CN109321596B - Preparation method and application of protein-entrapped exosome - Google Patents

Abstract

The invention provides a preparation method and application of an exosome entrapping protein. The preparation method of the exosome adopts a method for recombinant expression of exogenous target protein, comprises the transient expression and the stable expression of the protein, and obtains a large amount of exosomes containing the exogenous target protein by means of engineering large-scale cell culture. Serum is not required to be added in the culture process, so that the pollution of serum vesicles in the exosome extraction process is avoided; a large amount of exosomes loaded with bioactive antibodies are obtained by culturing cells in a large scale, so that the possibility is provided for the industrialization of the exosomes, and the method has a good industrialization prospect. Meanwhile, the exosome obtained by the preparation method of the invention entraps active protein, can easily penetrate tissues and cell membranes and blood brain barriers and reaches a focus part for treating diseases such as tumor and the like; can also be used in skin care products, is easier to permeate the skin, and has wide application.

Description

Preparation method and application of protein-entrapped exosome

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a preparation method and application of an exosome entrapping protein.

Background

The traditional medicines, whether chemical medicines or traditional Chinese medicines, often have the defects of poor water solubility, easy quick removal by human bodies, poor biocompatibility, unsatisfactory distribution in vivo, low permeability to cells and the like, and biological medicines such as protein medicines also have the problems of easy degradation and instability. Different drug delivery systems have therefore been developed to address the above problems, for example nanoparticles such as liposomes. However, these chemically synthesized entrapped particles present a number of problems, the most important of which is the strong immune response that may be elicited.

In 1981, Trams et al found a group of vesicle-like materials smaller than the multivesicular bodies and having a diameter of 40-1000 nm under a transmission electron microscope. In 1987, Johnstone et al named this membrane vesicle as exosomes (exosomes), and the main process of its production can be summarized as: (1) the plasma membrane of the cell caveats to form small bubbles in the cell; (2) the intracellular vesicles further develop to form multivesicular bodies; (3) multivesicular bodies fuse with the cytoplasmic membrane to release exosomes, and receptor cell acceptance of exosomes can be achieved by ligand-receptor interaction, pinocytosis/phagocytosis, or membrane fusion. As can be seen from the production process, exosomes are vesicles of cell membrane components, and the insides can carry a large number of components such as RNA, proteins and the like. This has also led to the idea of using exosomes naturally produced by such cells as drug-encapsulating systems.

The exosome has unique advantages in drug transportation as a drug carrier, and is mainly reflected in that: (1) when using self-derived exosomes, the harmful immune response caused by exosomes is very low; (2) the exosome has good stability in human blood; (3) the efficiency of transporting 'cargo' to cells is high; (4) the exosome has certain targeting property when carrying the medicine; (5) the diameter of the exosome is 40-100 nm, so that the exosome can selectively infiltrate into tumor or inflammatory tissue parts by utilizing an enhanced permeation-retention (EPR) effect. At present, research on gene therapy, tumor therapy and the like by carrying siRNA, chemical small molecule drugs and the like by exosome has been tried. However, for large molecule protein drugs, it is very difficult to encapsulate the drug by means of electroporation, transfection, incubation, etc. which are commonly used at present.

Therefore, how to obtain the protein-entrapped exosome efficiently is urgent to be researched and broken through.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provides a preparation method of an exosome entrapping protein.

The invention also aims to provide application of the preparation method of the protein-entrapped exosome.

The purpose of the invention is realized by the following technical scheme:

a preparation method of an exosome entrapping protein comprises the following steps:

(1) constructing a recombinant expression vector containing exogenous target protein gene segments,

(2) transfecting cells with the recombinant expression vector for expression, and culturing the transfected cells to enable the cells to secrete exosomes carrying the exogenous target proteins;

when the expression is transient expression, the specific steps are as follows:

A. and (3) culturing the cells: cells cultured to logarithmic growth phase were seeded at a final concentration of 4X 10⁵～6×10⁵Inoculating the strain/mL into a culture medium, and culturing at 36-38 ℃ in 3-7% CO₂Performing shaking suspension culture in a Tubespin tube at the rotation speed of 160-200 rpm for 60-84 h, and expanding to 1L of culture shake flask, wherein the cell viability is maintained at about 90%;

B. transfecting cells with the recombinant expression vector, wherein the transfected cells have 4-8% CO at 36-38 DEG C₂Performing suspension culture at the rotating speed of 160-200 rpm, and collecting samples when the cell viability is lower than 30%;

when the expression is stable expression, the specific steps are as follows:

A. transfecting cells with the recombinant expression vector, culturing in a cloning culture medium with the cell viability of more than 90% on the day of culture, measuring the protein expression condition by an ELISA method on days 12-14, and selecting clones with high expression quantity to amplify to a 12-hole plate; measuring the protein expression condition by using an ELISA method again at 12-14 days, screening out high-expression clones, culturing the high-expression clones in a Tubespin tube, and obtaining stable expression cells with high expression quantity;

B. large-scale culture of stably expressing cells with high expression: cells cultured to logarithmic growth phase were seeded at a final concentration of 4X 10⁵～6×10⁵Inoculating the strain/mL into a culture medium, and culturing at 36-38 ℃ with 3-7% CO₂Performing suspension culture in a Tubespin tube at a rotation speed of 160-200 rpm for 60-84 h, amplifying into a 1L culture shake flask, culturing for 60-84 h, transferring into a 5L fermentation tank, and culturingCulturing for 60-84 h, transferring to a 20L fermentation tank, culturing for 60-84 h, and transferring to a 200L fermentation tank; through the large-scale culture, the cell viability can be maintained at about 80 percent after the culture is carried out for 15 to 18 days, and the highest cell density can reach 1.0 to 3.0 multiplied by 10⁷Per mL;

(3) isolating said exosomes from the cell culture supernatant.

The cell is preferably at least one of a CHO cell or a HEK293F cell.

When the cells are CHO cells, the culture medium is preferably ProCHO5 culture medium of Lonza company; when the cells are HEK293F cells, the culture medium is preferably Sigma

293 serum-free medium.

The expression vector is preferably pcDNA^TM3.4。

The preparation method of the invention is applicable to various exogenous target proteins; the foreign target protein may be selected as desired, for example, HER2 antibody, recombinant fusion protein TNFR-Fc, and the like.

Preferably, the exosome is isolated from the cell culture supernatant by an ultracentrifugation method or an exosome extraction kit.

