4, aEG2C7, aEG2E12, aEG4D9 and aEG6B2, negative control antibody group (50 μ g/mL): aVE201 and aHer2-13C1；*: p < 0.05vs *: p < 0.01vs of control, * control (n=3).

Fig. 8 is that scratch healing method detects nano antibody to the result photo figure of cancer cell migration；Wherein, figure A~C is respectively A549, MCF-7 and DU145 cell 0h and migration results photo figure for 24 hours.

Fig. 9 is the mobility result figure obtained according to the scratch length computation of Fig. 8；Wherein, figure A~C be respectively A549, MCF-7 and DU145 cell；*: 0 μ g/mL of p < 0.05vs, 0 μ g/mL (n=3) of * *: p < 0.01vs.

Figure 10 is that Transwell method detects nano antibody to the result photo figure of cancer cell migration；Wherein, figure A~C difference It is each concentration nano antibody treated A549, MCF-7 and DU145 cell migration result photo figure.

Figure 11 is the antibody light absorption value trend chart obtained according to Figure 10；Wherein, figure A~C is A549, MCF-7 respectively With DU145 cell；*: 0 μ g/mL of p < 0.05vs, 0 μ g/mL (n=3) of * *: p < 0.01vs.

Figure 12 is that Transwell method detects influence result photo figure of the nano antibody to cancer cell invasion；Wherein, scheme A~C It is the result photo figure of each concentration nano antibody treated A549, MCF-7 and DU145 cell respectively.

Figure 13 is the antibody light absorption value trend chart obtained according to Figure 12；Wherein, figure A~C is A549, MCF-7 respectively With DU145 cell；*: 0 μ g/mL of p < 0.05vs, 0 μ g/mL (n=3) of * *: p < 0.01vs.

Figure 14 is that nano antibody is verified using mice model of lung cancer to the inhibiting effect result figure of tumor size；Wherein, scheme A It is the volume change curve graph of tumour after administration, figure B is the tumor size of each group at the end of dosage period, and figure C is dosage period After each group tumor weight；*: 0 μ g/mL of p < 0.05vs, 0 μ g/mL (n=4/n=5) of * *: p < 0.01vs.

Specific embodiment

The present invention is described in further detail with attached drawing combined with specific embodiments below, but embodiments of the present invention It is without being limited thereto.

Embodiment 1 prepares helper phage

(1) the TG1 escherichia coli cloning bacterial strain that glycerol saves is taken out from -80 DEG C of refrigerators, using the method for four rides It is coated on the plate of TYE non-resistant, 13h is cultivated in 37 DEG C of inversions.

(2) on plate one TG1 monoclonal strain inoculated of picking into 5mL2 × TY non-resistant fluid nutrient medium, 37 DEG C, 230rpm cultivates 13h.

(3) TG1 bacterium solution is transferred in 5mL2 × TY non-resistant fluid nutrient medium with volume ratio 1:100,37 DEG C, 230rpm Cultivate 2h (bacterium solution OD₆₀₀=0.5 or so).

(4) 200 μ L TG1 bacterium solution (OD are taken₆₀₀=0.5 or so) into 1.5mL centrifuge tube, the KM13 auxiliary that 10 μ L are added is bitten Thallus (1 × 10¹³Pfu/mL), it is put into warm bath 30min in 37 DEG C of water of preheating.

(5) soft agar is prepared, after being allowed to cool to 40 DEG C or so, the TG1 bacterium solution that step (4) are handled is poured into, is mixed, then It pours on the TYE solid culture plate containing 50 μ g/mL kalamycin resistances prepared in advance, being stored at room temperature makes its solidification, and 37 DEG C It is inverted culture 13h.

(6) one plaque of picking is put into 5mLTG1 bacterium solution (OD₆₀₀=0.5) in, 37 DEG C, 230rpm shaking table culture 2h.

(7) bacterium solution that step (6) obtains all is transferred in 500mL2 × TY culture medium, 37 DEG C, the training of 230rpm shaking table Support 2h, then plus 500 μ L of kanamycins (concentration in the medium is 50 μ g/mL), 30 DEG C, 230rpm culture 20h.

(8) bacterium solution is centrifuged 20min in 3300g, collects supernatant into a sterile tube, is pressed with 20%PEG/NaCl solution The ratio and supernatant of volume ratio 1:4 mixes, and places 4h on ice.

(9) it then is centrifuged 30min in 3300g, collects precipitating, be resuspended with 1mL sterile PBS (pH=7.4,0.01M) solution Precipitating, 4000g are centrifuged 5min, collect supernatant, as helper phage.

The amplification in 2 bacteriophage nano antibody library of embodiment

(1) thaw on ice containing antibody plasmids TG1 bacterium (i.e. source of people nano antibody phage library, SourceBioscience, London, UK), it is transferred in 500mL 2 × TY fluid nutrient medium (containing mass volume ratio 0.1% The glucose of ampicillin and mass volume ratio 1%), 37 DEG C, 230rpm shaking table culture 2.5h (OD₆₀₀=0.5), then to It is 2 × 10 that quantity, which is wherein added,¹²Helper phage, 37 DEG C of water-bath 30min.

(2) bacterium solution is distributed into 250mL/ bottles, 3200g is centrifuged 10min, removes supernatant, (is contained with 500mL 2 × TY culture medium The ampicillin of mass volume ratio 0.1% and the kanamycins of mass volume ratio 0.05%) precipitating, 25 DEG C, 220rpm are resuspended Shake culture 20h.

(3) bacterium solution 3200g is centrifuged 20min, supernatant is collected, using step (8) in embodiment 1-(9) identical method Purified phage, the library bacteriophage prepared are stored in -80 DEG C.

(4) antibody library titre is surveyed.The first: estimating to prepare using the absorbance value at spectrophotometer measurement 260nm Phage titre in library, library phage titre formula: bacteriophage number/mL=OD₂₆₀× extension rate × 22.14 × 10¹⁰。 Second: being estimated using clone technology method, after bacteriophage is diluted to a certain concentration, the TG1 bacterium for infecting logarithmic growth phase is applied On cloth to solid plate with ampicillin, 37 DEG C are incubated overnight, and are calculated by the number of clone.The antibody library drop amplified Degree is 4.8 × 10¹³pfu/mL。

Embodiment 3 screens the nano antibody of anti-EGFR segment from bacteriophage nano antibody library

(1) screening of anti-EGFR nano antibody bacteriophage

1) by EGFR polypeptide (being purchased from biotech firm of upper hypo Thailand, there is the amino acid sequence as shown in SEQ ID NO.15) packet By (the first round: 0.1mg/mL in immune pipe (nunc)；Second and third wheel: 0.05mg/mL；Fourth, fifth wheel: 0.025mg/ mL；), setting PBS (control) is managed.4 DEG C overnight.

2) coating buffer is poured out, per effective 4.5mL PBS, washing (after liquid is added every time, does not have to stop and directly abandon three times Go), every pipe adds the BSA confining liquid that 4.5mL concentration is mass volume ratio 2%, is placed at room temperature for 2h.

3) BSA confining liquid is outwelled, washing (after liquid is added every time, does not have to stop and directly abandon three times per effective 4.5mL PBS It goes).

4) every pipe addition 4mL contains 5 × 10¹²The 2%BSA solution of pfu bacteriophage, is stored at room temperature 1h.

5) it is washed 10 times (after liquid is added every time, directly being discarded without stopping) using PBST.

