CN109324185A - A method of for distinguishing syphilis morning later infections - Google Patents

Abstract

The present invention relates to a kind of methods for distinguishing syphilis morning later infections, utilize molecular biology gene cloning and expression technology, obtain syphilis TP0136 recombinant protein, using the syphilis TP0136 recombinant protein of purifying as antigen, it establishes the ELISA method of detection TP0136 antibody and is assembled into kit, early later infections are distinguished based on syphilis person TP0136 antibody level, are conducive to instruct clinical rational drug use, over-treatment is avoided, provides a kind of detection method quickly, easy for the diagnosis and treatment of syphilis.Syphilis period is distinguished by detection TP0136 antibody level, compensates for the blank of syphilis staging diagnosis detection method；Have the characteristics that detect that flux is big, result is definite, high sensitivity, easy to operate, is easy to base's popularization.

Description

A method of for distinguishing syphilis morning later infections

Technical field

The present invention relates to syphilis antibody detection fields, and in particular to a method of for distinguishing syphilis morning later infections.

Background technique

Syphilis is to infect institute by microspironema pallidum globus pallidus subspecies (Treponema pallidum subsp.pallidum) A kind of sexually transmitted disease caused.Epidemic data shows that the whole world shares 25,000,000 people's syphilizations, annual syphilis new cases More than 11,000,000.In addition, evidence shows that the congenital propagation of syphilis is that developing country leads to the primary of fetus and perinatal infants dead rate Reason；And syphilis will increase human immunodeficiency virus and propagate and obtain, therefore syphilis is important global health problem.

It is divided into early syphilis (in 2 years) and late syphilis (2 years or more) according to the syphilitic time.According to facing for syphilis Bed performance can be divided into primary syphilis (ulcer or chancre of such as infection site), (including secondary syphilid, skin are viscous for mesosyphilis Film lesion, enlargement of lymph nodes etc.), tertiary syphilis (heart syphilis, gumme, tabetic crisis, general paresis etc.).But due to clinic Syphilis person more than 70% lacks clinical manifestation, referred to as latent infection.Latent syphilis within wherein infecting 2 years claims For early latent syphilis, infection 2 years or more referred to as advanced stage latent syphilis.Different stadium syphilis therapeutic schemes are different, but due to Latent syphilis lacks clinical manifestation, and patient does not often know stage property body infection time, therefore is correctly conducive to by stages to syphilis progress Help clinical guidance treatment and subsequent follow-up.

There are two types of common controller used in syphilis diagnosis detection methods: 1) non-syphilitic leptospira antibody test (including rapid plasma reaction Element test [RPR], tolulized red unheated serum test [TRUST], Venereal Disease Research Laboratory Test [VDRL])；2) syphilis spiral shell Rotation body antibody test (including microspironema pallidum particle agglutination test [TPPA], treponema pallidum hemagglutination test [TPHA], fluorescence are close Helicoid antibody adsorption test [FTA-ABS], syphilis enzyme linked immune assay, syphilis chemiluminescence immune assay, profeta immunity print Mark test, the detection of quick syphilis helicoid antibody etc.).However, the syphilis time cannot be distinguished in the above method, it can not Correctly being diagnosed to be patient is early stage or later infections, the clinical Clinics and Practices of influence.

Summary of the invention

The technical problem to be solved by the present invention is to overcome the existing defects, a kind of for distinguishing the side of syphilis morning later infections Method is included the following steps: using microspironema pallidum TP0136 antigen protein is contained

The passage and separation of Step.1 microspironema pallidum bacterial strain: Nichols plants of microspironema pallidum pass through inocalation method in testis, It breeds and extracts in New Zealand White Rabbit testis；

Step.2 is from extraction microspironema pallidum DNA in rabbit testis tissue: the conveyor screw extracted from infected rabbits testis is through low Speed centrifugation, uses microcentrifuge centrifugation microspironema pallidum.Again suspension microspironema pallidum is in 1X Cell lysis buffer In, suspension microspironema pallidum is frozen in -20 DEG C or mentions as needed using QIAamp DNA Mini kit (QIAGEN) again DNA is taken, DNA is extracted in by specification operation, and DNA is stored in -20 DEG C after extraction；.

The analysis of Step.3TP0136 sequence and design of primers: it is searched for from the protein of Genbank and DNA data library TP0136 amino acid and nucleic acid sequence, using 7.1 software of BioEdit to 5 syphilis Spirochaeta pallidas of Treponema (Nichols, DAl-1, Chicago, Mexico A and SS14), 3 refined department Spirochaeta pallidas (Samoa D, CDC2 and Gauthier) and 1 non-classified anthropoid treponema (Fribourg-Blanc) carries out Multiple sequence alignments；

Step.4 application primer-design software inquires Nichols type strain TP0136 gene order to GenBank and carries out Design of primers, with SignalP4.1Server software prediction TP0136 signal peptide, TP0136 open reading frame primer is without letter Number peptide；

Step.5 poison conveyor screw TP0136DNA amplification: Nichols plants of TP0136DNA of standard PCR amplification microspironema pallidum. Upstream primer (Fp) are as follows: ATGACGTGCGATTTCACTGG (SEQ ID No:2)；Downstream primer (Rp) are as follows: CTCGCGGTTCCAGGAGCACG(SEQ ID No:3).Pcr amplification reaction reagent is added in 95 DEG C of denaturation 10min；95 DEG C of denaturation 1min, 60 DEG C of denaturation 2min, 72 DEG C of denaturation 1min repeat the above denaturation totally 45 circulations；72 DEG C of extension 10min for the last time, Amplification PCR product is identified through 1.5% agarose gel electrophoresis；