The specific steps of the ultracentrifugation method are preferably as follows:

(1) centrifuging 300g of cell culture supernatant for 10min, centrifuging 2000g of cell culture supernatant for 10-20 min, and discarding the precipitate to obtain a first supernatant so as to remove cells;

(2) centrifuging the first supernatant at 10000g for 30min, discarding the precipitate, and collecting the second supernatant to remove subcellular components;

(3) centrifuging 100000g of the second supernatant for 70-90 min, discarding the supernatant, and reserving a first precipitate, wherein the precipitate is exosome and some soluble proteins;

(4) re-suspending the first precipitate obtained in the step (3) by using a PBS solution, uniformly mixing, centrifuging for 70-90 min by 100000g to wash off soluble protein, and washing the precipitate to obtain the exosome;

the steps (1) to (4) are all carried out at 4 ℃.

The preparation method of the protein-entrapped exosome is applied to a gene, protein or drug delivery system.

An exosome prepared by the preparation method.

The particle size of the exosome is 40-200 nm.

Compared with the prior art, the invention has the following advantages and effects:

1. the invention adopts a method for recombinant expression of exogenous target protein, comprising transient expression and stable expression of the protein, and obtains a large amount of exosomes containing the exogenous target protein by means of engineering large-scale cell culture.

The invention adopts suspension cultured CHO cell or HEK293F cell as the most main expression system for expressing recombinant protein, and the culture technology is mature and can reach 10⁷～10⁸The cell density of each mL, the expression quantity of the recombinant protein can exceed 10g/L, and the scale can reach more than 2000L. However, the culture technology is used for protein expression at present, and the culture technology is not used for the production of exosomes yet. According to the invention, the culture process is optimized, the yield of the exosomes is improved, serum is not required to be added during culture, the pollution of serum vesicles in the exosome extraction process is avoided, and a large amount of exosomes loaded with bioactive antibodies can be obtained by culturing CHO cells or HEK cells in a large scale, so that the exosomes can be industrialized.

2. The exosome prepared by the invention is loaded with active protein, can easily penetrate tissues, cell membranes and blood brain barriers and reaches a focus part for treating diseases such as tumor and the like; can also be used as skin care product, and can penetrate skin easily.

Drawings

FIG. 1 is a graph of CHO cell culture.

FIG. 2 is an electrophoresis chart of PCR products of the recombinant HER2 antibody plasmid of example 2, wherein lanes 1-2 are the heavy chain of HER2 antibody and lanes 3-4 are the light chain of HER2 antibody.

FIG. 3 is a graph showing the results of reductive electrophoresis of the recombinant HER2 antibody protein obtained by transient expression.

FIG. 4 is a reduced electrophoresis image of HER2 antibody protein stably expressed by CHO cells.

FIG. 5 is a Transmission Electron Microscope (TEM) photograph of exosomes extracted in example 5.

FIG. 6 is a graph showing the results of analyzing the particle size of the exosomes detected by NTA in example 5.

FIG. 7 is a graph showing the Western blotting results of the purified exosomes; wherein CD9 and CD63 are marker proteins of exosomes, and the exosome-antibody is an exosome extracted from a CHO cell expressing a HER2 antibody; control exosomes were exosomes extracted from blank CHO cells.

FIG. 8 is a graph showing the results of tumor cell activity inhibition by the HER2 antibody-containing exosomes and the HER2 antibody protein.

FIG. 9 is an electrophoresis diagram of PCR products of the recombinant TNFR-Fc plasmid, wherein lane 1 is protein Marker and 2-3 are positive clones.

FIG. 10 is a graph showing the result of reductive electrophoresis of the recombinant TNFR-Fc protein obtained by transient expression.

FIG. 11 is a reduced electrophoresis image of TNFR-Fc protein stably expressed by CHO cells.

FIG. 12 is a graph showing the results of analyzing the particle size of the exosomes detected by NTA in example 12.

FIG. 13 is a graph showing the Western blotting results of the purified exosomes; wherein, CD63 is the marker protein of the exosome, and the exosome-TNFR-Fc is the exosome extracted from CHO cells expressing the TNFR-Fc; blank exosomes were exosomes extracted from blank CHO cells.

FIG. 14 is a graph showing the results of the cell activity inhibition assay of TNFR-Fc-containing exosomes and TNFR-Fc pure protein.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.

EXAMPLE 1 Large Scale culture of cells

Culture was carried out from laboratory scale to industrial production scale using CHO cells (purchased from Invitrogen) used for the industrial production of recombinant proteins.

The experimental method comprises the following steps: the cell cryopreserved tube was removed from the liquid nitrogen tank, the cells were thawed by rapid horizontal shaking in warm water at 37 ℃ (about 2min), the cells were transferred to a tube of Tubespin (purchased from sartorius), 5mL of fresh ProCHO5 medium (purchased from Lonza) was added, the mixture was mixed, the cells were centrifuged at 1000rpm × 5min, the supernatant was discarded, the cells were suspended by 10mL of fresh ProCHO5 medium, and the cell density and cell viability were calculated by observing with a microscope after trypan blue staining. 37 ℃ and 5% CO₂And (4) shaking and suspending for culture under the conditions of 180rpm and saturated humidity. CHO cells were cultured at 0.5X 10 in their logarithmic growth phase⁶one/mL of the density was inoculated in ProCHO5 medium. Using a disposable Tubespin rotating tube at 37 ℃ and 5% CO₂Oscillating and suspending for 72h under the condition of 180rpm and saturated humidity, amplifying the mixture into a 1L culture shake flask, transferring the mixture into a 5L fermentation tank after 72h of culture, transferring the mixture into a 20L fermentation tank after 72h of culture, and transferring the mixture into a 200L fermentation tank after 72h of culture.

Except that the ProCHO5 medium was replaced with

The HEK cells were cultured in the same manner as CHO cells except for 293 serum-free medium (purchased from Sigma).

As shown in FIG. 1, the CHO cells cultured in the reactor for 15-18 days have a cell viability of about 80% and a cell maximum density of 1.0-3.0 × 10⁷one/mL.

Example 2 recombinant HER2 antibody plasmid construction

The HER2 antibody is used as a model protein and is transiently expressed in cells.