6) 500 μ L 1mg/mL trypsin solutions (trypsin solution), overturning digestion elution is added in every pipe 10min。

7) bacteriophage elution liquid is collected into sterile 1.5mL EP pipe, therefrom takes 125 μ L bacteriophage elution liquid, be added (the OD into 875 μ L TG1 bacterium₆₀₀=0.5) it, mixes, is put into warm bath 30min in 37 DEG C of water of preheating.

8) it needs to dilute mixed bacteria liquid according to experiment, then takes 2 μ L to infect bacterium solution and be coated on containing 1% glucose, 0.1% ammonia In the TYE solid panel of parasiticin, it to be used for evaluation and screening result.

9) remaining experimental group is infected bacterium solution to be all coated in identical another piece of TYE solid panel, 37 DEG C of trainings overnight It supports.

10) 2 × TY of 2mL (containing 15% glycerol) is added in the plate of step (9), and whole bacteriums are scraped and are collected into nothing In the 1.5mL centrifuge tube of bacterium.Therefrom inhale 50 μ L bacterium solutions be inoculated into the new 2 × TY fluid nutrient medium of 50mL (containing 1% glucose, 0.1% ampicillin), 37 DEG C, 230rpm shaking table culture about 2h make bacteria concentration to OD₆₀₀=0.5.After 2h, taken from 50mL 10mL bacterium solution is into 50mL centrifuge tube, then adds helper phage into centrifuge tube, and centrifuge tube is then put into 37 DEG C of standing water-baths 30min。

11) 3000g is centrifuged 15min, discards supernatant, and (contains 0.1% glucose, 0.1% ammonia with 2 × TY fluid nutrient medium Parasiticin, 0.05% kanamycins), bacterial sediment, 25 DEG C, 230rpm shake culture 20h is resuspended.

12) 3000g is centrifuged 20min, and supernatant 40mL is taken to pour into sterile 50mL centrifuge tube, then adds 10mL into centrifuge tube 20%PEG/NaCl, mixing of turning upside down, ice bath 4h.

13) after 4h, 4 DEG C of 4000g are centrifuged 30min, outwell supernatant.1mL PBS is added, precipitating is resuspended, goes to 1.5mL centrifugation Pipe, 4 DEG C of 10000g are centrifuged 10min again, collect supernatant, 4 DEG C of preservations.

14) repeat step 1) to 13) the step of, altogether carry out 5 wheel enrichment isolations, successively from last round of obtained bacteriophage It is screened.The results are shown in Table 1 for enrichment.Colony counts/negative control hole gram in accumulation rate=coating EGFR antigen hole Grand number

(2) polyclonal Phage-ELISA

1) it takes 0.2 μ g EGFR polypeptide to be coated with 96 holes and plate is immunized, coating buffer is 100 holes μ L/, while blank control wells are arranged (PBS), it stays overnight for 4 DEG C.

2) coating buffer is outwelled.It is washed 3 times (after liquid is added every time, directly being discarded without stopping) with PBS.

3) 280 μ L concentration are then added to be the BSA confining liquid of mass volume ratio 2%, room temperature 2h.

4) 2% (w/v) BSA confining liquid is all outwelled.3 times are washed with PBS (after liquid is added every time, not having to stop direct It discards).

5) the every wheel phage solution for taking step 13) to prepare is as primary antibody, with 2% (w/v) BSA confining liquid with volume ratio 1: 3 ratios mix, and each hole is coated with 100 μ L mixed liquors.Room temperature 1h.

6) it after 1h, is washed 4 times (after liquid is added every time, directly being discarded without stopping) with PBST.

7) the bacteriophage M13 (M13Bacteriophage-HRP) that every hole adds HRP to mark is (with 2% (w/v) BSA confining liquid With volume ratio 1:10000 dilution) 100 μ L of antibody, as secondary antibody, room temperature 1h.

8) after 1h, with PBST wash 4 times, PBS wash 1 time (every time be added liquid after, without stop directly discard).

9) every hole adds 100 μ L TMB developing solutions (the green skies), and room temperature is protected from light 4min.

10) 50 μ L 1M H are added in 4min, every hole₂SO₄Solution.

11) using the light absorption value of microplate reader measurement OD450nm.

The above result shows that being screened by 5 wheels, accumulated with the phage antibody of anti-EGFR specificity.

Respectively take turns the enrichment result of screening in 1 bacteriophage nano antibody library of table

The picking monoclonal phage from the library of the 5th wheel enrichment of embodiment 4 carries out ELISA verifying

(1) bacteriophage that the 5th wheel enrichment isolation obtains is diluted to 10⁸-10¹⁰Times, take 100 μ L dilutions infection logarithm raw Long-term TG1 bacterium solution coated plate is cultivated, every 200 μ of hole from selecting 448 monoclonal bacterial strains in plate at random and being placed in 96 well culture plates L2 × TY culture medium/mono- clone, 37 DEG C, 230rpm shaking table culture 13h.

(2) from drawn in every hole 5 μ L stay overnight bacterium solution be transferred to 96 new holes cell support plate in cultivated, every 200 μ of hole L 2 × TY culture medium/mono- clone, 37 DEG C, 250rpm cultivate 2h, after the bacterium solution that the every hole of old plate is sucked to 95 μ L, then to each The glycerine water solution that 100 μ L concentration are percent by volume 30%, -80 DEG C of storages are added in hole.

(3) gone to after 2h in 1.5mL sterile centrifugation tube, then plus 50 2 × TYs of the μ L containing helper phage, mix, be placed in 37 DEG C water-bath 30min.

(4) 3000g is centrifuged 10min, discards supernatant, (contains 0.1% glucose, 0.1% ammonia benzyl mould with 200 μ L2 × TY Element, 0.05% kanamycins) bacterial sediment is resuspended, the bacterium solution of every pipe is added to a 96 new orifice plates, 25 DEG C, 250rpm shakes Swing culture 20h.

(5) 3000g be centrifuged 10min, each hole supernatant is collected into respectively in a 1.5mL centrifuge tube, 4 DEG C keep in it is standby With.

(6) it takes 0.2 μ g EGFR polypeptide to be coated with 96 holes and plate is immunized, coating buffer is 100 holes μ L/, while blank control wells are arranged (PBS) and CXCR4 polypeptide (be purchased from biotech firm of upper hypo Thailand) irrelevant antigen control wells, 4 DEG C overnight.

(7) coating buffer is outwelled.It is washed 3 times (after liquid is added every time, directly being discarded without stopping) with PBS.

(8) 280 μ L concentration are then added to be the BSA confining liquid of mass volume ratio 2%, room temperature 2h.

(9) 2% (w/v) BSA confining liquid is all outwelled.3 times are washed with PBS (after liquid is added every time, not having to stop direct It discards).

(10) the monoclonal phage solution for taking step (5) to prepare is as primary antibody, with 2% (w/v) BSA confining liquid with volume It is mixed than 1:3 ratio, each 100 μ L mixed liquor of coating hole.Room temperature 1h.

(11) it after 1h, is washed 4 times (after liquid is added every time, directly being discarded without stopping) with PBST.

(12) the bacteriophage M13 (M13Bacteriophage-HRP) that every hole adds HRP to mark (is closed with 2% (w/v) BSA Liquid with volume ratio 1:10000 dilution) 100 μ L of antibody, as secondary antibody, room temperature 1h.