The building of Step.6 recombinant expression plasmid: PCR product is cloned into pPEX 5-CT carrier (Invitrogen).Carrier It imports in TOP10 competent E.coli (Invitrogen): reaction tube is incubated at 22 DEG C 5 minutes；Then by reaction tube Be placed in and react on ice, and TOP10 competent E.coli is also placed on ice, TOP10 competent E.coli storage temperature be- 80℃；Water-bath is prepared to 42 DEG C；S.O.C. reagent is placed in room temperature rewarming；By the LB plate containing 100 μ g/mL ampicillins It is placed in 37 DEG C of incubators 30 minutes；Thaw competent cell on ice；2 μ l carrier reaction solutions are added to TOP10 competent E.coli, It mixes gently；It is incubated for 5 to 30 minutes on ice；It infects state cell 30 seconds, cannot shake in 42 DEG C of heat shocks；Immediately by reaction tube It is transferred to 3 minutes on ice；Add the S.O.C. reagent of 250 μ l room temperature rewarmings；Cap test tube is tightened, it is small that 37 DEG C of 200 turns of levels rock 1 When；100 μ l are taken, the LB plate containing 100 μ g/mL ampicillins, 37 DEG C of overnight incubations are uniformly applied to；High-efficient cloning reacts meeting Hundreds of bacterium colonies are generated, 10 bacterium colonies are selected, verify transformant with Standard PCR method；It takes the correct transformant of conversion to shake bacterium to stay overnight, The small extraction reagent kit of plasmid (Qiagen) extracts plasmid；

The expression and purifying of Step.7 recombinant protein: turn through the correct pPEX 5-CT-TP0136 expression vector of sequence verification Change to competent E.coli Rosetta cell (Merck KGaA, Germany), transformant is placed in LB+1% grape at first day On sugared agar plate, processing is placed in 37 DEG C of incubator overnight with antibiotic, antibiotic 100 μ g/mL containing ampicillin； The 2nd day morning, from fresh agar plate transfer bacterium colony in 2mL ZYP-0.8G or LB+1% glucose, in addition antibiotic, antibiosis Element 100 μ g/mL containing ampicillin, is placed in 18 × 150 millimeters of buckle capped pipe, it is small to be shaken bacterium 3-4 at 37 DEG C with 300RPM When, until culture becomes muddy, 400mL ZYMP-5052 culture medium and antibiotic is added in the flask of 52 liters of preparation, each flask, Antibiotic 100 μ g/mL containing ampicillin；In morning on day 2,200 μ l inoculum cultures of transfer are to containing 400mLZYP-5052 It in 2 liters of flasks of+antibiotic, is shaken at room temperature with 220RPM bacterium 72 hours, in the 5th day morning, by the burning containing the culture Bottle is placed in cooling in ice bucket and takes 1.0mL culture from each flask, and place it in and be marked after culture is cooling 1.5mL centrifuge tube in, with 500 μ l SDS-PAGE sample buffers again suspension culture, boil sample after ten minutes, use 13000 turns of desk centrifuge are centrifuged 5 minutes, limpid azure supernatant are loaded in new 1.5mL centrifuge tube, remaining precipitating Bacterium is centrifuged 2 minutes again, removes supernatant, and with the albumen of Diagnosis of Sghistosomiasis notation verifying label containing 6xHis: the albumen of expression passes through After SDS-PAGE is separated and is transferred to nitrocellulose membrane, being detected with anti-6xHis antibody (Sigma) confirms that TP0136 is insoluble Protein；Culture in flask is sub-packed in 0.3 liter of centrifugal bottle, it is thin to be centrifuged 10 minutes precipitatings by 6000 × g at 4 DEG C Bacterium, pours out supernatant, and precipitating is stored in -80 DEG C of low temperature；Every 1 heave starch is resuspended with 1 cold × combination buffer of 30mL, such as Fruit albumen is insoluble, addition 0.1%NP-40 to combination buffer；Processor for ultrasonic wave GEX130 (Cole-Parmer) is right Precipitating is resuspended and carries out ultrasonic treatment 5 minutes, avoids the formation of foam as far as possible, after ultrasonic treatment, 15 points are centrifuged at 13 000rpm Clock；Remove supernatant, every 1 heave is formed sediment to be resuspended with 30mL cold 1 × combination buffer (being free of NP-40), again ultrasonic treatment with It being centrifuged 15 minutes under 13 000rpm, removes supernatant, every 1 heave is formed sediment to be resuspended with 80mL 1X combination buffer+6M guanidine hydrochloride, It is incubated overnight on 4 DEG C of magnetic stirring apparatus；Ultracentrifuge (Thermo Scientific) 20 is freezed with Sorvall RC-5B 000rpm is centrifuged 30 minutes, recycles supernatant, and filter by one 45 microns of filter；By resin/buffering of 5mL50% Liquid is added in 15mL conical pipe, and 1 000rpm is centrifuged 5 minutes, removes supernatant, and 10mL distilled water is added, and shakes 10 points at room temperature Clock, 1 000rpm are centrifuged 5 minutes, remove distilled water；10mL distilled water is added again, shakes 10 minutes at room temperature, 1 000rpm Centrifugation 5 minutes removes distilled water, adds 10-12mL1X combination buffers (guanidine hydrochloride containing 6M), is incubated at room temperature 10 minutes, and 1 000rpm is centrifuged 5 minutes, removes combination buffer；Again plus 10-12mL1X combination buffers (guanidine hydrochloride containing 6M), at room temperature It is incubated for 10 minutes, 1 000rpm is centrifuged 5 minutes, and removal combination buffer transfers a resin into affine after the final washing Chromatographic column (Bio-Rad) simultaneously waits its sedimentation；Supernatant after filtering is added to the affine of agarose containing Ni-NTA (Qiagen) In chromatographic column (Bio-Rad), the Ni-NTA agarose (Qiagen) of 4 DEG C of preservations should be sufficiently mixed before use, be tied with 15mL 1X It closes buffer (guanidine hydrochloride containing 6M) and cleans resin；Resin is cleaned with 10mL washing buffer (guanidine hydrochloride containing 6M)；It collects under cleaning Washing buffer, loaded in 1.5mL centrifuge tube, every pipe collects the lower washing buffer of cleaning containing 1mL, for subsequent SDS- PAGE analysis；Protein is eluted with 10mL elution buffer (guanidine hydrochloride containing 6M), the elution buffer under cleaning is collected, is loaded on In 1.5mL centrifuge tube, every pipe collects the elution buffer under cleaning containing 1mL, analyzes for subsequent SDS-PAGE；It collects by several times Washing buffer and elution buffer through blue safe dyeing liquor (Life Technologies) dyeing point of SDS-PAGE and letter Analysis, to determine the eluent for being free of pollutant；Before carrying out SDS-PAGE detection, the washing buffer of the gradation collection of hydrochloric guanidine Liquid and elution buffer trichloroacetic acid (TCA)/acetone precipitation albumen；It is verified by SDS-PAGE and most pure is free of pollutant Eluent be placed at 4 DEG C dialysis cassette (Thermo Scientific) dialysis, dialyzate be contain the salt for being gradually reduced concentration 1 × PBS of sour guanidine (from 3M, 1.5M, 1M, 0.5M to 0M), by centrifuge separation by the soluble egg of refolding again after dialysis White to isolate from precipitating, recombinant protein is stored under -80 DEG C of low temperature；

The kit of Step.8 preparation detection TP0136 antibody；

Step.9 distinguishes syphilis morning later infections using kit

New Zealand White Rabbit in the Step.1 is inhaled through Venereal Disease Research Laboratory (VDRL) and fluorescence syphilis helicoid antibody Attached (FTA-ABS) detection is to exclude T.paraluiscuniculi infection.Only choose the white rabbit that VDRL and FTA-ABS is negative.

