CN109320602B - Siglec-9 targeted chimeric antigen receptor T cell and application thereof - Google Patents

Abstract

The invention relates to a Siglec-9 targeted chimeric antigen receptor T cell and application thereof, and particularly provides a Siglec-9 extracellular segment protein, a CAR expressing a targeted MUC1 and an engineered immune cell. The engineered immune cells of the invention can selectively kill tumor cells from high MUC1 expressing malignant tumors.

Description

Siglec-9 targeted chimeric antigen receptor T cell and application thereof

Technical Field

The invention relates to the field of immunotherapy, in particular to a Siglec-9 targeted chimeric antigen receptor T cell and application thereof.

Background

Chimeric antigen receptor T cell therapy (CAR-T therapy), which is the most fierce cellular immunotherapy in the world at present, modifies T cell receptors to make T cells specifically recognize and kill tumor cells, has already good clinical therapeutic effects on acute lymphoblastic leukemia and non-hodgkin lymphoma, but still faces huge challenges when the therapeutic effects on solid tumors are not satisfactory.

There is therefore an urgent need in the art to develop a chimeric antigen receptor T cell having a significant killing effect on malignant solid tumors.

Disclosure of Invention

The invention aims to provide a chimeric antigen receptor T cell with a remarkable killing effect on malignant solid tumors.

The invention provides a Siglec-9 extracellular segment protein in a first aspect, wherein the extracellular segment protein is selected from the group consisting of:

(a) 1 amino acid sequence of the protein as shown in SEQ ID NO;

(b) 1, a protein which is formed by substituting, deleting or adding one or more (such as 1-10) amino acid residues in the amino acid sequence of SEQ ID NO, has the functions of the protein (a) and is derived from the protein (a); or

(c) And (b) a protein derived from (a) and having more than 90% (preferably more than or equal to 95%) homology with the protein sequence defined by (a) and having the protein function of (a).

In another preferred embodiment, the Siglec-9 extracellular domain protein targets or binds to human MUC1 protein.

In a second aspect, the invention provides a Chimeric Antigen Receptor (CAR) comprising a Siglec-9 extracellular domain protein according to the first aspect of the invention.

In another preferred embodiment, the Chimeric Antigen Receptor (CAR) comprises from N-terminus to C-terminus:

(i) the Siglec-9 extracellular domain protein of claim 1;

(ii) (ii) a transmembrane domain which is capable of,

(iii) at least one co-stimulatory domain, and

(iv) the activation domain.

In another preferred embodiment, the CAR has the structure shown in formula I below:

L-T-H-TM-C-CD3ζ (I)

in the formula (I), the compound is shown in the specification,

l is an optional signal peptide sequence;

t is the Siglec-9 extracellular domain protein of claim 1;

h is a null or hinge region;

TM is a transmembrane domain;

c is a costimulatory signal molecule;

CD3 ζ is the cytoplasmic signaling sequence derived from CD3 ζ.

And in each of the above formulae, each "-" is independently a linker peptide or a peptide bond.

In another preferred embodiment, the nucleotide sequence encoding the Siglec-9 extracellular segment protein is selected from the group consisting of:

(a) the polynucleotide with the nucleotide sequence shown in SEQ ID NO. 2;

(b) polynucleotide having homology of more than or equal to 70% (preferably more than or equal to 80%, > 90%, > 95% or more than or equal to 98%) with the sequence shown in SEQ ID NO. 2 and having activity of targeting or binding to human MUC1 protein;

(c) the polynucleotide which is truncated by 1-60 (preferably 1-30, more preferably 1-6) nucleotides at the 5 'end and/or 3' end of the polynucleotide shown in SEQ ID NO. 4 and has the activity of targeting or binding to the human MUC1 protein.

In another preferred embodiment, the Siglec-9 extracellular domain protein is of human origin.

In another preferred embodiment, L is a signal peptide of a protein selected from the group consisting of: CD8, CD28, GM-CSF, CD4, CD137, or a combination thereof.

In another preferred embodiment, said H is a hinge region of a protein selected from the group consisting of: CD8, CD28, CD137, or a combination thereof.

In another preferred embodiment, the TM is a transmembrane region of a protein selected from the group consisting of: CD28, CD3epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, CTLA-4, PD-1, LAG-3, 2B4, BTLA, or a combination thereof.

In another preferred embodiment, the TM comprises a CD 8-derived transmembrane region.

