CN109321585B - Method for improving mutation breeding efficiency of prokaryotic microorganisms by using T4 deoxyribonucleic acid ligase - Google Patents

Abstract

The invention discloses a method for improving mutation breeding efficiency of prokaryotic microorganisms by using T4 deoxyribonucleic acid ligase, which is characterized in that T4 deoxyribonucleic acid ligase is heterogeneously expressed in prokaryotic microorganism cells to be mutagenized by constructing plasmids; treating the prokaryotic microorganism strains to be mutagenized by utilizing a normal-pressure room-temperature plasma mutagenesis technology; the treatment and culture of the mutagenic strain are realized. Experiments prove that the survival rate of host bacteria subjected to double-strand break mutagenesis treatment can be remarkably improved and the mutation efficiency can be improved under the condition that T4DNA Ligase is over-expressed in prokaryotic microorganisms such as escherichia coli, lactobacillus plantarum and pseudomonas putida. The T4DNA Ligase is suggested to have application prospect in the aspect of prokaryotic microorganism mutation breeding.

Description

Method for improving mutation breeding efficiency of prokaryotic microorganisms by using T4 deoxyribonucleic acid ligase

Technical Field

The invention relates to a method for improving mutation breeding efficiency of prokaryotic microorganisms, in particular to a method for improving mutation breeding efficiency of prokaryotic microorganisms by using T4 deoxyribonucleic acid ligase, and specifically relates to a method for improving mutation breeding efficiency of a plasma mutation instrument on prokaryotic cells by using T4 deoxyribonucleic acid ligase to repair deoxyribonucleic acid double-strand breaks of prokaryotic cell genomes. Belongs to the field of microorganism mutation breeding and prokaryotic organism gene repair.

Background

The abundant microbial resources in nature are more and more widely applied in the fields of industry, energy, food, medicine and the like. The properties of microbial strains are crucial for their industrial production. Naturally obtained strains are improved to obtain strains more suitable for industrialization. Because the mutation frequency of the microorganism is lower, the mutation breeding technology of the microorganism is widely applied to obtain strains with better properties more quickly. Commonly used mutagenesis methods include chemical mutagenesis and physical mutagenesis. Mutagens act on the genetic material deoxyribonucleic acid of a microorganism to cause a change in its chemical structure, thereby causing genetic variation of the microorganism.

Studies have shown that as the mutagen dose is increased, the average mutation rate of living cells increases to a maximum and then remains stable or decreases. Excessive genetic material deoxyribonucleic acid damage exceeds the ability to repair cells within a mechanism and is lethal to the cells. In the case of mutagenic breeding of microorganisms, the lethality of the treated microorganisms is always more than 90%. Each cell forms a candidate mutant, but only living cells are able to participate in the mutation library. The maximization of the capacity of the mutant library is not favored because the higher average mutation rate of the cells in the library is pursued by increasing the mutagen dose, while the contradiction of the reduction of the number of living cells is encountered. Therefore, there is a need for improved methods to improve the survival rate and mutation rate of bacterial cells under mutagenesis conditions, and further to accelerate the progress of microbial mutation breeding.

The normal pressure room temperature plasma (ARTP) mutagenesis technology is an efficient mutagenesis technology developed by the research team of the New society of the New chen of the Qinghua university based on the principle of Atmospheric pressure injection frequency glow discharge. The technology takes inert gas helium as working gas, discharges electricity in a high-frequency electric field to generate plasma rich in high-energy chemical activity, generates multiple damages (including double strand break of deoxyribonucleic acid caused by active oxygen and peroxide and the like) to bacterial strains/plant cells, induces biological cells to start an SOS high fault-tolerant rate repair mechanism to generate mismatched site forming mutant strains, and accordingly introduces mutation. The applicant found that ARTP mutagenesis is an important lethal factor for prokaryotic cells, and plasma generated active oxygen or peroxide can generate deoxyribonucleic acid Double Strand Breaks (DSBs) on the genome, and most prokaryotic cells can not repair the DSBs in time and die.

There are two main approaches to the intracellular repair of DSBs: homologous Recombination (HR) and non-homologous end joining (NHEJ). The HR repair pathway is only functional at specific cellular stages because it needs to rely on homologous templates. In contrast, NHEJ does not require a homologous template, but rather directly links the two ends of the break. However, the repair pathway for NHEJ is not present in most prokaryotic cells (e.g., e.coli, lactic acid bacteria, etc.). Therefore, most of the time, DSBs produced on the genome are lethal to e.coli, lactic acid bacteria, etc.