(13) after 1h, with PBST wash 4 times, PBS wash 1 time (every time be added liquid after, without stop directly discard).

(14) every hole adds 100 μ L TMB developing solutions (the green skies), and room temperature is protected from light 4min.

(15) 50 μ L 1M H are added in 4min, every hole₂SO₄Solution.

(16) using the light absorption value of microplate reader measurement OD450nm.As a result it proves to have obtained 25 positive colonies.Fig. 2 is it In 64 monoclonal phages ELISA result.

(17) Huada gene company is sent to carry out DNA sequencing positive colony.In NCBI OFR to the DNA result of sequencing into Row analysis, exclude identical nucleotide sequence, obtain 5 sequences, be named as aEG1B4, aEG2C7, aEG2E12, aEG4D9 and The sequence of aEG6B2,5 nano antibodies are as follows:

AEG1B4:ATGGCCCAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTG GGGGGTCCCTG CGTCTCTCCTGTGCAGCCTCCGGAGTTAACGTTAGCAATGAGGTTATGAGCTGGGTCCGCCAGGCTCCAGGGAAGG GTCTAGAGTGGGTATCAACCATTGCTAACCATAGCGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCAC CATCTCCCGTGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGCGTGCCGAGGACACCGCGGTATAT TATTGCGCGACACTTTATAGTGGTGCTACGAAGCAGTTGGAGTATTGGGGTCAGGGAACCCTGGTCACCGTCTCGA GCGCGGCCGCA；

AEG2C7:ATGGCCCAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTG GGGGGTCCCT G CGTCTCTCCTGTGCAGCCTCCGGATTTACCTTTAACAATGAGATTATGGCCTGGGTCCGCCAGGCTCCAGGGAAGG GTCTAGAGTGGGTATCAAGCATTGCGGCCAATAACGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCAC CATCTCCCGTGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGCGTGCCGAGGACACCGCGGTATAT TATTGCGCGAGATATGCGGCGGAGCCGCATACGTATTCGATGGGGAACAAGTCGCTGAGGTATTGGGGTCAGGGAA CCCTGGTCACCGTCTCGAGCGCGGCCGCA；

AEG2E12:ATGGCCCAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCT GGGGGGTCCCT GCGTCTCTCCTGTGCAGCCTCCGGATATAGCTCTAACAATGAGTTTATGGCCTGGGTCCGCCAGGCTCCAGGGAAG GGTCTAGAGTGGGTATCAGCCATTTCTACGAGAAACGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCA CCATCTCCCGTGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGCGTGCCGAGGACACCGCGGTATA TTATTGCGCGGGTGTGTCTTATAGGAGGCCCCAGCAGTTGAAGTATTGGGGTCAGGGAACCCTGGTCACCGTCTCG AGCGCGGCCGCA；

AEG4D9:ATGGCCCAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTG GGGGGTCCC TG CGTCTCTCCTGTGCAGCCTCCGGAGATATGCTTAGCCCTGACAATATGACCTGGGTCCGCCAGGCTCCAGGGAAGG GTCTAGAGTGGGTATCAACCATTCATAAGACTGACGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCAC CATCTCCCGTGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGCGTGCCGAGGACACCGCGGTATAT TATTGCGCGGGATTGCGTAGTAGGGGGCTTAGTTCGAAGTACCTGGAGTATTGGGGTCAGGGAACCCCGGTCACCG TCTCGAGCGCGGCCGCA；

AEG6B2:ATGGCCCAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTG GGGGGTCCCTG CGTCTCTCCTGTGCAGCCTCCGGATTTAACGTTAACCCTAAGTATATGACCTGGGTCCGCCAGGCTCCAGGGAAGG GTCTAGAGTGGGTATCAAGCATTCGTAGCCCTGGCGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCAC CATCTCCCGTGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGCGTGCCGAGGACACCGCGGTATAT TATTGCGCGAGTGTTAGTCGGGATGAGAAGTACATGCGCTTTTGGGGTCAGGGAACCCTGGTCACCGTCTCGAGCG CGGCCGCA。

Embodiment 5 obtains negative control nano antibody

Negative control nano antibody is obtained using the method for embodiment 1-4, it only will be in embodiment 3 in (1) and embodiment 4 (6) EGFR polypeptide replaces with the synthesis polypeptide (upper biotech firm of hypo Thailand) or blood of human epidermal growth factor receptor-2 (Her2) The synthesis polypeptide (upper biotech firm of hypo Thailand) of endothelial tube growth factor (VEGF), by ELISA select 2 not with antigen binding Clone obtain negative control antibody.

As the nano antibody aHer2-13C1 of negative control (using Her2 as antigen) and aVE201 (with VEGF in experimental example For antigen) it is respectively provided with the amino acid sequence as shown in SEQ ID NO:6 and SEQ ID NO:7.The coding aHer2-13C12 With the nucleotide sequence of aVE201 respectively as shown in SEQ ID NO:13 and SEQ ID NO:14.

Embodiment 6 expresses prokaryotic expression and the purifying of the nano antibody of anti-EGFR

(1) prepared by BL21 competent cell

1) respectively from one bacillus coli DH 5 alpha newly activated of picking on LB plate and BL21 (DE3) bacterium colony (BL21 (DE3) Purchased from day advantageous Science and Technology Ltd. in Tianjin), be inoculated in 5mL LB liquid medium, 37 DEG C, 220rpm overnight incubation (about 12h or so).

2) bacteria suspension is inoculated with the ratio of volume ratio 1:100,500 μ L bacterium solutions is taken to be transferred to 50mL LB Liquid Culture (this step can be scaled up or be reduced according to aequum), 37 DEG C of 2~3h of shaken cultivation, until OD in base₆₀₀=0.5 or so.

3) bacterium solution is transferred in 50mL centrifuge tube, places 10min on ice, 3000g is centrifuged 5min at 4 DEG C, abandons supernatant, uses ice The CaCl of the 10mL0.1mol/L of upper pre-cooling₂Solution gently suspended bacterial cell, places 30min on ice.

4) 4 DEG C, 3000g centrifugation 5min, abandon supernatant, the 0.1mol/LCaCl of 3mL pre-cooling are added₂Solution lightly suspends Bacterial cell stands 5min on ice, completes the preparation of competent cell.

5) glycerol liquor of percent by volume 30% that 3mL has sterilized and has been pre-chilled is added in the competent cell that 3mL is prepared Solution (i.e. 1:1 volume, make final glycerol concentration 15%), mixes gently, and is distributed into every 100 μ L of pipe, is transferred quickly to -80 DEG C of ice Case saves.

(2) nano antibody construction of recombinant vector

Prepare PCR reaction system: 5 × PrimerStar buffer, 10 μ L, dNTP mixture (every kind of 2.5mM) 4 μ L, aEG- F primer (10 μM, 5 '-GATCCATGGCCCAGGTGCAGCTGT-3 ') 1 μ L, aEG-R primer (10 μM, 5 '- TCTGCGGCCGCGCTCGAGAC-3 ') 1 μ L, 0.5 μ L of template 10ng, PrimerStarDNA polymerase, aseptic deionized water benefit Enough to 50 μ L.

PCR reaction: 96 DEG C of 10min；95 DEG C of 10sec, 60 DEG C of 10sec, 72 DEG C of 30sec, 30 circulations；72℃5min.

PCR product is purified by PCR product purification kit.