1. Sequence information

(1) HER2 antibody gene information

Nucleotide sequence of the light chain:

GACATCCAGATGACGCAGTCGCCGTCCTCATTGAGCGCATCCGTGGGA GACAGAGTCACTATTACATGCCGGGCATCCCAAGACGTAAACACGGCCGTC GCCTGGTACCAACAGAAGCCCGGAAAAGCGCCCAAACTGTTGATCTACTCC GCCTCATTTCTGTACAGCGGGGTACCCTCGAGGTTCAGCGGCTCGAGGAGC GGGACGGATTTCACGTTGACAATTTCGTCACTTCAGCCGGAAGATTTTGCG ACATACTATTGCCAGCAACACTATACCACACCCCCGACGTTTGGCCAGGGG ACCAAAGTCGAGATCAAGCGGACCGTGGCCGCTCCGTCAGTATTCATCTTC CCGCCGTCCGATGAGCAACTCAAGAGCGGAACCGCATCAGTCGTATGCTTG CTCAATAACTTCTATCCGCGAGAGGCGAAGGTGCAGTGGAAAGTGGACAA CGCCCTGCAGTCCGGTAATAGCCAGGAATCAGTCACGGAGCAGGATTCAAA GGATTCGACCTATTCCCTCTCGTCGACATTGACGCTGTCGAAAGCAGACTAC GAAAAACATAAAGTGTACGCTTGTGAAGTGACACACCAGGGCCTTTCATCC CCGGTGACAAAGTCGTTCAATCGCGGGGAGTGT；

nucleotide sequence of heavy chain:

GAGGTGCAGCTTGTCGAATCCGGGGGAGGGCTCGTCCAACCCGGAGG ATCACTGCGCCTTTCATGCGCAGCCTCGGGTTTCAATATCAAGGACACGTAT ATCCATTGGGTGCGGCAGGCGCCAGGAAAAGGTTTGGAGTGGGTCGCGAG GATCTACCCCACCAATGGGTACACACGATACGCCGATTCGGTCAAGGGGCG GTTCACAATCTCGGCGGACACGTCGAAAAACACTGCGTACTTGCAGATGAA TAGCCTCCGCGCAGAAGATACTGCGGTGTATTACTGCTCCCGCTGGGGAGG TGATGGCTTCTATGCGATGGACTATTGGGGACAAGGAACACTTGTAACGGT CAGCTCGGCCAGCACCAAGGGGCCGTCCGTGTTTCCCCTCGCCCCCTCGTC GAAGTCAACTAGCGGCGGAACAGCCGCCCTTGGTTGCCTGGTCAAGGACT ACTTCCCCGAACCGGTCACGGTGTCATGGAACTCGGGAGCATTGACTTCGG GTGTGCATACATTTCCCGCAGTGCTCCAGTCATCAGGACTGTATAGCCTCTC GTCCGTCGTAACGGTCCCGTCATCGTCGCTCGGGACCCAGACATACATTTGC AATGTCAACCACAAACCTTCGAATACAAAGGTGGATAAGAAGGTCGAGCC GAAGTCGTGTGACAAGACGCACACATGTCCTCCATGCCCTGCGCCTGAGTT GCTGGGAGGGCCGAGCGTGTTCCTCTTTCCTCCCAAGCCGAAGGACACACT GATGATTTCGAGGACGCCTGAGGTAACTTGCGTGGTAGTAGATGTGTCCCAT GAGGACCCCGAAGTAAAGTTTAACTGGTATGTGGACGGTGTGGAGGTCCAC AATGCCAAAACCAAACCGCGCGAAGAGCAATACAACAGCACATATCGGGT GGTGAGCGTGCTCACCGTCTTGCACCAGGACTGGCTGAACGGGAAAGAGT ACAAATGTAAAGTATCAAACAAAGCGCTCCCCGCACCCATTGAAAAGACTA TCTCAAAGGCTAAGGGACAGCCCAGAGAGCCACAAGTCTACACGCTCCCG CCCTCGAGAGATGAGTTGACGAAGAATCAGGTCAGCCTTACGTGCCTCGTC AAAGGGTTTTACCCATCCGACATTGCGGTGGAATGGGAAAGCAACGGACA GCCAGAGAACAACTACAAGACTACACCGCCTGTGCTGGACTCGGATGGTTC GTTCTTCCTCTACTCGAAATTGACTGTGGACAAATCCCGCTGGCAGCAGGG AAATGTGTTCTCGTGTAGCGTAATGCATGAAGCGTTGCACAATCACTATACC CAGAAATCGCTCTCCCTTTCGCCTGGC；

(2) primer information

Heavy chain primer:

HC-Forward Primer:

GACGGATCCGCCATGGAGTTCTGGTTGTCATGGGTCTTTCTGGTAGC

HC-Reverse Primer:

GACGGATCCTCATTAGCCAGGCGAAAGGGAGAGCGATTTCTGGGTA

light chain primers:

LC-Forward Primer:

GACGGATCCGCCATGGATATGCGAGTACCCGCACAACTTCTTGGGCT

LC-Reverse Primer:

GACGGATCCTCATTAACACTCCCCGCGATTGAACGACTTTGTCACCG

obtaining of the target Gene fragment (PrimerSTAR HS DNA Polymerase) the reaction system and reaction conditions were as follows:

TABLE 1 PCR amplification System for target genes

TABLE 2 PCR amplification reaction conditions for the genes of interest

The PCR products were recovered and purified by QIAquick PCR Purification kit (purchased from QIAGEN) to obtain 1450bp and 750bp PCR products, respectively. The expression vector pcDNA was digested with the restriction enzymes Kpn I, Thermo Scientific (from Thermo Co.) and Xho I (from Thermo Co.)^TM3.4 (from Invitrogen) and the heavy and light chain genes of interest, two recombinant plasmids were constructed by ligating the plasmid and the two genes of interest for the heavy and light chain, respectively, with T4DNA ligase (from Fermentas). The ligation product-transformed host bacterium DH5a (purchased from Shanghai Biotech Co., Ltd.) was plated on a plate containing LB solid medium (containing 100mg/L ampicillin) overnight at 37 ℃.

(2) Individual colonies were picked and inoculated into 5mL of LB medium (containing 100mg/L ampicillin) and shake-cultured overnight at 37 ℃. Then, 1mL of overnight culture was inoculated into 400mL of LB medium (containing 100mg/L ampicillin), and positive clones were picked for PCR identification.