It include 10mM Tris, 0.1M EDTA, 0.5%SDS in 1X Cell lysis buffer in the Step.2.It is described Pcr amplification reaction reagent in Step.4 is 50uL, includes: 5 μ L DNA sample to be detected, 200 μM of dNTPs, 5 10 × Go of μ L Taq PCR buffer (Promega), 1.5mM MgCl2,0.6 μM of TP0751 primer, 0.5U thermal starting Taq PCR polymerase (Promega)。

A kind of kit detecting TP0136 antibody, it is characterised in that: including antibody test lath, positive and negative compare blood (each 1.5mL) clearly, serum dilution 60mL, ELIAS secondary antibody 30mL, cleaning solution 75mL, substrate developing solution 15mL, terminate liquid 15mL； Each kit includes 2 pieces of elisa plates, and for every block of plate containing the elisa plate item for being removably coated with detection antigen, specification is 8 holes × 12；The negative control sera is no syphilitic Healthy Human Serum, and positive serum is early infection syphilitic The human serum of person's acquisition；The serum dilution includes: 1%BSA, adds 800mL PBST molten by 10g bovine serum albumin(BSA) BSA Solution adds aqua sterilisa to be configured to 1000mL；The ELIAS secondary antibody is by the goat anti-human igg of horseradish peroxidase-labeled with containing The PBST of 1%BSA dilutes 5000 times, as the ELIAS secondary antibody for directly using concentration；The cleaning solution is containing for 10 times of concentrations The 1M PBS (pH7.4) of 0.5% Tween-20；The substrate developing solution: being purchased from LOFE company, and developing solution A, B are mixed in equal volume, As substrate developing solution；The termination liquid is 2M H2SO4.

The carbonate buffer solution of the elisa plate item 0.05M, PH concentration are 9.6, are diluted obtained in claim 1 The TP0136 recombinant protein of purifying determines that peridium concentration is 0.236 μM/L with square matrix method, takes removable 96 hole elisa Plates, every hole adds Enter l00 μ l, 4 DEG C of coatings are washed 2 times after 24 hours with the PBS cleaning solution containing 0.05% Tween-20 (volume ratio), with quality volume Than being closed 1 hour for 37 DEG C of skimmed milk power of 5%, is sufficiently washed, be air-dried at room temperature with PBST.

A kind of application method for the kit detecting TP0136 antibody comprising the steps of:

Step.1 takes l00 μ l to add to antibody test plate, sun for after 100 times of serum dilution dilutions of blood serum sample to be checked Property and negative control sera do not have to dilution, directly plus l00 μ l, and repeat two holes, discard liquid in hole after setting 37 DEG C of incubations 30 minutes Body, every hole are washed 4 times with 250 μ l cleaning solutions；

The ELIAS secondary antibody of l00 μ l is added in the every hole Step.2, discards liquid in hole after ELISA Plate is placed in 37 DEG C of incubations 30 minutes Body, every hole are washed 4 times with 250 μ l cleaning solutions；

Substrate developing solution is added in Step.3, and every 50 μ l of hole, 37 DEG C are protected from light colour developing 15 minutes；

Terminate liquid, every 50 μ l of hole, color development stopping is added in Step.4；

Step.5 microplate reader reads OD value under 450nm wavelength.

Compared with prior art, the beneficial effects of the present invention are: the present invention utilizes molecular biology gene cloning and expression skill Art obtains syphilis TP0136 recombinant protein, and using the syphilis TP0136 recombinant protein of purifying as antigen, it is anti-to establish detection TP0136 The ELISA method of body is simultaneously assembled into kit, distinguishes early later infections based on syphilis person TP0136 antibody level, favorably In instructing clinical rational drug use, over-treatment is avoided, provides a kind of detection method quickly, easy for the diagnosis and treatment of syphilis.This hair Bright method distinguishes syphilis period by detection TP0136 antibody level, compensates for the sky of syphilis staging diagnosis detection method It is white；Have the characteristics that detect that flux is big, result is definite, high sensitivity, easy to operate, is easy to base's popularization.

Detailed description of the invention

Fig. 1 is the PCR products electrophoresis map of syphilis TP0136 gene.

Fig. 2 is the expression electrophoretogram of syphilis recombination TP0136 albumen.

Fig. 3 is the electrophoretogram of syphilis recombination TP0136 albumen.

Fig. 4 is clinical serum sample detection result.

Fig. 5 is the ROC curve for distinguishing syphilis morning later infections.

Specific embodiment

Following will be combined with the drawings in the embodiments of the present invention, and technical solution in the embodiment of the present invention carries out clear, complete Site preparation description, it is clear that described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.It is based on Embodiment in the present invention, it is obtained by those of ordinary skill in the art without making creative efforts every other Embodiment shall fall within the protection scope of the present invention.

The preparation of 1 microspironema pallidum TP0136 albumen of embodiment

The passage and separation of microspironema pallidum bacterial strain: Nichols plants of microspironema pallidum pass through inocalation method in testis, in Xin Xi It breeds and extracts in blue white rabbit testis.Before carrying out infection experiment, all New Zealand White Rabbit are through Venereal Disease Research Laboratory The absorption of (Venereal Disease Research Laboratory, VDRL) and fluorescence syphilis helicoid antibody (fluorescent treponemal antibody-absorbed, FTA-ABS) is detected to exclude T.paraluiscuniculi infection.Only VDRL and FTA-ABS negative animal is used for the experiment.