There are reports: through the NEHJ repair system of Mycobacterium tuberculosis (Mycobacterium tuberculosis H37Rv), which consists of two parts of Ku (deoxyribonucleic acid end protection protein) and LigD (deoxyribonucleic acid connexin), is expressed in escherichia coli cells in a heterologous way, and deoxyribonucleic acid with double-strand breaks in cells is successfully repaired without a homologous template.

T4 deoxyribonucleic acid ligase derived from bacteriophage T4 of enterobacter is widely applied to molecular operations such as molecular biological in vitro molecular cloning and the like. T4DNA ligase catalyzes the ligation of blunt ends or complementary cohesive ends of double-stranded DNA under the action of ATP cofactor. However, there are few reports on the use of T4DNA ligase in vivo. Through search, no patent is reported about a method for improving the mutation breeding efficiency of prokaryotic microorganisms by using T4 deoxyribonucleic acid ligase.

Disclosure of Invention

Aiming at the contradiction between mutation rate and death rate in the current microorganism mutation breeding process, the invention aims to provide a method for improving the mutation breeding efficiency of prokaryotic microorganisms by using T4 deoxyribonucleic acid ligase.

The invention relates to a method for improving mutation breeding efficiency of prokaryotic microorganisms by using T4 deoxyribonucleic acid ligase, which comprises the following steps:

a. heterogeneously expressing T4DNA ligase in prokaryotic microbial cells to be mutagenized by constructing plasmids;

b. treating the prokaryotic microorganism strains to be mutagenized by utilizing a normal-pressure room-temperature plasma mutagenesis technology;

c. treating and culturing a mutagenic strain;

the method is characterized in that:

step a said T4DNA ligase is an ATP dependent DNA ligase from Enterobacter phage T4; the method for heterogeneously expressing T4DNA ligase in the prokaryotic microbial cells to be mutagenized is as follows: amplifying a T4 deoxyribonucleic acid ligase coding gene by utilizing a PCR reaction, cloning the coding gene to an expression vector of a target prokaryotic microorganism strain to realize heterologous expression in cells, repairing genome deoxyribonucleic acid double-strand breaks in the cells in a non-homologous end connection mode after the coding gene is expressed, and forming deoxyribonucleic acid base deletion with random length at a repaired position;

the mutagenesis condition and method of the plasma mutagenic apparatus in the normal-pressure room-temperature plasma mutagenesis technology in the step b are as follows: washing the strain to be mutagenized in logarithmic growth phase with sterile normal saline, and diluting to bacterial liquid OD₆₀₀1.0, then dripping the solution on a slide glass, placing the slide glass on a position 1-2 mm away from an airflow port on a plasma mutagenic apparatus, setting the power of the apparatus to be 100W, setting the airflow to be 10SLM, and carrying out irradiation;

the method for processing and culturing the mutagenic strain in the step c comprises the following steps: immediately placing the glass slide into 1mL of physiological saline for vortex oscillation after the plasma mutagenizing instrument irradiates to obtain a thallus cleaning solution, then coating the thallus cleaning solution on a solid culture medium plate containing spectinomycin, carrying out constant temperature overnight culture, counting the number of single colonies on the plate, and calculating the thallus survival rate.

In the method for improving the mutation breeding efficiency of the prokaryotic microorganisms by using the T4 deoxyribonucleic acid ligase: the prokaryotic microorganism is preferably Escherichia coli, Pseudomonas putida or Lactobacillus plantarum.

In the method for improving the mutation breeding efficiency of the prokaryotic microorganisms by using the T4 deoxyribonucleic acid ligase: when the T4DNA ligase is heterogeneously expressed in prokaryotic microbial cells to be mutagenized by constructing a plasmid, the T4DNA ligase is expressed in Escherichia coli (Escherichia coli) through a plasmid pUCLR 4-T4; expressed in Pseudomonas putida (Pseudomonas putida) by plasmid pBBR-T4; expressed in Lactobacillus plantarum (Lactobacillus plantarum) by plasmid pE-T4.