The results are shown in FIG. 2, and the positive clone was identified by PCR as two bands, 1450bp heavy chain and 750bp light chain, consistent with our expectations, indicating that we have successfully constructed recombinant plasmids.

Example 3 transient expression of recombinant HER2 antibody in animal cells

The recombinant protein is transiently expressed in CHO cells or HEK293F cells respectively, and the specific steps are as follows:

(1) and (3) culturing the cells:

culture of cho cells: CHO cells cultured to logarithmic growth phase, ProCHO5 medium (purchased from Lonza) at a final concentration of 4X 10⁵～6×10⁵Per mL, 3-7% CO at 36-38 ℃₂Performing shaking suspension culture in a Tubespin tube at the rotation speed of 160-200 rpm for 60-84 h, and expanding the suspension to a 1L culture shake flask, wherein the cell viability can be maintained at about 90%;

culture of hek293f cells: 293F cells cultured to logarithmic growth phase were inoculated

293 serum-free Medium (purchased from Sigma) at a final concentration of 4X 10⁵～6×10⁵Per mL, 3-7% CO at 36-38 ℃₂And performing shaking suspension culture in a Tubespin tube at the rotation speed of 160-200 rpm for 60-84 h, and expanding the suspension to a 1L culture flask, wherein the cell viability can be maintained at about 90%.

(2) Transient expression: culturing the cells to logarithmic phase, taking a sterilized 1.5mL EP tube, and according to the required plasmid DNA concentration (0.5-2 mug/10)⁶cells) (ratio of plasmid DNA concentration of heavy and light chains 1:1,) and transfection reagent Linear 25kDa PEI (polyethyleneimine) (Polysciences), both were mixed in a certain ratio (DNA: PEI 1: 2-1: 3) respectively adding the mixture into an EP tube, fully mixing, and standing for 5-10 min; the DNA/PEI mixture was added at a concentration of 2X 10⁶～4×10⁶In one/mL cell suspension, the final DNA concentration is 0.5-2 mug/10⁶cells. Make itThe cells and DNA/PEI complex are sufficiently homogeneous; 37 ℃ and 6% CO₂And (3) shaking and suspending at 180rpm, detecting the density and the cell viability rate of the living cells every day, starting to collect samples every other day on the third day, and collecting the samples when the cell viability rate is lower than 30 percent.

(3) Protein purification: the harvested cells were centrifuged at 5000 Xg for 30min and the supernatant was collected. One-step purification was performed using Protein A packing (GE Co.). Setting the flow rate to be 1mL/min, starting to load the sample, eluting the ProteinA column by using 100mM glycine elution buffer solution after the sample loading is finished, collecting target eluent by using a 50mL centrifuge tube, and immediately adding a proper amount of 1M Tris-HCl to adjust the pH value for neutralization.

(4) SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) detection of purified protein:

the formulation of the protein gel, the separation gel and the concentrated gel are shown in table 3:

TABLE 3 electrophoretic gel configuration

Samples were denatured by heating at 100 ℃ for 5min, and subjected to electrophoresis under 80V pressure.

The electrophoresis result is shown in fig. 3, after reduction electrophoresis, the protein is dissociated into two bands of a heavy chain and a light chain, the positions of the two bands are respectively 50KDa and 25KDa, the molecular weight is consistent with the expected molecular weight of the antibody, and the successful expression of the protein in the CHO cell or the HEK293F cell is shown.

Example 4 Stable expression of recombinant HER2 antibody in cells

The recombinant protein was stably expressed in CHO cells by the same transfection method as in example 3.

(1) Monoclonal screening

1000mL of cloning medium (1000mL of CD-FORTI +30mL of 200mM glutamine stock solution) was prepared (purchased from Gbico).

On the day of culture, the cell viability was greater than 92%, and the cells were diluted 10-fold with cloning medium to 1000 cells per well (120mL of cloning medium) and inoculated into 15 plates, 60 wells per plate. The well plates were seeded at 200. mu.L/well. And measuring the protein expression result by using an ELISA method at about the day 13 of cloning, selecting a cell clone with high expression level, amplifying the cell clone to a 12-hole plate, similarly culturing for 13 days, detecting by using the ELISA method, then selecting a cell clone with high expression level, culturing in a Tubespin tube, and finally determining the cell clone with high expression level.

(2) ELISA method

Diluting goat anti-human IgG (Fc) antibody (purchased from KPL) with coating solution at a ratio of 1:1000, 100 μ L/well, and coating overnight in a refrigerator at 4 deg.C; PBST (ex Thermo) 1 wash; IgG standards (purchased from Amgen) were diluted with sample diluent to a concentration gradient: 6.25ng/mL, 3.125ng/mL, 1.5625ng/mL, 0.78125ng/mL, 0.39063ng/mL, 0.19531ng/mL, 0.09766 ng/mL. Each well was loaded with 100. mu.L and incubated at 37 ℃ for 1 h.

The sample solution is deducted to be dried, and PBST is washed for 3 times; diluting goat anti-human IgG (H + L)/AP (purchased from Abcam) antibody with a second antibody diluent according to a ratio of 1:1000, adding 100 mu L/well into each well, and standing at 37 ℃ for 1H; PBST washing 5 times; a developing solution (purchased from sigma) was added at a rate of 100. mu.L/well, and the mixture was developed in the dark at 37 ℃ for 15 min. The color development was stopped by the addition of 3mol/L NaOH (from Panera). Detection was carried out using a microplate reader (from Thermo) at a wavelength of 405 nm.

(3) Stable expression of the protein: after selecting the clones, large-scale cell culture was carried out by the method of example 1 for 10 to 15 days, and the cell culture supernatant was collected, purified and electrophoretically examined (same as in example 3).

The electrophoresis result is shown in FIG. 4, after reduction electrophoresis, the protein is dissociated into two bands of heavy chain and light chain, which are at the positions of 50kDa and 25kDa, respectively.

Example 5 exosome extraction and identification

1. And (3) exosome extraction: example 3 transient expression and example 4 stable expression of proteins the culture supernatant contains exosomes, so the exosomes were first extracted. Centrifuging the cell culture supernatant to be extracted at 4 ℃ for 300g 10min and 2000g 20min to remove cells; centrifuging for l0000g 30min to remove subcellular components; centrifuging at 100000g for 70min, removing supernatant, and collecting precipitate as exosome and some soluble proteins; resuspending the precipitate with PBS solution, mixing, centrifuging at 100000g for 70min to remove soluble protein, and repeatedly washing for three times to obtain precipitate as exosome; and finally, suspending the precipitate with PBS solution to purify the exosome solution, and storing the exosome solution in a refrigerator at the temperature of 80 ℃ below zero for later use.