From extracting microspironema pallidum DNA in rabbit testis tissue: the conveyor screw extracted from infected rabbits testis through low-speed centrifugal, It is separated from rabbit fragment of tissue from conveyor screw, then uses microcentrifuge centrifugation microspironema pallidum.Again it hangs Floating microspironema pallidum (Tris containing 10mM, 0.1M EDTA, 0.5%SDS) in 1X Cell lysis buffer.Again suspend syphilis Conveyor screw is frozen in -20 DEG C or extracts DNA, by specification using QIAamp DNA Mini kit (QIAGEN) as needed DNA is extracted in operation.DNA is stored in -20 DEG C after extraction.

The analysis of TP0136 sequence and design of primers: TP0136 amino is searched for from the protein of Genbank and DNA data library Acid and nucleic acid sequence (http://www.ncbi.nlm.nih.gov/genome/? term=Treponema% 20pallidum), right using 7.1 software (http://bioedit.software.informer.com/7.1/) of BioEdit 5 syphilis Spirochaeta pallidas (Nichols, DAl-1, Chicago, Mexico A and SS14) of Treponema, 3 refined departments Spirochaeta pallida (Samoa D, CDC2 and Gauthier) and 1 non-classified anthropoid treponema (Fribourg- Blanc Multiple sequence alignments) are carried out.Using primer-design software: the Primer3:WWW primer tool (http: // Biotools.umassmed.edu/bioapps/primer3_www.cgi Nichols type strain) is inquired to GenBank TP0136 gene order carries out design of primers.With SignalP4.1Server software (http://www.cbs.dtu.dk/ Services/SignalP/) predict that TP0136 signal peptide, TP0136 open reading frame primer are free of signal peptide.

Microspironema pallidum TP0136DNA amplification: Nichols plants of TP0136DNA of standard PCR amplification microspironema pallidum.Upstream Primer (Fp) are as follows: ATGACGTGCGATTTCACTGG (SEQ ID No:2)；Downstream primer (Rp) are as follows: CTCGCGGTTCCAGGAGCACG(SEQ ID No:3).50uL pcr amplification reaction reagent contains: 5 μ L DNA sample to be detected, 200 μM dNTPs, 5 μ L 10 × Go Taq PCR buffers (Promega), 1.5mM MgCl2,0.6 μM of TP0751 primer, 0.5U Thermal starting Taq PCR polymerase (Promega).Amplification condition: 95 DEG C of denaturation 10min；95℃1min,60℃2min,72℃ 1min, totally 45 recycle；Last 72 DEG C of extensions 10min.Amplification PCR product is identified through 1.5% agarose gel electrophoresis.As a result see Fig. 1, amplified fragments size are consistent with expected purpose clip size, and wherein S is syphilis TP0136 gene amplification product；M is DNA points Sub- amount standard.

The building of recombinant expression plasmid: PCR product is cloned into pPEX 5-CT carrier (Invitrogen).Vector introduction In TOP10 competent E.coli (Invitrogen): reaction tube 1) being incubated for 5 minutes (22-23 DEG C) at room temperature；2) then Reaction tube is placed in and is reacted on ice, and TOP10 competent E.coli (being stored in -80 DEG C) is also placed on ice；3) water is prepared Bath is to 42 DEG C；4) S.O.C. reagent is placed in room temperature rewarming；5) the LB plate containing 100 μ g/mL ampicillins is placed in 37 DEG C incubator 30 minutes；6) thaw competent cell on ice；7) 2 μ l carrier reaction solutions of addition are to TOP10 competent E.coli, gently It is light to mix.It not mix up and down；8) it is incubated for 5 to 30 minutes on ice.The incubation of longer time seems to transformation efficiency on ice Influence it is little；9) it infects state cell 30 seconds, cannot shake in 42 DEG C of heat shocks；10) reaction tube is transferred to 3 points on ice immediately Clock；11) the S.O.C. reagent of 250 μ l room temperature rewarmings is added；12) cap test tube is tightened, 37 DEG C of 200 turns of levels are rocked 1 hour；13. 100 μ l are taken, the LB plate containing 100 μ g/mL ampicillins, 37 DEG C of overnight incubations are uniformly applied to；14) high-efficient cloning is answered This can generate hundreds of bacterium colonies.10 bacterium colonies are selected, verify transformant with Standard PCR method.The correct transformant of conversion is taken to shake bacterium Overnight, the small extraction reagent kit of plasmid (Qiagen) extracts plasmid.Shanghai Sangon Biotech Company is sent to carry out the plasmid for being accredited as positive colony Sequencing.Sequencing result shows that TP0136 genetic fragment is correctly connected with pPEX 5-CT carrier, is expressing the reading frame of albumen just Really, illustrate that recombinant prokaryotic expression vector plasmid pPEX 5-CT-TP0136 is constructed successfully.