PET-22b carrier (being purchased from EMD Biosciences (Novagen)) and PCR product are carried out according to following scheme Double enzyme digestion reaction, digestion system are as follows:

2 μ g of pET-22b vector plasmid, 5 μ L of enzyme cutting buffering liquid, 2 NotI μ L, 2 NcoI μ L, sterile water complement to 50 μ L.

1.4 μ g of PCR product, 6 μ L of enzyme cutting buffering liquid, 2 NotI μ L, 2 NcoI μ L, sterile water complement to 60 μ L.

Above-mentioned reaction system is placed in 37 DEG C and keeps the temperature 15 minutes.Up to pET-22b double enzyme digestion product and the double enzymes of target fragment Cut product.

Digestion products are purified by digestion products purification kit.

It is attached reaction, system is as follows: pET-22b double enzyme digestion product 0.03pmol, PCR product double enzyme digestion product 0.3pmol, enzyme connect 2.5 μ L of buffer, 1 μ L of T4DNA ligase, and sterile water complements to 25 μ L.

4 DEG C of connections overnight, obtain connection product.Connection product is transformed into bacillus coli DH 5 alpha competent cell, is coated with In on the LB plate containing 100 μ g/mL ampicillins, primary dcreening operation is then carried out to bacterium colony by primer aEG-F and aEG-R, is obtained Positive colony expand culture.Plasmid is extracted, by endonuclease reaction secondary screening, the positive colony that secondary screening obtains is sequenced, and is obtained The recombinant expression plasmid that pET-22b carrier and nano antibody recombinate.

(3) nano antibody recombinant vector transformed competence colibacillus cell

1) the BL21 competent cell frozen is taken out from -80 DEG C of refrigerators, is placed in and is thawed on ice.

2) of short duration centrifugation recombinant expression plasmid takes 10 μ L recombinant expression plasmids in 1.5mL EP pipe, and is put on ice, EP 100 μ L competent cells are added in pipe, finger flicks tube bottom mixing, places 30min on ice.

3) mixture is kept the temperature into 100s in 42 DEG C of thermostat water baths, is quickly transferred to cooled on ice at least 2min.EP pipe The not antibiotic LB culture medium of 900 μ L of interior addition, 37 DEG C, 220rpm shake bacterium 1.5h.

4) bacterium solution 8000g is centrifuged 1min, makes bacterial sediment to tube bottom, removes 900 μ L supernatants, is cultivated with remaining 100 μ L Bacterial precipitation is resuspended in liquid, and bacterium solution is spread evenly across on the LB solid medium containing 0.1% ampicillin and 1% glucose, 37 DEG C of culture 12-16h.

(4) prokaryotic expression of nano antibody and purifying

1) BL21 (DE3) monoclonal that picking contains recombinant expression plasmid carrier is seeded to 5mL containing 1% glucose and 100 μ In the LB liquid medium of g/mL ampicillin, 37 DEG C, 230rpm shaking table culture 13h.

2) the ratio inoculation of 1:100 by volume takes 4mL to stay overnight bacterium solution and is transferred to 400mL containing 100 μ g/mL ammonia benzyl moulds In the LB liquid medium of element, 37 DEG C, 220rpm shake culture 2-3h make OD₆₀₀=0.6-0.8.

3) 0.25mM IPTG inducing expression is added, 25 DEG C, 230rpm shake culture 6h, 5000g centrifugation 5min abandon supernatant, 40mL breaks bacterium buffer and bacterial sediment, ultrasonication is resuspended, and the 40% of ultrasonic power 650W, ultrasonication 4s rest 8s, protection 10 DEG C of temperature, work 40min.

4) broken liquid is collected to centrifuge tube, 4 DEG C, 15000g centrifugation 30min, collection supernatant to new centrifuge tube, 0.22 μm Membrane filtration, can 4 DEG C of preservations, in case purifying (time of storage be no more than 4 days).

5) antibody protein in broken supernatant is purified using nickel column.The nickel column of 4 DEG C of preservations is taken out, drop is fallen to save liquid (20% alcohol) is added the cleaning of 10mL ultrapure water, starts to carry out subsequent purification.

Step 1: breaking bacterium buffer balance pillar with 10mL.

Step 2: the albumen supernatant of collection is crossed column, it is integrated to destination protein on pillar.

Step 3: washing miscellaneous buffer (imidazoles containing 0.02M) using 20mL washes away foreign protein.

Step 4: eluting using 5mL elution buffer (imidazoles containing 0.2M) to destination protein, and collect the elution of 5 pipes Liquid, 1mL/ pipe.Be collected simultaneously each step crosses column liquid for subsequent detection.

6) the SDS-PAGE electrophoresis sample-loading buffer for preparing each step different component albumen, then carries out SDS-PAGE respectively Electrophoresis detection.SDS-PAGE protein electrophoresis figure after antibody protein expression and purification is as shown in Figure 3.

7) antibody-solutions obtained by all purifying are carried out dialysis in cell PBS (pH=7.4,0.01M), uses 0.22 μm Syringe needle filter filtration sterilization, -80 DEG C of all albumen storages.

8) concentration of anti-egfr antibodies albumen is determined using BCA method.By protein solution with PBS be adjusted to 1mg/mL to Subsequent experimental.

(5) combination for anti-the EGFR nano antibody and EGFR polypeptide that purifying is purified using ELISA method detection

1) 0.2 μ g VEGF, CAMPH, BMP2, ENDOF1, FGF21, HER2, CXCR4, EGFR segment (above piece are taken respectively Section is provided by biotech firm of upper hypo Thailand) the immune plate in 96 holes of coating, coating buffer is 100 holes μ L/, while blank control wells are arranged (PBS), it stays overnight for 4 DEG C.

2) remaining step is according to the step 2) -11 during polyclonal Phage-ELISA in embodiment 3), only by step 7) The bacteriophage M13 of middle HRP label replaces with proteinA-HRP albumen (1:5000 dilutes by volume).As a result as shown in Figure 4.

(6) using the nano antibody and the complete extracellular fragment of EGFR of the anti-EGFR of WesternBlotting method detection purifying Combination

1) the 0.5 complete extracellular fragment of μ g EGFR (purchased from the Divine Land Beijing Yi Qiao biotech firm) is taken to carry out SDS-PAGE electrophoresis, and It goes on pvdf membrane, is closed with 5% skimmed milk power.

2) the aEG antibody of purifying is added, 4 DEG C overnight.

3) second day, PBST was washed 3 times, 6min/ times.

4) secondary antibody protein A-HRP (1:5000) is added, room temperature 1h.

5) PBST is washed 3 times, each 8min.

6) it is uniformly applied on pvdf membrane using ECL luminescent solution (A liquid: B liquid volume ratio=1:1), is placed in gel imaging system It is imaged in system.As a result as shown in Figure 5.

Experimental example 7

Mtt assay detects nano antibody to human lung cancer cell A549, human breast cancer cell line Bcap-37 and Human Prostate Cancer Cells The inhibiting effect of DU145 proliferation (A549, MCF-7 and DU145 are purchased from abundant Biotechnology Co., Ltd of upper Hisense).

(1) 5000 cells are inoculated with into 96 orifice plates (repeat number n=3), 37 DEG C, CO₂The cell incubator that concentration is 5% In be incubated overnight.

(2) old culture medium is removed, (A549, DU145 use 1640, MCF- to the 100 μ L of culture medium of every hole addition serum-free 7 use DMEM), cultivate 4h.