2. Particle size analysis of exosomes: NTA measures the particle size and concentration of exosomes. Using a NanoSight NS300 instrument (from Malvern), the machine was preheated and the sample tube and sample cell were first cleaned with ultra pure water. After waiting for the temperature to rise to the set temperature, 10. mu.L of the exosomes obtained by ultracentrifugation were taken and added to 990. mu.L of membrane-passed PBS, and the sample was diluted 100-fold. The 1mL exosome dilution sample is uniformly mixed by a pipette, a sample to be detected is slowly injected into a sample pool by using a clean injector, the focus is adjusted by a knob of a host to a visible and clear white bright spot, the gain is adjusted to record, 30s is recorded every time, and the injector is slowly pushed into a small amount of sample after the single 30s recording is completed, so that different visual fields are changed for measurement. And (3) repeatedly detecting each sample for 3 times, adjusting the brightness to the maximum value after 3 times of 30s video picture recording, distinguishing a threshold value until the number of pictures to blue points (false positives) is less than 5/picture, analyzing the motion track of each exosome in each picture by software, automatically converting the motion track into the diameter and the concentration of the exosome according to the Brownian motion principle, and obtaining the original concentration according to the dilution ratio.

3. The morphology of exosomes was observed by transmission electron microscopy: the copper mesh is placed on a clean piece of filter paper, 10 μ L of the sample (diluted to a suitable multiple for observation if the sample concentration is high) is dropped on the copper mesh until the sample is naturally air-dried, then 5% phosphotungstic acid is stained for 90s, and the liquid is blotted with filter paper. The whole operation process is carried out at normal temperature, after the sample is fully aired, the size and the shape of the exosome can be observed under an electron microscope, and a representative electron microscope picture is shot.

The results of exosomes extracted from CHO cells stably expressing antibodies are shown in fig. 5 and 6, NTA detection results show that the particle size is mainly distributed within 0-200 nm, and a significant peak height is present around 120nm (see fig. 6), which is consistent with the exosome size (Scale bar 100nm) shown in Transmission Electron Microscopy (TEM) of fig. 5. The exosome results obtained in example 3 were similar.

Example 6 analysis of recombinant HER2 antibody carried in exosomes

The purified exosomes (exosomes obtained by stably expressing the HER2 antibody in CHO cells) were extracted and subjected to SDS-PAGE (same as in example 3), and after the electrophoresis, the electrophoresis gel was removed and subjected to Western Blotting to determine whether the exosomes contained the recombinantly expressed antibody protein.

PVDF membrane (purchased from Merck Millipore) was first activated with methanol and then placed in a membrane transfer solution after activation. The sponge, the filter paper, the membrane, the glue, the filter paper and the sponge are clamped in sequence, the sponge, the filter paper, the membrane, the glue, the filter paper and the sponge are placed in a membrane rotating groove, and a precooled ice bag is placed in the membrane rotating groove. After the assembly, the film transferring tank is placed in ice-water mixed liquid, and the film is transferred for 60min under the condition of constant current of 250 mA. The transferred membrane was washed once with TBST (purchased from Sigma) to remove the residual membrane transfer solution. Preparing 5% skimmed milk, adding 10mL TBST, shaking, mixing uniformly, adding onto PVDF membrane, and sealing at low speed for 30-60 min at room temperature on a shaking table; membranes were washed three times with TBST and primary antibodies (anti-CD 9, CD63 and HER2 antibodies, all from Abcam) diluted by appropriate fold with TBST were added to the membranes. Shaking at room temperature for more than 5h or at 4 deg.C overnight; the PVDF membrane was then washed 3 times with TBST, the corresponding goat anti-mouse secondary antibody (purchased from Proteintech) was added, the membrane was shaken at low speed for 60min at room temperature, washed 3 times with TBST, developed and photographed using the BIO-RAD gel imaging system. The results were analyzed with Image J software.

The results are shown in FIG. 7, where "exosome-antibody" corresponds to exosomes extracted from CHO cells expressing HER2 antibody, and a distinct band is visible at the corresponding position of the antibody protein, indicating that recombinant antibody protein we express is contained in exosomes; the "control exosomes" were exosomes extracted from blank CHO cells. The two proteins are marker proteins of exosomes and can also be found to have obvious bands by simultaneously using antibodies of CD9 and CD63 for development, and further, the exosomes are extracted.

Example 7 use of carrying recombinant HER2 antibody in vitro exosomes

We select the recombinant expression HER2 antibody as a protein with the function of inhibiting the growth of tumor cells, and we detect that the exosome containing the recombinant protein can also have the same pharmacodynamic function through a cell growth experiment, so that the exosome carrying the recombinant protein can be confirmed to be used as a drug delivery system to deliver drug protein to target cells.

Breast cancer BT-474 cells (purchased from Guangzhou Securio Biotechnology Co., Ltd.) cultured at a density of 1.2X 10 in 96-well cell culture plates in RPMI 1640 medium (10% FBS) (purchased from Gibco)⁵one/mL, 50. mu.L/well. 37 ℃ and 5% CO₂And culturing for 2h under the condition of saturated humidity to allow the cells to adhere to the wall. Purified monoclonal antibody (5. mu.g/mL) diluted in RPMI 1640 medium (10% FBS) and antibody-containing exosome (10% (v/v)) were added to the cells, and the mixture was added to the cell culture medium at a concentration of 50. mu.L/well in each of 10-fold dilutions. And continuing culturing for 168h to ensure that the abundance of the cells reaches more than 80 percent. MTT solution (purchased from Sigma), 20. mu.L/well, 37 ℃ C., 5% CO was added₂And culturing for 4h under the condition of saturated humidity. The supernatant was carefully removed and DMSO (purchased from Sigma) was added at 100. mu.L/well and incubated at 37 ℃ in the dark for 15min until the crystals were completely dissolved. The OD was measured at a wavelength of 570nm, with a reference wavelength of 630 nm.

The results are shown in fig. 8, and both the purified recombinant antibody and the exosome containing the recombinant antibody have the activity of inhibiting tumor cells, which indicates that the protein encapsulated in the exosome is active, and this indicates that the exosome can be used as a drug carrier to carry active drug protein for treating diseases.