In another preferred embodiment, C is a costimulatory signal molecule for a protein selected from the group consisting of: OX40, CD2, CD7, CD27, CD28, CD30, CD40, CD70, CD134, 4-1BB (CD137), PD1, Dap10, CDS, ICAM-1, LFA-1(CD11a/CD18), ICOS (CD278), NKG2D, GITR, TLR2, or a combination thereof.

In another preferred embodiment, the C comprises a co-stimulatory signaling molecule from 4-1 BB.

In another preferred embodiment, the amino acid sequence of the CAR is as shown in SEQ ID No. 3.

In a third aspect, the present invention provides a recombinant protein, said recombinant protein comprising:

(i) the Siglec-9 extracellular domain protein of the first aspect of the invention; and

(ii) optionally a tag sequence to facilitate expression and/or purification.

In another preferred embodiment, the tag sequence comprises a 6His tag.

In another preferred embodiment, the recombinant protein (or polypeptide) comprises a fusion protein.

In another preferred embodiment, the recombinant protein is a monomer, dimer, or multimer.

In a fourth aspect, the present invention provides a drug conjugate, comprising:

(a) the Siglec-9 extracellular domain protein of the first aspect of the invention; and

(b) a coupling moiety coupled to the extracellular domain protein moiety, the coupling moiety selected from the group consisting of: a detectable label, a drug, a toxin, a cytokine, a radionuclide, an enzyme, or a combination thereof.

In another preferred embodiment, the extracellular segment protein moiety is coupled to the coupling moiety via a chemical bond or a linker.

In a fifth aspect, the invention provides a nucleic acid molecule encoding a Siglec-9 extracellular domain protein according to the first aspect of the invention, a Chimeric Antigen Receptor (CAR) according to the second aspect of the invention, a recombinant protein according to the third aspect of the invention, or a drug conjugate according to the fourth aspect of the invention.

In another preferred embodiment, the nucleic acid molecule encoding the Chimeric Antigen Receptor (CAR) according to the second aspect of the invention is as set forth in SEQ ID No.:4, respectively.

In a sixth aspect, the invention provides a vector comprising a nucleic acid molecule according to the fifth aspect of the invention.

In another preferred embodiment, the carrier is selected from the group consisting of: DNA, RNA, plasmids, lentiviral vectors, adenoviral vectors, retroviral vectors, transposons, or combinations thereof.

In another preferred embodiment, the vector is a lentiviral vector.

In a seventh aspect, the invention provides a host cell comprising a vector or chromosome of the sixth aspect of the invention into which has been integrated an exogenous nucleic acid molecule of the fifth aspect of the invention.

In another preferred embodiment, the cell is an isolated cell, and/or the cell is a genetically engineered cell.

In another preferred embodiment, the cell is a mammalian cell.

In another preferred embodiment, the cell is a T cell.

In another preferred embodiment, the host cell comprises an engineered immune cell.

In another preferred embodiment, the engineered immune cells comprise T cells or NK cells.

In another preferred embodiment, the engineered immune cell is selected from the group consisting of:

(i) chimeric antigen receptor T cells (CAR-T cells);

(ii) chimeric antigen receptor NK cells (CAR-NK cells); or

(iii) Exogenous T Cell Receptor (TCR) T cells (TCR-T cells).

In another preferred embodiment, the immune cells are autologous.

In another preferred embodiment, the immune cells are non-autologous.

In an eighth aspect, the invention provides a method of making an engineered immune cell expressing a CAR according to the second aspect of the invention, wherein the method comprises the steps of: transducing the nucleic acid molecule of the fifth aspect of the invention or the vector of the sixth aspect of the invention into an immune cell, thereby obtaining the engineered immune cell.

In another preferred embodiment, the introducing includes introducing simultaneously, sequentially, or sequentially.

In another preferred embodiment, the immune cell is a T cell or NK cell.

In another preferred embodiment, the method further comprises the step of performing functional and effective detection on the obtained engineered immune cells.

In a ninth aspect, the present invention provides a pharmaceutical composition comprising a Siglec-9 extracellular domain protein according to the first aspect of the present invention, a CAR according to the second aspect of the present invention, a recombinant protein according to the third aspect of the present invention, a drug conjugate according to the fourth aspect of the present invention, a nucleic acid molecule according to the fifth aspect of the present invention, a vector according to the sixth aspect of the present invention, or a host cell according to the seventh aspect of the present invention, and a pharmaceutically acceptable carrier, diluent or excipient.

In another preferred embodiment, the pharmaceutical composition is a liquid formulation.

In another preferred embodiment, the dosage form of the pharmaceutical composition is an injection.

In another preferred embodiment, the host cell comprises an engineered immune cell.