The expression and purifying of recombinant protein: sense is transformed into through the correct pPEX 5-CT-TP0136 expression vector of sequence verification By state Escherichia coli Rosetta cell (Merck KGaA, Germany).Transformant is placed in LB+1% agar glucose at first day On plate, handle with antibiotic appropriate (the 100 μ g/mL containing ampicillin).It is placed in 37 DEG C of incubator overnight.2nd day Shift several bacterium colonies in 2mL ZYP-0.8G (or LB+1% glucose), in addition antibiosis appropriate from fresh agar plate in the morning Plain (the 100 μ g/mL containing ampicillin), is placed in 18 × 150 millimeters of buckle capped pipe.Bacterium 3-4 is shaken at 37 DEG C with 300RPM Hour (is no more than 8 hours), until culture becomes muddy.Prepare 52 liters of flask, 400mL ZYMP-5052 is added in each flask Culture medium and antibiotic appropriate (the 100 μ g/mL containing ampicillin).Morning on day 2,200 μ l inoculum cultures of transfer are arrived In 2 liters of flasks containing 400mLZYP-5052+ antibiotic.It is shaken at room temperature with 220RPM bacterium 72 hours.It, will in the 5th day morning Flask containing the culture is placed in ice bucket cooling.After culture is cooling, 1.0mL culture is taken from each flask, and It places it in the 1.5mL centrifuge tube being marked.With 500 μ l SDS-PAGE sample buffers again suspension culture.It boils Sample after ten minutes, is centrifuged 5 minutes with 13000 turns of desk centrifuge.Limpid azure supernatant is centrifuged loaded on new 1.5mL Guan Zhong.Remaining precipitating bacterium is centrifuged 2 minutes again, removes supernatant.The albumen of the label containing 6xHis is verified with Diagnosis of Sghistosomiasis notation: After the albumen of expression separates by SDS-PAGE and is transferred to nitrocellulose membrane, being detected with anti-6xHis antibody (Sigma) is confirmed TP0136 is insoluble protein, and as shown in Figures 2 and 3, wherein M is Protein Marker, and 1 is the recombination table not induced It reaches, 2 be the recombinant expression of induction, and H1 is negative control, and H2 is the recombination TP0136 albumen of purifying.By the culture in flask point Loaded in 0.3 liter of centrifugal bottle, 6000 × g is centrifuged 10 minutes precipitating bacteriums at 4 DEG C.Supernatant is poured out, precipitating is stored in -80 ℃.Every 1 heave starch is resuspended with 1 cold × combination buffer of 30mL.If albumen is insoluble, addition 0.1%NP- 40 arrive combination buffer.Processor for ultrasonic wave GEX130 (Cole-Parmer) be ultrasonically treated 5 minutes to precipitating is resuspended, to the greatest extent Amount avoids the formation of foam.After ultrasonic treatment, it is centrifuged 15 minutes at 13 000rpm.Supernatant is removed, cold 1 30mL is used in every 1 heave shallow lake × combination buffer (being free of NP-40) is resuspended.It is centrifuged 15 minutes under ultrasonic treatment and 13 000rpm again.Supernatant is removed, often 1 heave is formed sediment to be resuspended with 80mL 1X combination buffer+6M guanidine hydrochloride.It is incubated overnight on 4 DEG C of magnetic stirring apparatus.With Sorvall RC-5B freezes Ultracentrifuge (Thermo Scientific) 20 000rpm and is centrifuged 30 minutes, recycles supernatant Liquid, and filtered by one 45 microns of filter.The Ni-NTA agarose (Qiagen) of 4 DEG C of preservations should be mixed sufficiently before use It closes.By resin/buffer of 5mL50%, (1mL resin can capture up to 8 milligrams of protein, such as the resin of 2.5mL can be with The culture of 1 liter of capture) it is added in 15mL conical pipe.1 000rpm is centrifuged 5 minutes.Supernatant is removed, 10mL distilled water is added. It shakes 10 minutes at room temperature.1 000rpm is centrifuged 5 minutes.Remove distilled water.10mL distilled water is added again.10 are shaken at room temperature Minute.1 000rpm is centrifuged 5 minutes.Remove distilled water.Add 10-12mL1X combination buffers (guanidine hydrochloride containing 6M).At room temperature It is incubated for 10 minutes.1 000rpm is centrifuged 5 minutes.Remove combination buffer.Again plus 10-12mL1X combination buffer (salt containing 6M Sour guanidine).It is incubated at room temperature 10 minutes.1 000rpm is centrifuged 5 minutes.Remove combination buffer.After the final washing, will Resin is transferred to affinity column (Bio-Rad) and it is waited to settle (this will need more 1 hour).After sedimentation, the volume of resin It should be initial half.Supernatant after filtering is added to the affinity column (Bio- of agarose containing Ni-NTA (Qiagen) Rad in).Resin is cleaned with 15mL 1X combination buffer (guanidine hydrochloride containing 6M).It is clear with 10mL washing buffer (guanidine hydrochloride containing 6M) Wash resin.The washing buffer under cleaning is collected, loaded in 1.5mL centrifuge tube, every pipe collects the washing buffer under cleaning containing 1mL Liquid is analyzed for subsequent SDS-PAGE.Protein is eluted with 10mL elution buffer (guanidine hydrochloride containing 6M), is collected under cleaning Elution buffer, loaded in 1.5mL centrifuge tube, every pipe collects the elution buffer under cleaning containing 1mL, is used for subsequent SDS- PAGE analysis.The washing buffer and elution buffer collected by several times are through SDS-PAGE and the blue safe dyeing liquor (Life of letter Technologies) staining analysis, to determine the eluent for being free of pollutant.Before carrying out SDS-PAGE detection, hydrochloric guanidine Gradation collect washing buffer and elution buffer trichloroacetic acid (TCA)/acetone precipitation albumen.It is tested by SDS-PAGE It demonstrate,proves the most pure eluent without pollutant and is placed in dialysis cassette (Thermo Scientific) dialysis at 4 DEG C.Dialyzate is 1 × PBS containing the guanidine hydrochloride (from 3M, 1.5M, 1M, 0.5M to 0M) for being gradually reduced concentration.After being dialysed by centrifuge separation The soluble protein of refolding is isolated from precipitating again.Recombinant protein is stored in -80 DEG C.

Embodiment 2 detects the preparation of the method for TP0136 antibody

1) antibody test lath: each kit includes 2 pieces of elisa plates, and every block of plate is anti-containing detection has removably been coated with Former elisa plate item, specification are 8 hole × 12.

The preparation of elisa plate item (antigen plate): obtained in 0.05M carbonate buffer solution (pH9.6) dilution embodiment 1 The TP0136 recombinant protein of purifying determines that best peridium concentration is 0.236 μM/L with square matrix method, takes removable 96 hole elisa Plates, often L00 μ l is added in hole, and 4 DEG C of coatings are after 24 hours with PBS (pH7.4) cleaning solution (PBST) containing 0.05% Tween-20 (volume ratio) Washing 2 times is closed 1 hour with 37 DEG C of 5% skimmed milk power (mass volume ratio), is sufficiently washed, be air-dried at room temperature with PBST.

2) positive and negative control serum (each 1.5mL): negative control sera is no syphilitic Healthy Human Serum, sun Property serum be early infection syphilitic person acquisition human serum.

3) serum dilution (60mL): 1%BSA, add 800mL PBST to dissolve by 10g bovine serum albumin(BSA) BSA, adds sterilizing Water is configured to 1000mL.

4) ELIAS secondary antibody (30mL): the goat anti-human igg of horseradish peroxidase-labeled is diluted with the PBST containing 1%BSA 5000 times, as the ELIAS secondary antibody for directly using concentration.

5) the 1M PBS (pH7.4) containing 0.5% Tween-20 of cleaning solution (75mL): 10 times of concentrations.

6) substrate developing solution (15mL): it is purchased from LOFE company.Developing solution A, B are mixed in equal volume, as substrate developing solution.7) Terminate liquid (15mL): 2M H2SO4.