In the method for improving the mutation breeding efficiency of the prokaryotic microorganisms by using the T4 deoxyribonucleic acid ligase: the T4DNA ligase in step a repairs genomic DNA double strand breaks in cells by non-homologous end joining means that T4DNA ligase does not require homologous template sequences to repair genomic DNA double strand breaks in cells.

In the method for improving the mutation breeding efficiency of the prokaryotic microorganisms by using the T4 deoxyribonucleic acid ligase: the step a of forming random length deoxyribonucleic acid base deletion at the repair site refers to that 1 base pair to 100000 base pairs of deletion is caused at the fracture repair site.

The invention improves the repair of deoxyribonucleic acid double-strand break of the prokaryotic microorganism genome, thereby improving the survival rate in the mutagenesis process of the microorganism and accelerating the genetic mutagenesis process of the prokaryotic microorganism. The T4DNA ligase selected by the invention can repair double-strand breaks of deoxyribonucleic acid (including exogenous deoxyribonucleic acid and genome deoxyribonucleic acid) in prokaryotic cells under the condition of no homologous template. This is a repair pathway (NHEJ) similar to non-homologous end-linking.

Experiments prove that the in vivo expression of T4DNA ligase can improve the survival rate of Escherichia coli, Lactobacillus plantarum, Pseudomonas putida and the like under ARTP ionizing radiation. After the T4DNA Ligase is expressed, the survival rate of the Escherichia coli (Escherichia coli) treated by a plasma mutagen is improved by 27 times; the survival rate of the mutagenic Pseudomonas putida (Pseudomonas putida) is improved by 7 times, and the survival rate of the Lactobacillus plantarum (Lactobacillus plantarum) is improved by 4 times.

After the applicant expresses T4 deoxyribonucleic acid ligase in Poly-beta-hydroxybutyrate (PHB) production strain E.coli XLPBB, a large number of mutants are obtained through one ARTP treatment, and the screened mutants have obvious change in the PHB yield. The highest PHB content was increased 112% over the control strain and reached 53.87. + -. 1.11% w/w of the dry cell weight. The method disclosed by the invention improves the survival rate of the microorganism through the ARTP mutagenesis effect, and is beneficial to obtaining a strain with better performance, thereby accelerating the process of the microorganism genetic mutagenesis.

Drawings

FIG. 1 shows the structure of plasmid pUCLR 4.

FIG. 2 is a schematic diagram of the plasmid structure

Wherein: A. a schematic structure diagram of a plasmid pUCLR 4-T4; B. schematic structure of plasmid pUCLR 4-Ku-LigD.

FIG. 3T 4DNA ligase in vivo repair of Linear plasmid DNA

Wherein: coli MG1655 carries a blank vector; coli MG1655 expresses T4 deoxyribonucleic acid Ligase; coli MG1655 expresses the Ku-LigD NHEJ-system.

FIG. 4T 4DNA ligase repair Cas9 induced genome double strand break (CFU-colony forming unit/mL)

Wherein: coli MG1655 does not express deoxyribonucleic acid ligase; coli MG1655 expresses T4 deoxyribonucleic acid Ligase; coli MG1655 expresses the Ku-LigD NHEJ-system.

FIG. 5T 4DNA ligase enhanced survival of prokaryotic microorganisms treated with ARTP (CFU-colony forming unit/mL)

Wherein: A. coli E.coli MG1655ARTP treatment lethality curve

B. L.plantarum ARTP treatment lethal curve of lactobacillus plantarum

C. Pseudomonas putida ARTP treatment lethality curve.

FIG. 6E. coli XLPBH lethality curve (CFU-colony forming unit/mL) under ARTP irradiation.

FIG. 7 PHB fermentation characteristics of the mutant strain obtained after ARTP mutagenesis.

Detailed Description

General description:

the bacterial strain used in the example Eschrichichia coli MG1655, its genome sequence number is NC-000913.2; the genome sequence number of Mycobacterium tuberculosis H37Rv is NC-000962.3; t4 Enterobacter phage with the genome sequence number NC-000866.4; the genome sequence number of Pseudomonas putida is NC-002947.4; the Lactobacillus plantarum genome sequence number is NC-004567.2.