(3) it with the culture medium of the culture medium replacement serum-free of 1%FBS antibody-containing, is added in corresponding cell, 37 DEG C, 5%CO₂Cultivate 72h.4 concentration: 0 μ g/mL, 25 μ g/mL, 50 μ g/mL and 100 μ g/mL are arranged in each antibody.Using AVE201 and aHer2-13C1 are as negative control antibody.

(4) after plus nano antibody 72h, old culture medium is discarded, 120 μ L (1mg/ of MTT-DMEM mixed solution is added in every hole MLMTT:DMEM=volume ratio 1:5), 37 DEG C of heat preservation 4h.

(5) MTT-DMEM mixed liquor is sucked, and plate is dried.150 μ L DMSO dissolution precipitating is added in every hole.It is placed in de- Color shaking table, 10min.

(6) with the absorbance value OD in each hole at microplate reader measurement wavelength 570nm.

As a result as shown in fig. 6, the antibody of 5 anti-EGFR can significantly inhibit cancer with not plus compared with antibody group (0 μ g/mL) Cell Proliferation.Wherein aEG2E12 is existing under 25 μ g/mL concentration significantly inhibits effect to A549 and DU145, and in 50 μ The proliferation of MCF-7 is significantly inhibited under g/mL concentration, antibody concentration and Inhibit proliferaton effect are positively correlated.Result above proves after purification 5 anti-EGFR nano antibodies be able to suppress the proliferation of A549, MCF-7 and DU145 cell.

Effect of 8 nano antibody of experimental example to A549, MCF-7 and DU145 Apoptosis

(1) 250,000/hole of inoculating cell (six orifice plates), 37 DEG C, 5%CO₂It is incubated overnight, keeps its adherent.

(2) old culture medium is removed, the culture medium of serum-free is added in every hole, cultivates 4h, and 1% (v/v) FBS culture is added Base makes the anti-egfr antibodies containing final concentration of 50 μ g/mL in culture medium, using aVE201 and aHer2-13C1 as negative control Antibody, 37 DEG C, 5%CO₂Cultivate 48h.

(3) cell is taken out from incubator, removes old Pei Ji, is washed once using sterile PBS, adds the 700 μ L concentration to be The trypsin solution of 0.25% (w/v) digests, then plus the culture medium termination digestion containing 10%FBS.It gently blows and beats, it is outstanding to collect cell For liquid into sterile 1.5mL EP pipe, 1050g is centrifuged 5min.

(4) plus the sterile PBS of 1mL is into the EP pipe containing cell precipitation, and cell, 3000g centrifugation is gently resuspended with pipette tips 5min.Repetitive operation is primary

Then plus 5 μ L Annexin V- (5) cell is resuspended with 195 μ L combination buffers (Binding buffer, 1 ×), FITC, room temperature, which is protected from light, is incubated for 15min.

(6) 4 DEG C, 1000rpm centrifugation 5min, abandon supernatant.Add 200 μ L combination buffers that cell, 4 DEG C of 1000g centrifugations are resuspended 5min abandons supernatant.

Then plus 10 μ L propidium iodides (Propidium Iodide) cell is resuspended in (7) 190 μ L combination buffers, in 4h Upper machine testing.

As a result as shown in Figure 7, wherein figure A, C, E are A549, MCF-7 and DU145 cell two dimension scatterplot of apoptosis respectively Figure, it can be seen that there is apoptotic cell ratio without antibody control in figure increases (right one side of something).Figure B, D, F are obtained from figure A, C, E respectively The apoptosis ratio arrived.The results show that 5 anti-EGFR nano antibodies after purification can promote A549, MCF-7 and DU145 cell Apoptosis.

Effect of 9 nano antibody of experimental example to A549, MCF-7 and DU145 cell migration

(1) 12 orifice plates are taken, long side is parallel at the back side in hole and draws the parallel lines that two distances are 5mm.Inoculating cell 500000/hole, 37 DEG C, 5%CO₂Overnight incubation keeps its adherent.

(2) old culture medium (A549, DU145 use DMEM using 1640, MCF-7) is removed, serum-free is added in every hole Culture medium cultivates 4h.Cell is scratched perpendicular to the line of back with the muzzle of 200 μ L, three gaps are drawn in every hole, are washed with PBS Fall cast-off cells.

(3) culture medium of 1%FBS antibody-containing is added in corresponding cell simultaneously, 37 DEG C, 5%CO₂Culture 24h.4 concentration: 0 μ g/mL, 25 μ g/mL, 50 μ g/mL and 100 μ g/mL are arranged in each antibody.Using aVE201 and aHer2- 13C1 is as negative control antibody.

(4) it takes pictures under inverted microscope, measures the distance and record in gap.

As a result as shown in FIG. 8 and 9, as 5 nano antibody concentrations increase, the migration of A549, MCF-7 and DU145 cell Rate has reduction, and the reduction of A549 and DU145 cell migration rate is especially apparent, nano antibody concentration and cell migration rate negative It closes, as a result proves that the nano antibody of 5 anti-EGFR after purification is able to suppress the migration of A549, MCF-7 and DU145 cell.

Effect of 10 nano antibody of experimental example to A549, MCF-7 and DU145 cell migration

(1) the sterile cell cell culture Transwell taking-up is placed into 24 orifice plates, upper cell is inoculated with corresponding antibodies With the 200 μ L (2%FBS) of mixing suspension of 50,000,000/hole of cell (24 orifice plate), 500 μ L culture mediums are added in lower cell (containing body The FBS of product percentage 10%), 37 DEG C, 5%CO₂Culture is for 24 hours.4 concentration: 0 μ g/mL, 25 μ g/mL, 50 μ are arranged in each antibody G/mL and 100 μ g/mL.Using aVE201 and aHer2-13C1 as negative control antibody.

(2) culture plate is taken out, tweezers clip cell, washed twice with PBS, wash off culture medium.

(3) 4% paraformaldehydes fix 15min, and then PBS is washed twice.

(4) 2% crystal violets are protected from light dyeing 30min, and then PBS is washed twice.

(5) cell is placed on to be placed under inverted microscope and take pictures by the cell that small indoor is wiped with cotton swab.

20% acetic acid solution of (6) 100 μ L washes off the cell dye liquor of each small outside.

(7) eluent is drawn onto the corresponding hole of 96 orifice plates, microplate reader measure OD570nm, duplicate measurements 3 times.

As a result as shown in FIG. 10 and 11, as 5 nano antibody concentrations increase, the mobility of cancer cell is significantly reduced, with Upper result proves that the nano antibody of 5 anti-EGFR after purification is able to suppress the migration of A549, MCF-7 and DU145 cell.

Effect of 11 nano antibody of experimental example to MCF-7, A549 and DU-145 cell invasion

(1) the sterile cell Transwell is placed into 24 orifice plates, 50 μ L matrigels (1:9 dilution) is added in every hole, gently Shaking culture plate is paved with glue uniformly, in 37 DEG C of incubators overnight, keeps gelling solid.

(2) culture plate for completing glue is taken out, the cell in the upper cell inoculation processed 50,000/hole of cell of corresponding antibodies is mixed It closes 200 μ L of suspension (2%FBS culture medium), 4 concentration: 0 μ g/mL, 25 μ g/mL, 50 μ g/mL and 100 μ g/ are arranged in each antibody 500 μ L culture mediums (10%FBS), 37 DEG C, 5%CO are added in lower cell in mL₂Culture is for 24 hours.Using aVE201 and aHer2-13C1 As negative control antibody.