Example 8 construction of recombinant TNFR-Fc plasmid

TNFR-Fc recombinant plasmid is constructed and transiently expressed in cells.

1. Sequence information

(1) Nucleotide sequence of TNFR-Fc:

ATGGCCCCCGTGGCCGTGTGGGCTGCCCTGGCCGTGGGACTGGAACTG TGGGCTGCTGCCCACGCCCTGCCCGCCCAGGTGGCCTTCACCCCCTACGCC CCCGAGCCAGGCAGCACCTGCAGGCTGAGAGAGTACTACGACCAGACCGC CCAGATGTGCTGCAGCAAGTGCTCTCCAGGCCAGCATGCCAAGGTGTTCTG CACCAAGACCAGCGACACCGTGTGCGACAGCTGCGAGGACAGCACCTACA CCCAGCTGTGGAACTGGGTGCCCGAGTGCCTGAGCTGTGGCAGCAGGTGC TCTAGCGACCAGGTCGAGACCCAGGCCTGCACCAGAGAGCAGAACAGGAT CTGCACCTGCAGACCCGGCTGGTACTGCGCCCTGAGCAAGCAGGAAGGCT GCAGGCTCTGCGCCCCACTGAGGAAGTGCAGGCCCGGCTTCGGCGTGGCC AGACCCGGCACCGAGACCTCCGACGTGGTGTGCAAGCCCTGCGCCCCAGG CACCTTCAGCAACACCACCTCCAGCACCGACATCTGCAGGCCCCACCAGAT CTGCAACGTGGTGGCTATCCCCGGCAATGCCAGCATGGACGCCGTGTGCAC CAGCACCTCCCCCACCAGAAGCATGGCCCCAGGCGCCGTGCACCTGCCCC AGCCCGTGAGCACCAGGTCCCAGCACACCCAGCCCACCCCAGAGCCTAGC ACCGCCCCCTCTACCAGCTTCCTGCTGCCCATGGGCCCCAGCCCTCCAGCC GAGGGCAGCACCGGCGACGAGCCCAAGAGCTGCGACAAGACCCACACCT GCCCCCCCTGTCCTGCTCCAGAACTCCTGGGCGGACCCAGCGTGTTCCTGT TCCCCCCCAAGCCCAAGGACACCCTGATGATCAGCAGGACCCCCGAGGTG ACCTGCGTGGTGGTGGACGTGAGCCACGAGGACCCACAGGTCAAGTTCAA CTGGTACGTGGACGGCGTGCAGGTGCACAACGCCAAGACCAAGCCCCGGG AGCAGCAGTACAACTCCACCTACAGAGTGGTGTCCGTGCTGACCGTGCTGC ACCAGAACTGGCTGGACGGCAAAGAGTACAAGTGCAAGGTCTCCAACAAG GCCCTGCCAGCCCCCATCGAGAAAACCATCAGCAAGGCCAAGGGCCAGCC CAGGGAACCCCAGGTGTACACCCTGCCACCCTCTCGAGAGGAAATGACCA AGAACCAGGTGTCCCTGACCTGCCTGGTGAAGGGCTTCTACCCCAGCGACA TCGCCGTGGAGTGGGAGAGCAACGGCCAGCCCGAGAACAACTACAAGACC ACCCCCCCAGTGCTGGACAGCGACGGCAGCTTCTTCCTGTACAGCAAGCTG ACCGTGGACAAGAGCAGATGGCAGCAGGGCAACGTGTTCAGCTGCAGCGT GATGCACGAGGCCCTGCACAACCACTACACCCAGAAGAGCCTGAGCCTGT CCCCCGGCAAGTGATGA；

(2) designing a primer:

Forward Primer:ATAAAAGGTACCATGGCCCCCGTGGCCGT

Reverse Primer:ATAAAAGGATCCTCATCACTTGCCGGGGGAC

2. the target gene fragment was obtained in the same manner as in example 2

The electrophoresis results of FIG. 9 show that the obtained gene fragments have the same theoretical values, indicating that the recombinant TNFR-Fc plasmid has been successfully constructed.

Example 9 transient expression of recombinant TNFR-Fc in animal cells

The recombinant TNFR-Fc was transiently expressed in CHO cells or HEK293F cells, respectively, and the specific steps were performed according to example 3.

The experimental results in FIG. 10 show that the protein is a chain with a molecular weight of about 75kD after reduction electrophoresis, which is consistent with the theoretical prediction value, and indicates that the protein is successfully expressed in CHO cells or HEK293F cells.

Example 10 Stable expression of recombinant TNFR-Fc in cells

The recombinant TNFR-Fc is stably expressed in CHO cells by the same transfection method as that of example 3. The monoclonal screening method and the stable expression method were the same as in example 4.

The electrophoresis results are shown in FIG. 11, and after reduction electrophoresis, the protein is a chain with a molecular weight of about 75kD, which is consistent with the theoretical prediction value.

Example 11 exosome extraction and identification

The exosome extraction method and analysis were performed with reference to the method of example 5.

Fig. 12 shows the results of exosomes extracted from CHO cells stably expressing antibodies, and NTA detection results show that the exosomes obtained in example 3 and example 5 are similar, the particle size of the exosomes obtained in this example is mainly distributed within 0-200 nm, and two significant peak heights are provided around 143nm and 197nm, and the extracted vesicles belong to the particle size range of exosomes.

Example 12 analysis of recombinant TNFR-Fc-carrying in exosomes

Recombinant TNFR-Fc carried in exosomes was analyzed by the assay of example 6.

The results are shown in FIG. 13, and the "exosome-TNFR-Fc" corresponds to exosomes extracted from CHO cells expressing TNFR-Fc, and a clear band can be seen at the corresponding position of the target protein, which indicates that the exosomes contain the recombinant protein which we express; "blank exosomes" are exosomes extracted from blank CHO cells. Meanwhile, the antibody of the marker protein CD63 of the exosome is used for development, and the obvious band can be found, so that the exosome is further confirmed to be extracted.

Example 13 use of recombinant TNFR-Fc exosomes

TNFR-Fc can be combined with TNF so as to inhibit the killing activity of TNF on cells, and the exosome containing the recombinant protein can also have the same pharmacodynamic function through cell growth experiments, so that the exosome carrying the recombinant protein can be confirmed to be used as a drug delivery system to deliver drug protein to target cells.