The Tiangen plasmid miniprep kit, agarose gel DNA recovery kit, used in the examples was purchased from Tiangen Biochemical technology (Beijing) Ltd, and Taq PrimeStar was purchased from TAKARA; restriction enzymes EcoR I, HindIII, EcoR I from Fermentas; plasmids pUC19, pwtCas9, pE, pSC101, p15A were purchased from Addgene; plasmid pACYCDue-1 was purchased from Novagen.

Example 1T 4DNA ligase repair of DNA double strand breaks in vivo

(1) Construction of T4DNA ligase expression plasmid

A pUC Ori fragment was PCR-amplified using the following primers using plasmid pUC19 as a template.

Ori-F：5'-GCTAGCACAATACCTAGGACTGAGCTAGCTGTCAAAGGCGGTAATACGGTTATCCACA-3'

Ori-R：5'-ACGCTCTCCACTGAGCGTCAGACCCCGTAG-3'，

PCR was performed to amplify the pLtet promoter fragment using the following primers, using plasmid pwtCas9 as a template.

pLtet-F：5'-CTTAAGACCCACTTTCACATTTAAG-3'

pLtet-R：5'-GACGTCTCCCTAGGTATAAACGCAG-3'

The LR4gRNA and spectinomycin resistance gene (Spc) were PCR amplified using the following primers using plasmid p15A-L4 as a template.

gRNA Spc-F：5'-ACTAGTTGAGACCAGTCTCGGAAG-3'

gRNA Spc-R：5'-ACGCTCTCCATAAGCCTGTTCGGTTCGTAAGC-3'

The PCR product was purified back and assembled into a pUCLR4 plasmid using the Gibson method (FIG. 1).

The Gibson assembly reaction system is as follows: (30. mu.L)

2 XGibson reaction solution 15. mu.L

Equimolar T4DNA ligase fragment and pUCLR4 vector backbone fragment

Adding deionized water to the final reaction system to 30 mu L

The metal bath is carried out for 1h at 50 ℃.

PCR was performed using the genome of the Enterobacter phage T4 as a template using the following primers to amplify the T4 deoxyribonuclease gene.

T4-F:5'-CTGACGCTCAGTGGAGAGCGTGCTTTCATAGACCAGTTACCTCATG

T4-R:5'-CAGTCCTAGGTATTGTGCTAGCGTTAGAACCACGTACCACAGG

The plasmid constructed above, pUCLR4, was used as a template, and the following primers were used to amplify a plasmid backbone fragment by PCR.

T4(ori ter)-F:5’-CTGACGCTCAGTGGAGAGCGTGCTTTCATAGACCAGTTACCTCATG-3’ori(ter)-R:5’-AATGTGAAAGTGGGTCTTAAGCACTGAGCGTCAGACCCCGTA-3’

The two fragments were isolated and purified by gel recovery and then assembled into plasmid pUCLR4-T4 using Gibson's system (FIG. 2).

The ku and ligD genes were PCR-amplified using the following primers, respectively, using the Mycobacterium tuberculosis H37Rv (NC-000962.3) genome as a template.

ku-F:5'-GAACAGGCTTATGGAGAGCGTTCACGGAGGCGTTGGGA-3’

ku-R:5'-CAGTCCTAGGTATTGTGCTAGCACTAGTATTAAAGAGGAGAATACTAGATGCG-3’

ligD-F:5'-GTCTGACGCTCAGTGGAGAGCGTTCATTCGCGCACCACCTCAC TG-3’

ligD-R:5'-CAGTCCTAGGTATTGTGCTAGCCTAGAGAAAGAGGAGAAATACTAGATGG-3’

Using pUCLR4 as a template, a pUCLR4 plasmid backbone was amplified by PCR using the following primers.

Ku Spc-F:

5’-AGGCCAACTCAAACGTCCCAACGCCTCCGTGAACGCTCTCCATAAGCCTGTTCGGTT-3’

LigD Ori-R:

5’-TAGCACAATACCTAGGACTGAGCTAGCTGTCAAAGGCGGTAATACGGTTATCCACA-3’

The three DNA fragments were recovered, separated and purified by gel, and then assembled by the Gibson method to construct plasmid pUCLR 4-LigD-Ku.