(3) culture plate is taken out, clips cell with tweezers, PBS is washed twice, washes off culture medium.

(4) 4% paraformaldehydes fix 15min, every 500 μ L of hole, and PBS washes upper cell twice after fixing.

(5) 2% violet staining, is protected from light 30min, and PBS is washed twice.

(6) cell for dabbing off upper small indoor is wiped with cotton swab, and cell is placed on to be placed under inverted microscope and is taken pictures.

20% acetic acid solution of (7) 100 μ L washes off the cell dye liquor of each small outside.

(8) eluent is drawn onto the corresponding hole of 96 orifice plates, measures OD570nm with microplate reader.

As a result as shown in Figures 12 and 13, with not plus compared with antibody group (0 μ g/mL), 5 anti-egfr antibodies can be significantly inhibited Cancer cell invasion.Wherein, aEG2E12 can significantly inhibit three kinds of cancer cell migrations under 25 μ g/mL concentration, and aEG4D9 is in 25 μ g/ A549 and DU145 migration can be significantly inhibited under mL concentration, and MCF-7 migration can be significantly inhibited under 50 μ g/mL concentration.Result above Prove that the nano antibody of 5 anti-EGFR after purification is able to suppress the invasion of A549, MCF-7 and DU145 cell.

Effect of 12 nano antibody of experimental example to mice lung cancer model

(1) pancreatin digests A549 cell, and 1050g is centrifuged 5min.

(2) supernatant is abandoned, the cell being collected into is resuspended with PBS, is placed in centrifuge 1050g centrifugation 5min.

(3) step (2) are repeated.Abandon supernatant, be added appropriate PBS cell precipitation is resuspended and cell density is adjusted to 5 × 10⁷/mL。

(4) 4 week old male Balb/C nude mices (being purchased from Guangdong Medical Lab Animal Center) is chosen, the sterile note of 1mL is used Emitter draws 100 μ L cell suspensions and (contains 5 × 10⁶A A549 cell), with injected s.c. by pallium cell injection in small It carries out making tumor under mouse right axillary, mouse is placed in SPF grades of Animal Lab.s and is routinely raised, use vernier caliper measurement one every three days Secondary mouse tumor volume.

(5) external contractile studies best antibody aEP3D4 and aEP4D11 are chosen and carries out zoopery, aHer2- 13C1 and aVE201 are as negative control.Reach 100mm to knurl product³Afterwards, mouse is randomly divided into 6 groups, every group 5.Wherein 1 Group be blank control group (PBS), 1 group be positive controls (cis-platinum, DDP), 2 groups for experimental antibodies group (aEG2E12, AEG4D9), 2 groups are negative control antibody group (aHer2-13C1, aVE201).It is given using insulin syringe by tail vein Medicine.Wherein every mouse dosage 10mg/kg of experimental antibodies group and negative control nano antibody group, positive controls every is given Medicine 2mg/kg, blank control group every 100 μ L cell PBS buffer solution of injection.Dosage period be 24 days, administration frequency be 3 days/ It is secondary, while recording each group mouse tumor volume.Mouse is put to death after administration, strips tumour, takes pictures and weighs weight.

As a result as shown in figure 14, the increase of experimental antibodies group gross tumor volume is anti-compared with blank control group and negative control after administration Body group obviously slows down, and final volume also may be significantly smaller, it was demonstrated that aEG2E12 and aEG4D9 nano antibody after purification is able to suppress The tumor size of the mice lung cancer model of A549 cell induction.

The preparation method of used reagent is as follows in embodiment:

(1) PBS/PBST (pH7.4): KH₂PO₄ 0.24g、NaCl 8g、KCl 0.2g、Na₂HPO₄·12H₂O 9.07g。

Reagent is weighed, 900mL deionized water dissolving is added, is settled to 1L.

PBST: being added final concentration of 0.1% Tween-20, mix well in prepared PBS buffer solution, 121 DEG C go out Bacterium, 4 DEG C of preservations.

(2) TBS/TBST:Tris alkali 6.05g, NaCl 21.93g.

Reagent 400mL deionized water dissolving is settled to 500mL with dilute hydrochloric acid tune pH to 7.4.

TBST: 500 μ L Tween-20s are added in 500mL TBS buffer, mix well.

(3) LB liquid medium: NaCl 2g, tryptone 2g, yeast extract 1g, ultrapure water 200mL.

LB solid medium: 4g agar powder is added in LB liquid medium formula.

(4) 20% glucose: weighing 200g glucose powder, be dissolved in 1L deionized water, is filtered using 0.22 μM of filter Degerming.

(5) 100 μ g/mL ampicillin solution: 1g powder is weighed, is dissolved in 10mL deionized water and is configured to 100mg/ The solution of mL is distributed into the every pipe of 1mL, -20 DEG C of storages using 0.22 μM of filter filtration sterilization.

(6) SDS-PAGE electrophoresis liquid: glycine 94g, Tris alkali 30.2g, SDS 5g.

By reagent 900mL deionized water dissolving, it is settled to 1L.This reagent is 5 × electrophoresis formula of liquid, 4 DEG C of preservations.

(7) SDS-PAGE transferring film liquid: Tris alkali 15.14g, glycine 72g.

By reagent 900mL deionized water dissolving, it is settled to 1L, 4 DEG C of preservations.This reagent is 5 × electrophoresis formula of liquid.

(8) 500M IPTG: weighing IPTG powder 11.915g, be dissolved in 100mL deionized water, uses 0.2 μm of filter mistake Filter out bacterium.

(9)1M H₂SO₄: the 10mL concentrated sulfuric acid is slowly added in 187mL deionized water.

(10) 100 × PMFS: weighing 1.74g PMSF, is dissolved in 100mL isopropanol, -20 DEG C of preservations.

(11) protein expression and purification buffer

Broken bacterium buffer: Tris alkali 2.42g, NaCl 14.6g, 100 × PMSF 10mL

Reagent is dissolved in 900mL ultrapure water, pH value is adjusted to 7.45 using dilute hydrochloric acid, is settled to 1L, 4 DEG C of preservations.

Sample-loading buffer: with broken bacterium buffer.

It washes miscellaneous buffer: taking sample-loading buffer 20mL, add 200 μ L imidazoles mother liquors (2M).

Elution buffer: taking sample-loading buffer 9mL, adds 1mL imidazoles mother liquor (2M).

(12) 2% bovine serum albumin(BSA) powder (w/v) 2%BSA: is added in PBS buffer solution.

(13) 30% glycerites (glycerol-PBS): measuring 15mL glycerine, is added 35mLPBS buffer (pH=7.4), Use 0.22 μm of filter filtration sterilization, 4 DEG C of preservations.

(14) 10% ammonium persulfates (APS): ammonium sulfate 0.5g, ddH₂O 5mL.It is distributed into the 500 every pipes of μ L, -20 DEG C of preservations.

(15) 1M Tris-Hcl (PH=8.8/PH=6.8): 0.2g Tris-Base powder is weighed, 900mL is dissolved in and goes In ionized water, pH value is adjusted using dilute hydrochloric acid and is settled to 1L, 121 DEG C of sterilizings, 4 DEG C of preservations to 6.8 or 8.8..