In another preferred embodiment, the engineered immune cell is (i) a chimeric antigen receptor T cell (CAR-T cell); or (ii) a chimeric antigen receptor NK cell (CAR-NK cell).

In another preferred embodiment, the concentration of the cells in the pharmaceutical composition is 1 × 10³-1×10⁸Individual cells/ml, preferably 1X 10⁴-1×10⁷Individual cells/ml.

In another preferred embodiment, the pharmaceutical composition further comprises other drugs that selectively kill tumor cells (such as emerging antibody drugs, other CAR-T drugs, or chemotherapeutic drugs).

The tenth aspect of the present invention provides a use of the Siglec-9 extracellular segment protein of the first aspect of the present invention, the CAR of the second aspect of the present invention, the recombinant protein of the third aspect of the present invention, the drug conjugate of the fourth aspect of the present invention, the nucleic acid molecule of the fifth aspect of the present invention, the vector of the sixth aspect of the present invention, the host cell of the seventh aspect of the present invention, or the pharmaceutical composition of the ninth aspect of the present invention, for preparing a drug or a preparation for selectively killing tumor cells.

In another preferred embodiment, the tumor cell is derived from a malignant solid tumor.

In another preferred embodiment, the malignant solid tumor is selected from the group consisting of: breast cancer, pancreatic cancer, colon cancer, gastric cancer, lung cancer, renal cell carcinoma, liver cancer, ovarian cancer, esophageal adenocarcinoma, cholangiocarcinoma, prostate cancer, cervical cancer, multiple sarcoma, or a combination thereof.

In an eleventh aspect, the invention provides a kit for selectively killing a tumor cell, the kit comprising a container, and in the container, a CAR of the second aspect of the invention, a recombinant protein of the third aspect of the invention, a drug conjugate of the fourth aspect of the invention, a nucleic acid molecule of the fifth aspect of the invention, a vector of the sixth aspect of the invention, or a host cell of the seventh aspect of the invention.

In another preferred embodiment, the kit further comprises a label or instructions for use.

In a twelfth aspect, the present invention provides a method for selectively killing tumor cells, comprising:

administering to a subject in need of treatment a safe and effective amount of a host cell according to the seventh aspect of the invention, or a pharmaceutical composition according to the ninth aspect of the invention.

In another preferred embodiment, the subject comprises a human or non-human mammal.

In another preferred embodiment, the non-human mammal includes a rodent (e.g., mouse, rat, rabbit), primate (e.g., monkey).

In another preferred embodiment, the method is non-therapeutic and non-diagnostic.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 shows a schematic diagram of the pCDH-exSiglec-9-CAR2-IRES-zsGREEN vector structure.

FIG. 2 shows a vector map of pCDH-exSiglec-9-CAR 2-IRES-zsGREEN.

FIG. 3 shows the results of the restriction enzyme digestion of pCDH-exSiglec-9-CAR2-IRES-zsGREEN recombinant vector and pCDH vector.

Fig. 4 shows the results of killing efficiency of Jurkat-exSiglec-9 on target cell Panc-1 at different effective target ratios (E: T ═ 1:1, 2:1,5:1,10:1,20: 1). After being stained by the eFluor 670, the target cell PANC-1 is cocultured with effector cells, an FL4 channel is selected on a flow cytometer to detect the eFluor 670, and all cells which are positive to the eFluor 670 are circled; after the eFluor 670 positive cycle, selecting an FL2 channel to carry out Anexin-V staining detection, wherein cells with positive Anexin-V staining are apoptosis target cells. According to the flow results, the killing efficiency of Jurkat-pCDH and Jurkat-exSiglec-9 on pancreatic cancer cells PANC-1 was calculated.

Detailed Description

The inventor of the present invention has extensively and deeply studied, and unexpectedly found an engineered immune cell specifically targeting MUC1, which can specifically and selectively kill tumor cells from malignant solid tumors, and has a significant killing effect. On this basis, the present inventors have completed the present invention.

The present invention is representatively illustrated in detail for the engineered immune cells of the present invention, taking CAR-T cells as an example. The engineered immune cells of the invention are not limited to the CAR-T cells described above and below, and the engineered immune cells of the invention have the same or similar technical features and benefits as the CAR-T cells described above and below. Specifically, when the immune cell expresses the chimeric antigen receptor CAR, the NK cell is identical to a T cell (or a T cell can replace an NK cell); when the immune cell is a T cell, the TCR is identical to the CAR (or the CAR can be replaced with a TCR).

Term(s) for

In order that the disclosure may be more readily understood, certain terms are first defined. As used in this application, each of the following terms shall have the meaning given below, unless explicitly specified otherwise herein. Other definitions are set forth throughout the application.