(2) T4DNA ligase in vivo repair enzyme digestion linear plasmid

Plasmid pACYCDue-1 was extracted using the TIANGEN plasmid mini-extract kit and digested with restriction enzymes EcoR I, Hind III, EcoR I and Hpa I for 30min at 37 ℃ in a warm bath. The digested product was detected on agarose gel electrophoresis and the linear DNA fragments were recovered. The linear DNA fragment was transferred into a strain expressing T4DNA ligase by electrotransformation, and transformants were selected by plating on chloramphenicol resistant plates. Linear deoxyribonucleic acid cannot be reproduced and passaged in cells. T4DNA ligase successfully repairs linear DNA to obtain circularized plasmid which confers chloramphenicol resistance to transformants. Therefore, the survival rate by chloramphenicol screening reflects the efficiency of ligase ligation to repair linear deoxyribonucleic acid in vivo.

The results show that T4DNA ligase can repair linear DNA with sticky ends (EcoR I, Hind III and EcoR I cleavage products) and blunt ends (Hpa I cleavage products) in prokaryotic microorganisms. Meanwhile, the repair efficiency is higher than that of the non-homologous end recombination system Ku-LigD (figure 3) derived from Mycobacterium tuberculosis. The application prospect of the T4DNA ligase in the DNA repair of prokaryotic microorganisms is predicted.

Example 2 in vivo repair of genomic double-strand breaks by T4DNA ligase

Using Cas9 and sgRNA LR 4: GTTCCCACGGAGAATCCGAC cause a site-directed deoxyribonucleic acid double strand break at the lacZ site of the E.coli MG1655 genome.

(1) Expression plasmid construction of Csa9 protein

The plasmid backbone comprising the low copy replicon pSC101ori and the chloramphenicol resistance gene was PCR amplified using the following primers with plasmid pCas9(TS) as template.

pSC101ori(Cas9)-F：5'-CGTTTATACCTAGGGAGACGTCTACCAGCAGTCGGA TACCTTC-3’pSC101ori(pLtet)-R：5'-TAAATGTGAAAGTGGGTCTTAAGGGATAATCCGAAGTGGTCAG-3’

The cas9 gene and the tetracycline-inducible promoter pLtet were amplified by PCR using plasmid pwtCas9(Addge plasma #42876) as a template and the following primers.

pLtet Cas9-F：5'-CTTAAGACCCACTTTCACATTTAAG-3’

pLtet Cas9-R：5'-GACGTCTCCCTAGGTATAAACGCAG-3’

After the above PCR products were purified, the plasmid pSC101Cas9(Ts) was assembled using the Gibson reaction method.

(2) T4DNA ligase repair genome DSBs

The pSC101Cas9(Ts) plasmid was transformed into e.coli MG1655 strains harboring pUCLR4, pUCLR4-T4 and pUCLR4-Ku-LigD plasmids, respectively, to obtain recombinant e.coli strains. Each single colony of the above-mentioned strain was inoculated into 5mL of LB medium and cultured overnight at 30 ℃ with shaking at 220 rpm. Fresh 50mL LB medium was inoculated at 2% inoculum size and cultured at 30 ℃ for 1h with shaking at 220 rpm. Addition of the inducer anhydrotetracycline initiates expression of sgRNA and Cas9 for 2 h. 100 mu L of bacterial liquid is taken, diluted in a gradient way and respectively coated on LB solid medium plates containing chloramphenicol, spectinomycin and X-gal, and the culture is carried out for 12h at the constant temperature of 30 ℃. Wherein the white colony is a cell which is inactivated by introducing mutation after genome deoxyribonucleic acid double-strand break repair so as to inactivate LacZ. The number of white single Colonies (CFU) grown on the plates was counted to evaluate the repair efficiency of the introduced chromosomal DSB.

The results show that expression of CRISPR-Cas9 and LR4gRNA targeting the chromosomal lacZ gene can kill host cells efficiently. While expression of T4DNA ligase increased host cell viability by an order of magnitude and the repair efficiency was 5-fold higher than that of the NHEJ Ku-LigD system (FIG. 4).

Example 3T 4DNA ligase-mediated in vivo DNA repair improves survival-coupled mutagenesis efficiency

(1) Expression of T4DNA ligase in P.putida

Using the plasmid pUCLRT4 as a template, the T4DNA ligase gene was PCR-amplified using the following primers and cloned between HindIII and KpnI sites of the pBBR1MCS-2 vector to obtain the vector pBBR-T4.