Embodiment 3 is used to distinguish the use of the ELISA detection kit of syphilis morning later infections

After 100 times of serum dilution dilutions of blood serum sample to be checked, l00 μ l is taken to add to antibody test plate, positive and yin Property control serum do not have to dilution, directly plus l00 μ l, and repeat two holes, discard liquid in hole, every hole after setting 37 DEG C of incubations 30 minutes It is washed 4 times with 250 μ l cleaning solutions.

The ELIAS secondary antibody of l00 μ l is added in every hole, discards liquid in hole, every hole after ELISA Plate is placed in 37 DEG C of incubations 30 minutes It is washed 4 times with 250 μ l cleaning solutions.

Substrate developing solution is added, every 50 μ l of hole, 37 DEG C are protected from light colour developing 15 minutes.

Terminate liquid, every 50 μ l of hole, color development stopping is added.

OD value is read under 450nm wavelength with microplate reader.

Embodiment 4 detects clinical syphilis sample using this kit

Using TP0136 antibody assay kit of the invention to 120 early syphilis from Guangdong Province's Hospital of Skin Diseases 240 parts of clinical serum samples of patient and 120 late syphilis patients detect, and as a result see Fig. 4.The testing result, which is shown, faces Bed early syphilis patients serum's TP0136 antibody OD value is apparently higher than late syphilis patient, difference it is statistically significant (P < 0.001)。

Fig. 5 is the ROC curve for distinguishing syphilis morning later infections, and abscissa is -1 specificity, and ordinate is sensitivity, AUC=0.799, wherein ROC indicates area under the curve.With 0.731 for cut-off value, detection sensitivity 0.74%, specificity It is 0.79%.

As it can be seen that can fast and accurately diagnose different stadium syphilis senses for distinguishing syphilis morning later infections using the present invention Dye, sensibility and specificity with higher.

It although an embodiment of the present invention has been shown and described, for the ordinary skill in the art, can be with A variety of variations, modification, replacement can be carried out to these embodiments without departing from the principles and spirit of the present invention by understanding And modification, the scope of the present invention is defined by the appended.

Sequence table

<110>Ke Wujian

<120>a kind of method for distinguishing syphilis morning later infections

<130> 1

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1470

<212> DNA

<213>microspironema pallidum Treponema Pallidum ()

<400> 1

atggatacgc agtatatgag gcgccgggtg tgcacggtgg tgcgcgcggt ggtgtgtcta 60

ctcagcacga gtttgctgac cacgtgcgat ttcactggca tctttgcggc aattcagtcg 120

gaagtgccca ttaaaacgcc gtccatcccg ggggcgattt atggcctggt caaggccggg 180

agcaagctct acgccaccaa cggccggctt tgggaaaagg agctgaacgg cactgggtcg 240

tggcagaaag tgtcttcctc gtccgttccc actgactcgg ataaaaaggt tatgagcatt 300

gccaccgacg ggaacacgtt cgtcctcgcc tgcgtgcctg gcacgggcgt ttacaaacac 360

tgcgtaaatg gcgcgggcag ctcaagcacc ggcacaacgg caagcccctc gactgaaacc 420

tgctcgcagc atgcgacgct cgtgggggga acgtccaagc ccttctggct cgtgccggga 480

ggcacgggga ataatgggaa ctgcggttgc gggggagggg ggggtggctc ctcctcgagt 540

agcagctcgt gcattcacat ctggctcgtg ccgggaggca cggggaataa tgggaactgc 600

ggttgcgggg gagggggggg tggctcctcc tcgagtagca gctcgtgcat tcacattaag 660

gtagaaaaca cggacgaaca gtttctcgat atgggtgagg ggtacgtggt gaccaccaag 720

cacctctaca ccaaaaacgg ctcgtccagc gcgggaccgg cgcagtgtcc cggtggcggt 780

ggcggcggag gcagcagcgg gggtgggggt tcctcggagt acaccaaagc ttcctgttcc 840

ttttccacgc ccattctggc aagcgtcagc gacgggtgct atcactacat tctcaccaaa 900

gaaaaagtgt actgcagaaa gcaggacacc gcttcctccg ctgcgtcgtc accagcccag 960

tgtccctctt ccccttcttc ttcttcctcc tcctcgacga atgcgggatg cgaggtggcg 1020

cacggggtgg acgacccgct gtgtcttgcg atttttaaac acaacggctg cgaatacttg 1080

ctcatcggcg gcagtcgggg ctacggggaa ataaagctgg aagcgaactc cagcggtacg 1140

aacggcacct gcatgcgatt gaaagagagc aatgtgcaca agagtccggg ccagtggggc 1200

gagtcgagcc ccacgcccaa agcgagcgcc gagcagtatc ggggcacggt cggtcggttt 1260

gccgtgcaga aaatctacgt agttgaaaaa aatggcggtg ggaacggtgt cgccgcgggt 1320

ggggcgggct gtcctgcaaa cgccagcagt tccagcggag ggaccagcag cacgcagcgt 1380

ccagacctct acgccgcagt gggggagtcg agcgacacct acacggggct gtggaagttt 1440

gacaccacca cgtgctcctg gaaccgcgag 1470

Claims (7)

1. a kind of method for distinguishing syphilis morning later infections, using containing microspironema pallidum TP0136 antigen protein, including Following steps:

The passage and separation of Step.1 microspironema pallidum bacterial strain: Nichols plants of microspironema pallidum pass through inocalation method in testis, new It breeds and extracts in western orchid white rabbit testis；

Step.2 from rabbit testis tissue extract microspironema pallidum DNA: the conveyor screw extracted from infected rabbits testis through low speed from The heart uses microcentrifuge centrifugation microspironema pallidum.Again suspension microspironema pallidum is in 1X Cell lysis buffer, weight New suspension microspironema pallidum is frozen in -20 DEG C or extracts as needed using QIAamp DNA Mini kit (QIAGEN) DNA is extracted in DNA, by specification operation, and DNA is stored in -20 DEG C after extraction；.