(16) Coomassie brilliant blue dye liquor: coomassie brilliant blue R_250 1g, isopropanol 250mL, glacial acetic acid 100mL, ddH₂O 650mL。

(17) coomassie brilliant blue staining destainer: glacial acetic acid 100mL, ethyl alcohol 50mL, ddH₂O 850mL。

(18) 5 × albumen sample-loading buffers: pH 6.8,1M Tris-HCl 12.5mL, SDS 5g, bromophenol blue 0.25g, sweet Oily 25mL.DdH is added in reagent₂O is settled to 50mL, room temperature preservation.500 μ L are taken before use, selectively add 25 μ L β-sulfydryl Ethyl alcohol.

(19) TYE solid medium (400mL): peptone 5g, yeast powder 2.5g, agar powder 4g, ddH₂O 400mL。121 DEG C sterilizing, 1% glucose solution and 100 μ g/mL ampicillins, inverted plate after mixing, 4 DEG C of ice are added when being cooled to 50 DEG C Case saves.

(20) 2 × TY culture mediums (100mL): peptone 1.6g, yeast powder 1g, NaCl 0.5g, ddH₂O 100mL。121 DEG C sterilizing.

(21) 20%PEG/NaCl solution (500mL): PEG600 100g, NaCl 73g, ddH₂O 400mL。

After deionized water dissolving, constant volume to 500mL, 121 DEG C of autoclave sterilization 20min are stored at room temperature.

The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment Limitation, other any changes, modifications, substitutions, combinations, simplifications done without departing from the spirit and principles of the present invention, It should be equivalent substitute mode, be included within the scope of the present invention.

Sequence table

<110>Ji'nan University

<120>nano antibody of anti-human EGFR and its application

<130> 1

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 125

<212> PRT

<213>people (Homo sapiens)

<400> 1

Met Ala Gln Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Asn Val Ser

20 25 30

Asn Glu Val Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu

35 40 45

Trp Val Ser Thr Ile Ala Asn His Ser Gly Ser Thr Tyr Tyr Ala Asp

50 55 60

Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr

65 70 75 80

Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr

85 90 95

Tyr Cys Ala Thr Leu Tyr Ser Gly Ala Thr Lys Gln Leu Glu Tyr Trp

100 105 110

Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ala Ala

115 120 125

<210> 2

<211> 131

<212> PRT

<213>people (Homo sapiens)

<400> 2

Met Ala Gln Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asn

20 25 30

Asn Glu Ile Met Ala Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu

35 40 45

Trp Val Ser Ser Ile Ala Ala Asn Asn Gly Ser Thr Tyr Tyr Ala Asp

50 55 60

Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr

65 70 75 80

Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr

85 90 95

Tyr Cys Ala Arg Tyr Ala Ala Glu Pro His Thr Tyr Ser Met Gly Asn

100 105 110

Lys Ser Leu Arg Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser

115 120 125

Ala Ala Ala

130

<210> 3

<211> 125

<212> PRT

<213>people (Homo sapiens)

<400> 3

Met Ala Gln Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Ser Ser Asn

20 25 30

Asn Glu Phe Met Ala Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu

35 40 45

Trp Val Ser Ala Ile Ser Thr Arg Asn Gly Ser Thr Tyr Tyr Ala Asp

50 55 60

Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr

65 70 75 80

Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr

85 90 95

Tyr Cys Ala Gly Val Ser Tyr Arg Arg Pro Gln Gln Leu Lys Tyr Trp

100 105 110

Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ala Ala

115 120 125

<210> 4

<211> 127

<212> PRT

<213>people (Homo sapiens)

<400> 4

Met Ala Gln Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asp Met Leu Ser

20 25 30

Pro Asp Asn Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu

35 40 45

Trp Val Ser Thr Ile His Lys Thr Asp Gly Ser Thr Tyr Tyr Ala Asp

50 55 60

Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr

65 70 75 80

Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr

85 90 95

Tyr Cys Ala Gly Leu Arg Ser Arg Gly Leu Ser Ser Lys Tyr Leu Glu

100 105 110

Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ala Ala

115 120 125

<210> 5

<211> 124

<212> PRT

<213>people (Homo sapiens)

<400> 5

Met Ala Gln Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Asn Val Asn

20 25 30

Pro Lys Tyr Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu

35 40 45

Trp Val Ser Ser Ile Arg Ser Pro Gly Gly Ser Thr Tyr Tyr Ala Asp

50 55 60

Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr

65 70 75 80

Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr

85 90 95

Tyr Cys Ala Ser Val Ser Arg Asp Glu Lys Tyr Met Arg Phe Trp Gly

100 105 110

Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ala Ala

115 120

<210> 6

<211> 129

<212> PRT

<213>people (Homo sapiens)

<400> 6

Met Ala Gln Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Ser Val Ser

20 25 30

Ser Glu Asn Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu

35 40 45

Trp Val Ser Gly Ile Leu Ala Gly Asp Gly Ser Thr Tyr Tyr Ala Asp

50 55 60

Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr

65 70 75 80

Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr

85 90 95

Tyr Cys Ala Arg Phe Thr Ser Gly Gln Gly Ser Leu Arg Ser Asp Pro

100 105 110

Ile Arg Ser Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ala

115 120 125

Ala

<210> 7

<211> 128

<212> PRT

<213>people (Homo sapiens)

<400> 7

Met Ala Gln Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Ser Val Ser

20 25 30

Asn Glu Ala Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu

35 40 45

Trp Val Ser Ser Ile Thr Asp Gln Ser Gly Ser Thr Tyr Tyr Ala Asp

50 55 60

Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr

65 70 75 80

Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr

85 90 95

Tyr Cys Ala Arg Gly Gln Arg Arg Arg Gln Met His Ser Tyr Lys Val

100 105 110

Ser Ser Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ala Ala

115 120 125

<210> 8

<211> 375

<212> DNA

<213>people (Homo sapiens)

<400> 8

atggcccagg tgcagctgtt ggagtctggg ggaggcttgg tacagcctgg ggggtccctg 60

cgtctctcct gtgcagcctc cggagttaac gttagcaatg aggttatgag ctgggtccgc 120

caggctccag ggaagggtct agagtgggta tcaaccattg ctaaccatag cggtagcaca 180

tactacgcag actccgtgaa gggccggttc accatctccc gtgacaattc caagaacacg 240

ctgtatctgc aaatgaacag cctgcgtgcc gaggacaccg cggtatatta ttgcgcgaca 300

ctttatagtg gtgctacgaa gcagttggag tattggggtc agggaaccct ggtcaccgtc 360

tcgagcgcgg ccgca 375

<210> 9

<211> 393

<212> DNA

<213>people (Homo sapiens)

<400> 9

atggcccagg tgcagctgtt ggagtctggg ggaggcttgg tacagcctgg ggggtccctg 60

cgtctctcct gtgcagcctc cggatttacc tttaacaatg agattatggc ctgggtccgc 120

caggctccag ggaagggtct agagtgggta tcaagcattg cggccaataa cggtagcaca 180

tactacgcag actccgtgaa gggccggttc accatctccc gtgacaattc caagaacacg 240

ctgtatctgc aaatgaacag cctgcgtgcc gaggacaccg cggtatatta ttgcgcgaga 300

tatgcggcgg agccgcatac gtattcgatg gggaacaagt cgctgaggta ttggggtcag 360

ggaaccctgg tcaccgtctc gagcgcggcc gca 393

<210> 10

<211> 375

<212> DNA

<213>people (Homo sapiens)