T4HindⅢ-F：CCCAAGCTTGAGAGCGTGCTTTCATAGACCAGTT

T4KpnI-R：CGGGGTACCTTGACAGCTAGCTCAGTCCTAGGTA

(2) Expression of T4DNA ligase in Lactobacillus plantarum

The T4DNA ligase gene was amplified using the following primers using plasmid pUCLRT4 as a template.

T4pE-F：AAAGCAATTACTGATACGTTACCACCGCTGCGTTCGGTC

T4pE-R：TTCTGCTCCCGCCCTTAGCTCACATGTTCTTTCCTGCGT

The vector backbone was amplified by PCR using pE vector as template and the following primers.

pE T4-F：5’-GAAAGAACATGTGAGCTAAGGGCGGGAGCAGAATGTCCG-3’

pE T4-R：5’-CGCAGCGGTGGTAACGTATCAGTAATTGCTTTATCAACT-3’

The two fragments were assembled by Gibson assembly to obtain vector pET 4.

(3) ARTP mutagenesis method

Activating E.coli MG1655, L.plantarum and P.putida S16 strains with different genetic backgrounds, culturing to logarithmic phase, collecting thallus, washing with normal saline three times, and treating each bacterial liquid OD₆₀₀Dilute to 1.0. 10 mu L of the treated bacteria are dropped on a slide glass, the slide glass is placed at the position 2mm away from an air flow port on an ARTP instrument, the instrument power (100W) and the air flow (10SLM) are set, and the specific time is irradiated. Then, the slide was washed with 1mL of physiological saline, and vortexed to obtain cells. 100 μ L of washing solution was applied to a solid plate containing spectinomycin, incubated overnight at a constant temperature, and the number of single colonies on the plate was counted.

The results show (fig. 5) that ARTP has a lethal effect on cells, and the survival rate after treatment with e.coli MG1655, l.plantarum and p.putida S16 ARTP decreases with ARTP treatment time. Among the three different bacterial species, the expression of T4DNA ligase can significantly improve the survival rate of cells under ARTP irradiation. That is, the expression of T4DNA ligase can obtain larger mutant library after the same ARTP irradiation time, thereby improving the mutagenesis efficiency.

Example 4 use of T4DNA ligase mediated in vivo repair of DSBs in microbial metabolic engineering

Poly-beta-hydroxybutyrate (PHB) is a traditional plastic substitute material which is biodegradable and environment-friendly. Coli genome integrates PHB biosynthetic gene operon derived from Ralstonia eutropha, and the obtained strain E.

(1) Coli XLPHB cells treated with ARTP had a lethality curve similar to the trend described above for e.coli MG1655a strain, with a decrease in viable cell number with increasing ARTP treatment time. However, the expression of T4DNA ligase in E.coli XLPBb increased the survival rate of host cells under ARTP irradiation by 5-6 fold (FIG. 6).

(2) Fermentation experiments

Randomly obtaining 10 mutants treated by ARTP to carry out PHB fermentation experiments. The single colony of interest was inoculated into 5mL of LB medium and cultured overnight at 37 ℃ with shaking at 220 rpm. The culture was transferred to a new LB liquid medium at an inoculum size of 4%, and glucose as a carbon source was added to a final concentration of 30 g/L. Fermentation was carried out at 37 ℃ and 220rpm for 48 hours with shaking. The fermentation broth cells were collected and freeze-dried for 12 hours. 10-20mg (mx) of the lyophilized cells were weighed, followed by the sequential addition of 150. mu.L of concentrated sulfuric acid, 850. mu.L of methanol and 1mL of chloroform. 100-oil bath for 1 hour. 1mL of distilled water was added to the reaction system. Mixing vigorously and standing for more than 5 h. Collecting organic phase layer sample and analyzing PHB content m (PHB)/mx by gas chromatography. Total PHB production was calculated as m (PHB) Mx/Mx.

The fermentation results show (FIG. 7) that the initial strain E.coli XLPB positively has PHB of 25.36. + -. 2.82% w/w of the cell dry weight. Mutants obtained by ARTP treatment varied significantly in PHB content. Wherein the highest PHB content was increased by 112% compared to the control strain and reached 53.87 + -1.11% w/w of the dry cell weight.

(3) GENEWIZ resequencing analyses the mutation types.