Breast cancer L929 cells (purchased from Shanghai Jining industries, Inc.) were cultured in 96-well cell culture plates using RPMI 1640 medium (10% FBS) (purchased from Gibco) at a cell density of 2X 10⁵one/mL, 100. mu.L/well, 37 ℃, 5% CO₂Culturing in an incubator overnight;

taking a new 96-well culture plate, diluting the extracted exosome sample with a control pure TNFR-Fc protein in a multiple ratio (the initial concentration of the pure TNFR-Fc protein is 1.25mg/mL, the initial concentration of the exosome is 10% (v/v)), adding recombinant human TNF alpha (purchased from Sigma) and actinomycin D (purchased from Sigma) to the final concentrations of 1ng/mL and 2 mu g/mL respectively, and standing at 37 ℃ for 30 min; adding 50 mu L of samples into corresponding cell wells, and culturing at 37 ℃ for 24 h; adding 10 μ L of WST-8 color developing solution (purchased from Shanghai Wei Cheng bioscience, Ltd.), standing at 37 deg.C for 2.5 hr, and measuring at 450nm wavelength.

The result is shown in FIG. 14, the purified TNFR-Fc and the exosome packaged with the TNFR-Fc can both bind to TNF-alpha and neutralize the killing effect of the TNF-alpha on cells, which indicates that the TNFR-Fc fusion protein in the exosome obtained by the invention has bioactivity. It is also proved that the exosome can be used as a drug carrier to carry active drug protein for treating diseases.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> river-south university

<120> preparation method and application of protein-entrapped exosome

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 642

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gacatccaga tgacgcagtc gccgtcctca ttgagcgcat ccgtgggaga cagagtcact 60

attacatgcc gggcatccca agacgtaaac acggccgtcg cctggtacca acagaagccc 120

ggaaaagcgc ccaaactgtt gatctactcc gcctcatttc tgtacagcgg ggtaccctcg 180

aggttcagcg gctcgaggag cgggacggat ttcacgttga caatttcgtc acttcagccg 240

gaagattttg cgacatacta ttgccagcaa cactatacca cacccccgac gtttggccag 300

gggaccaaag tcgagatcaa gcggaccgtg gccgctccgt cagtattcat cttcccgccg 360

tccgatgagc aactcaagag cggaaccgca tcagtcgtat gcttgctcaa taacttctat 420

ccgcgagagg cgaaggtgca gtggaaagtg gacaacgccc tgcagtccgg taatagccag 480

gaatcagtca cggagcagga ttcaaaggat tcgacctatt ccctctcgtc gacattgacg 540

ctgtcgaaag cagactacga aaaacataaa gtgtacgctt gtgaagtgac acaccagggc 600

ctttcatccc cggtgacaaa gtcgttcaat cgcggggagt gt 642

<210> 2

<211> 1347

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gaggtgcagc ttgtcgaatc cgggggaggg ctcgtccaac ccggaggatc actgcgcctt 60

tcatgcgcag cctcgggttt caatatcaag gacacgtata tccattgggt gcggcaggcg 120

ccaggaaaag gtttggagtg ggtcgcgagg atctacccca ccaatgggta cacacgatac 180

gccgattcgg tcaaggggcg gttcacaatc tcggcggaca cgtcgaaaaa cactgcgtac 240

ttgcagatga atagcctccg cgcagaagat actgcggtgt attactgctc ccgctgggga 300

ggtgatggct tctatgcgat ggactattgg ggacaaggaa cacttgtaac ggtcagctcg 360

gccagcacca aggggccgtc cgtgtttccc ctcgccccct cgtcgaagtc aactagcggc 420

ggaacagccg cccttggttg cctggtcaag gactacttcc ccgaaccggt cacggtgtca 480

tggaactcgg gagcattgac ttcgggtgtg catacatttc ccgcagtgct ccagtcatca 540

ggactgtata gcctctcgtc cgtcgtaacg gtcccgtcat cgtcgctcgg gacccagaca 600

tacatttgca atgtcaacca caaaccttcg aatacaaagg tggataagaa ggtcgagccg 660

aagtcgtgtg acaagacgca cacatgtcct ccatgccctg cgcctgagtt gctgggaggg 720

ccgagcgtgt tcctctttcc tcccaagccg aaggacacac tgatgatttc gaggacgcct 780

gaggtaactt gcgtggtagt agatgtgtcc catgaggacc ccgaagtaaa gtttaactgg 840

tatgtggacg gtgtggaggt ccacaatgcc aaaaccaaac cgcgcgaaga gcaatacaac 900

agcacatatc gggtggtgag cgtgctcacc gtcttgcacc aggactggct gaacgggaaa 960

gagtacaaat gtaaagtatc aaacaaagcg ctccccgcac ccattgaaaa gactatctca 1020

aaggctaagg gacagcccag agagccacaa gtctacacgc tcccgccctc gagagatgag 1080

ttgacgaaga atcaggtcag ccttacgtgc ctcgtcaaag ggttttaccc atccgacatt 1140

gcggtggaat gggaaagcaa cggacagcca gagaacaact acaagactac accgcctgtg 1200

ctggactcgg atggttcgtt cttcctctac tcgaaattga ctgtggacaa atcccgctgg 1260

cagcagggaa atgtgttctc gtgtagcgta atgcatgaag cgttgcacaa tcactatacc 1320

cagaaatcgc tctccctttc gcctggc 1347

<210> 3

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gacggatccg ccatggagtt ctggttgtca tgggtctttc tggtagc 47

<210> 4

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gacggatcct cattagccag gcgaaaggga gagcgatttc tgggta 46

<210> 5

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gacggatccg ccatggatat gcgagtaccc gcacaacttc ttgggct 47

<210> 6

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gacggatcct cattaacact ccccgcgatt gaacgacttt gtcaccg 47