<400> 10

atggcccagg tgcagctgtt ggagtctggg ggaggcttgg tacagcctgg ggggtccctg 60

cgtctctcct gtgcagcctc cggatatagc tctaacaatg agtttatggc ctgggtccgc 120

caggctccag ggaagggtct agagtgggta tcagccattt ctacgagaaa cggtagcaca 180

tactacgcag actccgtgaa gggccggttc accatctccc gtgacaattc caagaacacg 240

ctgtatctgc aaatgaacag cctgcgtgcc gaggacaccg cggtatatta ttgcgcgggt 300

gtgtcttata ggaggcccca gcagttgaag tattggggtc agggaaccct ggtcaccgtc 360

tcgagcgcgg ccgca 375

<210> 11

<211> 381

<212> DNA

<213>people (Homo sapiens)

<400> 11

atggcccagg tgcagctgtt ggagtctggg ggaggcttgg tacagcctgg ggggtccctg 60

cgtctctcct gtgcagcctc cggagatatg cttagccctg acaatatgac ctgggtccgc 120

caggctccag ggaagggtct agagtgggta tcaaccattc ataagactga cggtagcaca 180

tactacgcag actccgtgaa gggccggttc accatctccc gtgacaattc caagaacacg 240

ctgtatctgc aaatgaacag cctgcgtgcc gaggacaccg cggtatatta ttgcgcggga 300

ttgcgtagta gggggcttag ttcgaagtac ctggagtatt ggggtcaggg aaccccggtc 360

accgtctcga gcgcggccgc a 381

<210> 12

<211> 372

<212> DNA

<213>people (Homo sapiens)

<400> 12

atggcccagg tgcagctgtt ggagtctggg ggaggcttgg tacagcctgg ggggtccctg 60

cgtctctcct gtgcagcctc cggatttaac gttaacccta agtatatgac ctgggtccgc 120

caggctccag ggaagggtct agagtgggta tcaagcattc gtagccctgg cggtagcaca 180

tactacgcag actccgtgaa gggccggttc accatctccc gtgacaattc caagaacacg 240

ctgtatctgc aaatgaacag cctgcgtgcc gaggacaccg cggtatatta ttgcgcgagt 300

gttagtcggg atgagaagta catgcgcttt tggggtcagg gaaccctggt caccgtctcg 360

agcgcggccg ca 372

<210> 13

<211> 387

<212> DNA

<213>people (Homo sapiens)

<400> 13

atggcccagg tgcagctgtt ggagtctggg ggaggcttgg tacagcctgg ggggtccctg 60

cgtctctcct gtgcagcctc cggatatagc gttagctctg agaatatggg ctgggtccgc 120

caggctccag ggaagggtct agagtgggta tcaggcattt tggcgggaga cggtagcaca 180

tactacgcag actccgtgaa gggccggttc accatctccc gtgacaattc caagaacacg 240

ctgtatctgc aaatgaacag cctgcgtgcc gaggacaccg cggtatatta ttgcgcgaga 300

tttacgtcgg gtcaggggtc gttgcggtcc gaccccatcc ggtcttgggg tcagggaacc 360

ctggtcaccg tctcgagcgc ggccgca 387

<210> 14

<211> 384

<212> DNA

<213>people (Homo sapiens)

<400> 14

atggcccagg tgcagctgtt ggagtctggg ggaggcttgg tacagcctgg ggggtccctg 60

cgtctctcct gtgcagcctc cggagttagc gttagcaatg aggctatggg ctgggtccgc 120

caggctccag ggaagggtct agagtgggta tcaagcatta ctgaccaaag cggtagcaca 180

tactacgcag actccgtgaa gggccggttc accatctccc gtgacaattc caagaacacg 240

ctgtatctgc aaatgaacag cctgcgtgcc gaggacaccg cggtatatta ttgcgcgaga 300

gggcagcgtc gtaggcagat gcattcgtac aaggtcagct cttggggtca gggaaccctg 360

gtcaccgtct cgagcgcggc cgca 384

<210> 15

<211> 30

<212> PRT

<213>people (Homo sapiens)

<400> 15

Gln Ala Trp Pro Glu Asn Arg Thr Asp Leu His Ala Phe Glu Asn Leu

1 5 10 15

Glu Ile Ile Arg Gly Arg Thr Lys Gln His Gly Gln Phe Ser

20 25 30

<210> 16

<211> 24

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>aEG-F primer

<400> 16

gatccatggc ccaggtgcag ctgt 24

<210> 17

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<223>aEG-R primer

<400> 17

tctgcggccg cgctcgagac 20

Claims

1. a kind of nano antibody of anti-human EGFR, it is characterised in that: the nano antibody of the anti-human EGFR is entitled AEG1B4 nano antibody, aEG2C7 nano antibody, aEG2E12 nano antibody, aEG4D9 nano antibody and aEG6B2 nano antibody One of or at least two combination formed antibody；

The amino acid sequence of the aEG6B2 nano antibody is as shown in SEQ ID NO:5.

2. the coding nucleotide sequence of the nano antibody of anti-human EGFR described in claim 1, it is characterised in that: be described in coding The nucleotide sequence of aEG1B4 nano antibody, the nucleotide sequence of aEG2C7 nano antibody described in coding, described in coding The nucleotide sequence and coding of aEG4D9 nano antibody described in the nucleotide sequence of aEG2E12 nano antibody, coding is described The nucleotide sequence that one of nucleotide sequence of aEG6B2 nano antibody or at least two combinations are formed.

3. the coding nucleotide sequence of the nano antibody of anti-human EGFR according to claim 2, it is characterised in that:

The nucleotide sequence of the coding aEG1B4 nano antibody is as shown in SEQ ID NO:8；

The nucleotide sequence of the coding aEG2C7 nano antibody is as shown in SEQ ID NO:9；

The nucleotide sequence of the coding aEG2E12 nano antibody is as shown in SEQ ID NO:10；

The nucleotide sequence of the coding aEG4D9 nano antibody is as shown in SEQ ID NO:11；

The nucleotide sequence of the coding aEG6B2 nano antibody is as shown in SEQ ID NO:12.

4. the preparation method of the nano antibody of anti-human EGFR described in claim 1, it is characterised in that the following steps are included: passing through The nucleotide of the nano antibody of anti-human EGFR described in the method composite coding of gene chemical synthesis is then cloned into expression plasmid load On body, conversion is expressed into host cell, is purified, and obtains the nano antibody of anti-human EGFR；Or pass through Peptide systhesis Method, directly synthesis obtain the nano antibody of anti-human EGFR.

5. the nano antibody of anti-human EGFR described in claim 1 is overexpressed the antibody medicine for being characterized disease in preparation treatment EGFR Application in object.

6. the nano antibody of anti-human EGFR according to claim 5 is overexpressed in preparation treatment EGFR and is characterized the anti-of disease Application in body drug, it is characterised in that: the EGFR is overexpressed the disease being characterized and includes but is not limited to: autoimmunity disease And cancer.

7. the nano antibody of anti-human EGFR according to claim 6 is overexpressed in preparation treatment EGFR and is characterized the anti-of disease Application in body drug, it is characterised in that: the cancer is that EGFR high expresses tumour.

8. the nano antibody of anti-human EGFR according to claim 7 is overexpressed in preparation treatment EGFR and is characterized the anti-of disease Application in body drug, it is characterised in that: the EGFR high expression tumour is lung cancer, head and neck cancer, colon cancer or brain tumor.