Selecting two mutants of PHB-6 and PHB-10 with increased and decreased PHB accumulation respectively, and obtaining the genomic deoxyribonucleic acid by using a Tiangen bacterium genomic deoxyribonucleic acid extraction kit. Single Nucleotide Variants (SNV), insertions and deletions (INDEL) and Structural variants (Structural Variation) were analyzed by GENEWIZ for re-sequencing with the genome of E.coli MG1655 (https:// www.ncbi.nlm.nih.gov/nuccore/NC-000913.3) as a reference.

The results showed that fragment deletion and Single Nucleotide Variation (SNV) occurred in the genomic deoxyribonucleic acid of the strain after the ARTP mutagenesis treatment (see Table 1).

Table 1: mutation results of PHB-6 and PHB-10 strain genome complete sequencing

Wherein, the mutant PHB-6 introduces 13bp deletion in an open reading frame of a yieK gene and causes the inactivation of 6-phosphogluconolactonase. Inactivation of 6-phosphogluconolactonase may result in the accumulation of 6-phosphogluconolactone, which is a product of glucose-6-phosphate oxidation and increases the supply of glucose-6-phosphate for glycolysis. Correspondingly, the PHB content increased from 25.36. + -. 2.82% w/w to 39.47. + -. 1.00%. Therefore, yieK is a new target that is currently unknown to increase carbon flux in the glycolytic pathway. In another sequenced mutant PHB-10, a 65bp deletion present in the ORF of the ilvB gene was found, encoding the acetolactate synthase I subunit. In addition, in this mutant, there was a deletion of 1 base between the two ArcA-regulated repression sites upstream of the sdhC promoter. Mutations at this site may interfere with the transcription of succinate dehydrogenase, the major component of the respiratory chain. Resulting in very low cell growth (2.72. + -. 0.49g/L) and low PHB accumulation (1.95. + -. 0.14% w/w) for this mutant. This indicates that T4SM not only enhances survival of host cells by mediating chromosomal DSB repair, but also accumulates other types of mutations by introducing randomly sized deletions during mutagenesis.

Claims (1)

1. A method for improving the mutation breeding efficiency of prokaryotic microorganisms by using T4 deoxyribonucleic acid ligase comprises the following steps:

a. heterogeneously expressing T4DNA ligase in prokaryotic microbial cells to be mutagenized by constructing plasmids;

wherein: the T4DNA ligase is an ATP dependent DNA ligase derived from Enterobacter phage T4; the method for heterogeneously expressing T4DNA ligase in the prokaryotic microbial cells to be mutagenized is as follows: amplifying a T4 deoxyribonucleic acid ligase coding gene by utilizing a PCR reaction, cloning the coding gene to an expression vector of a target prokaryotic microorganism strain to realize heterologous expression in cells, repairing genome deoxyribonucleic acid double-strand breaks in the cells in a non-homologous end connection mode after the coding gene is expressed, and forming deoxyribonucleic acid base deletion with random length at a repaired position; the prokaryotic microorganism is Escherichia coli (E.coli)Escherichia coli ) Pseudomonas putida (b)Pseudomonas putida ) Or Lactobacillus plantarum: (Lactobacillus plantarum )；

b. Treating the prokaryotic microorganism strains to be mutagenized by utilizing a normal-pressure room-temperature plasma mutagenesis technology;

c. treating and culturing a mutagenic strain;

the method is characterized in that:

the mutagenesis condition and method of the plasma mutagenic apparatus in the normal-pressure room-temperature plasma mutagenesis technology in the step b are as follows: washing the strain to be mutagenized in logarithmic growth phase with sterile normal saline, and diluting to bacterial liquid OD₆₀₀1.0, then dripping the solution on a slide glass, placing the slide glass on a position 1-2 mm away from an airflow port on a plasma mutagenic apparatus, setting the power of the apparatus to be 100W, setting the airflow to be 10SLM, and carrying out irradiation;

the method for processing and culturing the mutagenic strain in the step c comprises the following steps: immediately placing the glass slide into 1mL of physiological saline for vortex oscillation after the plasma mutagenizing instrument irradiates to obtain a thallus cleaning solution, then coating the thallus cleaning solution on a solid culture medium plate containing spectinomycin, carrying out constant temperature overnight culture, counting the number of single colonies on the plate, and calculating the thallus survival rate.

Images