The analysis of Step.3TP0136 sequence and design of primers: TP0136 ammonia is searched for from the protein of Genbank and DNA data library Base acid and nucleic acid sequence, using 7.1 software of BioEdit to 5 syphilis Spirochaeta pallidas of Treponema (Nichols, DAl-1, Chicago, Mexico A and SS14), 3 refined department Spirochaeta pallidas (Samoa D, CDC2 and Gauthier) and 1 A non-classified anthropoid treponema (Fribourg-Blanc) carries out Multiple sequence alignments；

Step.4 application primer-design software inquires Nichols type strain TP0136 gene order to GenBank and carries out primer Design, with SignalP4.1Server software prediction TP0136 signal peptide, TP0136 open reading frame primer is free of signal peptide；

Step.4 microspironema pallidum TP0136DNA amplification: Nichols plants of TP0136DNA of standard PCR amplification microspironema pallidum.On It swims primer (Fp) are as follows: ATGACGTGCGATTTCACTGG (SEQ ID No:2)；Downstream primer (Rp) are as follows: CTCGCGGTTCCAGGAGCACG(SEQ ID No:3).Pcr amplification reaction reagent is added in 95 DEG C of denaturation 10min；95 DEG C of denaturation 1min, 60 DEG C of denaturation 2min, 72 DEG C of denaturation 1min repeat the above denaturation totally 45 circulations；72 DEG C of extension 10min for the last time, Amplification PCR product is identified through 1.5% agarose gel electrophoresis；

The building of Step.5 recombinant expression plasmid: PCR product is cloned into pPEX 5-CT carrier (Invitrogen).

In vector introduction TOP10 competent E.coli (Invitrogen): reaction tube is incubated at 22 DEG C 5 minutes；Then Reaction tube is placed in and is reacted on ice, and TOP10 competent E.coli is also placed on ice, the storage of TOP10 competent E.coli Depositing temperature is -80 DEG C；Water-bath is prepared to 42 DEG C；S.O.C. reagent is placed in room temperature rewarming；It will be green containing 100 μ g/mL ammonia benzyls The LB plate of mycin is placed in 37 DEG C of incubators 30 minutes；Thaw competent cell on ice；2 μ l carrier reaction solutions are added to experience to TOP10 State Escherichia coli, mix gently；It is incubated for 5 to 30 minutes on ice；It infects state cell 30 seconds, cannot shake in 42 DEG C of heat shocks； Reaction tube is transferred to 3 minutes on ice immediately；Add the S.O.C. reagent of 250 μ l room temperature rewarmings；Tighten cap test tube, 37 DEG C 200 Turn level to rock 1 hour；100 μ l are taken, the LB plate containing 100 μ g/mL ampicillins, 37 DEG C of overnight incubations are uniformly applied to； High-efficient cloning reaction can generate hundreds of bacterium colonies, select 10 bacterium colonies, verify transformant with Standard PCR method；Take conversion correct Transformant shakes bacterium and stays overnight, and the small extraction reagent kit of plasmid (Qiagen) extracts plasmid；

The expression and purifying of Step.6 recombinant protein: it is transformed into through the correct pPEX 5-CT-TP0136 expression vector of sequence verification Competent E.coli Rosetta cell (Merck KGaA, Germany), was placed in LB+1% glucose fine jade for transformant at first day On rouge plate, processing is placed in 37 DEG C of incubator overnight with antibiotic, antibiotic 100 μ g/mL containing ampicillin；2nd day In the morning, from fresh agar plate transfer bacterium colony in 2mL ZYP-0.8G or LB+1% glucose, in addition antibiotic, antibiotic contains ammonia 100 μ g/mL of parasiticin, is placed in 18 × 150 millimeters of buckle capped pipe, is shaken at 37 DEG C with 300RPM bacterium 3-4 hours, until Culture becomes muddy, prepares 52 liters of flask, and 400mL ZYMP-5052 culture medium and antibiotic, antibiotic is added in each flask Containing 100 μ g/mL of ampicillin；Morning on day 2, transfer 200 μ l inoculum cultures to contain 400mLZYP-5052+ antibiosis In 2 liters of flasks of element, is shaken with 220RPM bacterium 72 hours, in the 5th day morning, the flask containing the culture is placed at room temperature It is cooling in ice bucket, after culture is cooling, 1.0mL culture is taken from each flask, and place it in the 1.5mL being marked In centrifuge tube, with 500 μ l SDS-PAGE sample buffers again suspension culture, sample is boiled after ten minutes, with desk-top centrifugation 13000 turns of machine are centrifuged 5 minutes, and by limpid azure supernatant loaded in new 1.5mL centrifuge tube, remaining precipitating bacterium is again Centrifugation 2 minutes, removes supernatant, and with the albumen of Diagnosis of Sghistosomiasis notation verifying label containing 6xHis: the albumen of expression passes through SDS-PAGE points From and after being transferred to nitrocellulose membrane, being detected with anti-6xHis antibody (Sigma) confirms that TP0136 is insoluble protein；It will Culture in flask is sub-packed in 0.3 liter of centrifugal bottle, and 6000 × g is centrifuged 10 minutes precipitating bacteriums at 4 DEG C, pours out supernatant Liquid, precipitating are stored in -80 DEG C of low temperature；Every 1 heave starch is resuspended with the cold 1X combination buffer of 30mL, if albumen is can not Molten, 0.1%NP-40 is added to combination buffer；Processor for ultrasonic wave GEX130 (Cole-Parmer) is carried out to precipitating is resuspended Ultrasonic treatment 5 minutes, avoids the formation of foam as far as possible, after ultrasonic treatment, is centrifuged 15 minutes at 13000rpm；Remove supernatant, every 1 liter Precipitating is resuspended with 30mL cold 1 × combination buffer (being free of NP-40), is centrifuged under ultrasonic treatment and 13 000rpm again 15 minutes, supernatant is removed, every 1 heave is formed sediment to be resuspended with 80mL 1X combination buffer+6M guanidine hydrochloride, on 4 DEG C of magnetic stirring apparatus It is incubated overnight；30 points are centrifuged with Sorvall RC-5B freezing Ultracentrifuge (Thermo Scientific) 20 000rpm Clock recycles supernatant, and is filtered by one 45 microns of filter；Resin/buffer of 5mL50% is added to 15mL taper Guan Zhong, 1 000rpm be centrifuged 5 minutes, remove supernatant, be added 10mL distilled water, at room temperature shake 10 minutes, 1 000rpm from The heart 5 minutes, remove distilled water；10mL distilled water is added again, shakes 10 minutes at room temperature, 1 000rpm is centrifuged 5 minutes, removal Distilled water adds 10-12mL1X combination buffers (guanidine hydrochloride containing 6M), is incubated at room temperature 10 minutes, and 1 000rpm is centrifuged 5 points Clock removes combination buffer；Again plus 10-12mL1X combination buffer (guanidine hydrochloride containing 6M), it is incubated at room temperature 10 minutes, 1 000rpm is centrifuged 5 minutes, and removal combination buffer transfers a resin into affinity column (Bio- after the final washing Rad) and its sedimentation is waited；Supernatant after filtering is added to the affinity column (Bio- of agarose containing Ni-NTA (Qiagen) Rad in), the Ni-NTA agarose (Qiagen) of 4 DEG C of preservations should be sufficiently mixed before use, (be contained with 15mL 1X combination buffer 6M guanidine hydrochloride) cleaning resin；Resin is cleaned with 10mL washing buffer (guanidine hydrochloride containing 6M)；Collect the washing buffer under cleaning Liquid, loaded in 1.5mL centrifuge tube, every pipe collects the washing buffer under cleaning containing 1mL, analyzes for subsequent SDS-PAGE； Protein is eluted with 10mL elution buffer (guanidine hydrochloride containing 6M), collects the elution buffer under cleaning, is loaded on 1.5mL centrifuge tube In, every pipe collects the elution buffer under cleaning containing 1mL, analyzes for subsequent SDS-PAGE；The washing buffer collected by several times Liquid and elution buffer are through SDS-PAGE and blue safe dyeing liquor (Life Technologies) staining analysis of letter, to determine not Eluent containing pollutant；Before carrying out SDS-PAGE detection, the washing buffer and elution that the gradation of hydrochloric guanidine is collected are slow Fliud flushing trichloroacetic acid (TCA)/acetone precipitation albumen；The most pure eluent without pollutant is verified by SDS-PAGE to exist Be placed at 4 DEG C dialysis cassette (Thermo Scientific) dialysis, dialyzate be containing be gradually reduced concentration guanidine hydrochloride (from 3M, 1.5M, 1M, 0.5M to 0M) 1 × PBS, by centrifuge separation by after dialysis again the soluble protein of refolding from precipitating It isolates, recombinant protein is stored under -80 DEG C of low temperature；