<210> 7

<211> 1473

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atggcccccg tggccgtgtg ggctgccctg gccgtgggac tggaactgtg ggctgctgcc 60

cacgccctgc ccgcccaggt ggccttcacc ccctacgccc ccgagccagg cagcacctgc 120

aggctgagag agtactacga ccagaccgcc cagatgtgct gcagcaagtg ctctccaggc 180

cagcatgcca aggtgttctg caccaagacc agcgacaccg tgtgcgacag ctgcgaggac 240

agcacctaca cccagctgtg gaactgggtg cccgagtgcc tgagctgtgg cagcaggtgc 300

tctagcgacc aggtcgagac ccaggcctgc accagagagc agaacaggat ctgcacctgc 360

agacccggct ggtactgcgc cctgagcaag caggaaggct gcaggctctg cgccccactg 420

aggaagtgca ggcccggctt cggcgtggcc agacccggca ccgagacctc cgacgtggtg 480

tgcaagccct gcgccccagg caccttcagc aacaccacct ccagcaccga catctgcagg 540

ccccaccaga tctgcaacgt ggtggctatc cccggcaatg ccagcatgga cgccgtgtgc 600

accagcacct cccccaccag aagcatggcc ccaggcgccg tgcacctgcc ccagcccgtg 660

agcaccaggt cccagcacac ccagcccacc ccagagccta gcaccgcccc ctctaccagc 720

ttcctgctgc ccatgggccc cagccctcca gccgagggca gcaccggcga cgagcccaag 780

agctgcgaca agacccacac ctgccccccc tgtcctgctc cagaactcct gggcggaccc 840

agcgtgttcc tgttcccccc caagcccaag gacaccctga tgatcagcag gacccccgag 900

gtgacctgcg tggtggtgga cgtgagccac gaggacccac aggtcaagtt caactggtac 960

gtggacggcg tgcaggtgca caacgccaag accaagcccc gggagcagca gtacaactcc 1020

acctacagag tggtgtccgt gctgaccgtg ctgcaccaga actggctgga cggcaaagag 1080

tacaagtgca aggtctccaa caaggccctg ccagccccca tcgagaaaac catcagcaag 1140

gccaagggcc agcccaggga accccaggtg tacaccctgc caccctctcg agaggaaatg 1200

accaagaacc aggtgtccct gacctgcctg gtgaagggct tctaccccag cgacatcgcc 1260

gtggagtggg agagcaacgg ccagcccgag aacaactaca agaccacccc cccagtgctg 1320

gacagcgacg gcagcttctt cctgtacagc aagctgaccg tggacaagag cagatggcag 1380

cagggcaacg tgttcagctg cagcgtgatg cacgaggccc tgcacaacca ctacacccag 1440

aagagcctga gcctgtcccc cggcaagtga tga 1473

<210> 8

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ataaaaggta ccatggcccc cgtggccgt 29

<210> 9

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ataaaaggat cctcatcact tgccggggga c 31

Claims (3)

1. A preparation method of an exosome carrying protein is characterized by comprising the following steps:

(1) constructing a recombinant expression vector containing exogenous target protein gene segments; the exogenous target protein is HER2 antibody or recombinant fusion protein TNFR-Fc; the expression vector is pcDNA^TM3.4；

(2) Transfecting cells with the recombinant expression vector for expression, and culturing the transfected cells to enable the cells to secrete exosomes carrying the exogenous target proteins;

when the expression is transient expression, the specific steps are as follows:

A. and (3) culturing the cells: cells cultured to logarithmic growth phase were seeded at a final concentration of 4X 10⁵～6×10⁵ Inoculating the strain/mL into a culture medium, and culturing at 36-38 ℃ in 3-7% CO₂Performing shaking suspension culture in a Tubespin tube at the rotation speed of 160-200 rpm for 60-84 h, and expanding to 1L of culture shake flask, wherein the cell viability is maintained at about 90%;

B. transfecting cells with the recombinant expression vector, wherein the transfected cells have 4-8% CO at 36-38 DEG C₂Performing suspension culture at the rotating speed of 160-200 rpm, and collecting samples when the cell viability is lower than 30%;

when the expression is stable expression, the specific steps are as follows:

A. transfecting cells with the recombinant expression vector, culturing in a cloning culture medium with the cell viability of more than 90% on the day of culture, measuring the protein expression condition by an ELISA method on days 12-14, and selecting clones with high expression quantity to amplify to a 12-hole plate; measuring the protein expression condition by using an ELISA method again at 12-14 days, screening out high-expression clones, culturing the high-expression clones in a Tubespin tube, and obtaining stable expression cells with high expression quantity;

B. large-scale culture of stably expressing cells with high expression: cells cultured to logarithmic growth phase were seeded at a final concentration of 4X 10⁵～6×10⁵ Inoculating the strain/mL into a culture medium, and culturing at 36-38 ℃ in 3-7% CO₂Performing oscillatory suspension culture in a Tubespin tube at the rotation speed of 160-200 rpm for 60-84 h, amplifying the suspension culture into a 1L culture shake flask, transferring the suspension culture into a 5L fermentation tank after culturing for 60-84 h, transferring the suspension culture into a 20L fermentation tank after culturing for 60-84 h, and transferring the suspension culture into a 200L fermentation tank after culturing for 60-84 h;

the cell is at least one of CHO cell and HEK293F cell;

when the cells are CHO cells, the culture medium is ProCHO5 culture medium of Lonza company;

when the CELLs are HEK293F CELLs, the culture medium is EX-CELL 293 serum-free culture medium manufactured by Sigma company;

the stable expression cells with high expression level are cultured for 15 to 18 days on a large scale, the cell survival rate is 80 percent, and the cell density is 1.0 to 3.0 multiplied by 10⁷ Per mL;

(3) isolating said exosomes from the cell culture supernatant.

2. The method for producing a protein-entrapped exosome according to claim 1, characterized in that:

the separation is to separate the exosome from the cell culture supernatant by an ultracentrifugation method or an exosome extraction kit.

3. The method for preparing protein-entrapped exosomes according to claim 2, wherein the ultracentrifugation method comprises the following specific steps:

(1) centrifuging 300g of cell culture supernatant for 10min, centrifuging 2000g of cell culture supernatant for 10-20 min, and discarding the precipitate to obtain a first supernatant so as to remove cells;

(2) centrifuging the first supernatant at 10000g for 30min, discarding the precipitate, and collecting the second supernatant to remove subcellular components;

(3) centrifuging 100000g of the second supernatant for 70-90 min, discarding the supernatant, and reserving the first precipitate;

(4) re-suspending the first precipitate obtained in the step (3) by using a PBS solution, uniformly mixing, centrifuging for 70-90 min by 100000g to wash off soluble protein, and washing the precipitate to obtain the exosome;

the steps (1) to (4) are all carried out at 4 ℃.

Images