Step.7 prepares the kit that can be used for detecting TP0136 antibody；

Step.8 distinguishes syphilis morning later infections using kit.

2. according to a kind of method for distinguishing syphilis morning later infections described in claim 1, it is characterised in that: described New Zealand White Rabbit in Step.1 is through Venereal Disease Research Laboratory (VDRL) and fluorescence syphilis helicoid antibody absorption (FTA-ABS) inspection It surveys to exclude T.paraluiscuniculi infection.Only choose the white rabbit that VDRL and FTA-ABS is negative.

3. according to a kind of method for distinguishing syphilis morning later infections described in claim 1, it is characterised in that: described It include 10mM Tris, 0.1M EDTA, 0.5%SDS in 1X Cell lysis buffer in Step.2.

4. according to a kind of method for distinguishing syphilis morning later infections described in claim 1, it is characterised in that: described Pcr amplification reaction reagent in Step.4 is 50uL, includes: 5 μ L DNA sample to be detected, 200 μM of dNTPs, 5 10 × Go of μ L Taq PCR buffer (Promega), 1.5mM MgCl2,0.6 μM of TP0751 primer, 0.5U thermal starting Taq PCR polymerase (Promega)。

5. a kind of kit for detecting TP0136 antibody, it is characterised in that: including elisa plate, positive and negative control serum is each 1.5mL, serum dilution 60mL, ELIAS secondary antibody 30mL, cleaning solution 75mL, substrate developing solution 15mL, terminate liquid 15mL；Each examination Agent box includes 2 pieces of elisa plates, and for every block of plate containing the elisa plate item for being removably coated with detection antigen, specification is 8 hole × 12； The negative control sera is no syphilitic Healthy Human Serum, and positive serum is early infection syphilitic person acquisition Human serum；The serum dilution includes: 1%BSA, adds 800mL PBST to dissolve by 10g bovine serum albumin(BSA) BSA, adds sterilizing Water is configured to 1000mL；The ELIAS secondary antibody is by the goat anti-human igg of horseradish peroxidase-labeled with containing 1%BSA's PBST dilutes 5000 times, as the ELIAS secondary antibody for directly using concentration；The cleaning solution is 10 times of concentrations containing 0.5% tween- 20 1M PBS, pH concentration is 7.4；The substrate developing solution: being purchased from LOFE company, and developing solution A, B are mixed in equal volume, as bottom Object developing solution；The termination liquid is 2M H2SO4.

6. a kind of kit for detecting TP0136 antibody according to claim 5, it is characterised in that: the elisa plate item With the carbonate buffer solution of 0.05M, PH concentration is 9.6, dilutes the TP0136 recombinant protein of purifying obtained in claim 1, It determines that peridium concentration is 0.236 μM/L with square matrix method, takes removable 96 hole elisa Plates, l00 μ l is added in every hole, and 4 DEG C are coated with 24 hours It is washed 2 times with the PBS cleaning solution containing 0.05% Tween-20 (volume ratio) afterwards, with 37 DEG C of skimmed milk power that mass volume ratio is 5% Closing 1 hour, is sufficiently washed with PBST, is air-dried at room temperature.

7. a kind of application method for the kit for detecting TP0136 antibody comprising the steps of:

Step.1 will take l00 μ l to add to antibody test plate after 100 times of serum dilution dilutions of blood serum sample to be checked, it is positive and Negative control sera does not have to dilution, directly adds l00 μ l, and repeat two holes, discards liquid in hole after setting 37 DEG C of incubations 30 minutes, often It is washed 4 times with 250 μ l cleaning solutions in hole；

The ELIAS secondary antibody of l00 μ l is added in the every hole Step.2, discards liquid in hole after ELISA Plate is placed in 37 DEG C of incubations 30 minutes, often It is washed 4 times with 250 μ l cleaning solutions in hole；

Substrate developing solution is added in Step.3, and every 50 μ l of hole, 37 DEG C are protected from light colour developing 15 minutes；

Terminate liquid, every 50 μ l of hole, color development stopping is added in Step.4；

Step.5 microplate reader reads OD value under 450nm wavelength.