The term "about" can refer to a value or composition that is within an acceptable error range for the particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined.

By "endogenous" is meant that the nucleic acid molecule or polypeptide is normally expressed in a cell or tissue.

By "exogenous" is meant that the nucleic acid molecule or polypeptide is not endogenously present in the cell or is not present at a level sufficient to achieve the functional effect obtained upon overexpression. Thus, the term "exogenous" includes any recombinant nucleic acid molecule or polypeptide that is expressed in a cell, e.g., exogenous, heterologous, and overexpressed nucleic acid molecules and polypeptides.

MUC1

MUC1 is a macromolecular transmembrane protein with a molecular weight of 300kDa to 600 kDa. MUC1 is first transcribed and synthesized on the ribosome as a single polypeptide chain and then self-cleaved into two parts, MUC1-N and MUC1-C, respectively, which are capable of forming stable, non-covalently linked heterodimers at the membrane site.

A great deal of research of the invention finds that MUC1 has abnormally enhanced expression on the surfaces of various malignant solid tumors such as breast cancer, pancreatic cancer, colon cancer, gastric cancer and other cancer cells, is more than 10 times of the expression of normal tissues, and is accompanied with structural change. The conformational change of the core protein of MUC1 exposes a new protein epitope and a new active site to distinguish from normal tissues, and further, the immune system recognizes and activates an immune response, so MUC1 can be used as a potential target for CAR-T therapy to treat solid tumors.

Siglec-9 extracellular segment protein

The invention unexpectedly discovers that the specific Siglec-9 extracellular domain protein can be specifically combined with MUC 1.

Siglec-9 is a member of the sialic acid binding immunoglobulin family, belongs to a single transmembrane protein, and is mainly expressed on the surface of immune cells, such as neutrophils, monocytes, NK cells, lymphocyte subsets and the like. Siglec-9 is composed of an extracellular region containing a V-region recognizing sialic acid (SIA) at the N-terminus and two C-terminal immunoglobulin-like domains, a transmembrane region and an intracellular region containing an immunotyrosine inhibitory motif (ITIM) which, upon tyrosine phosphorylation, recruits inhibitory phosphatases such as Src homology region 2, including tyrosine phosphatase 1(SHP-1), SHP-2, and mediates downstream tyrosine kinase phosphorylation, thereby delivering inhibitory or lethal signals into the cell. The current research shows that the Siglec-9 extracellular segment can be combined with MUC1 protein highly expressed on the surfaces of various tumor cells. Therefore, the design of the CAR-T cell taking the extracellular segment (exSiglec-9) of Siglec-9 as a target has great significance in killing various malignant tumor cells with high MUC1 protein expression on the surface.

The invention constructs a chimeric antigen receptor T cell taking a Siglec-9 extracellular segment as a target, and the extracellular segment of the Siglec-9 is connected with a CD8 transmembrane region, a co-stimulatory factor 4-1BB and an intracellular signal activation sequence CD3zeta to construct a structure of a second-generation CAR, which is used for treating a solid tumor highly expressing MUC1 protein.

In a preferred embodiment of the invention, the amino acid sequence of the Siglec-9 extracellular domain protein of the invention is shown in SEQ ID No. 1:

MLLLLLPLLWGRERAEGQTSKLLTMQSSVTVQEGLCVHVPCSFSYPSHGWIYPGPVVHGYWFREGANTDQDAPVATNNPARAVWEETRDRFHLLGDPHTKNCTLSIRDARRSDAGRYFFRMEKGSIKWNYKHHRLSVNVTALTHRPNILIPGTLESGCPQNLTCSVPWACEQGTPPMISWIGTSVSPLDPSTTRSSVLTLIPQPQDHGTSLTCQVTFPGASVTTNKTVHLNVSYPPQNLTMTVFQGDGT are provided. The nucleotide sequence for encoding the Siglec-9 extracellular domain protein is shown in SEQ ID No. 2.

Chimeric Antigen Receptor (CAR)

Chimeric immune antigen receptors (CARs) consist of an extracellular antigen recognition region, usually a scFv (single-chain variable fragment), a transmembrane region, and an intracellular costimulatory signal region. The design of CARs goes through the following process: the first generation CARs had only one intracellular signaling component, CD3 ζ or Fc γ RI molecule, and due to the single intracellular activation domain, it caused only transient T cell proliferation and less cytokine secretion, and did not provide long-term T cell proliferation signaling and sustained in vivo anti-tumor effects, and thus did not achieve good clinical efficacy. The second generation CARs introduce a costimulatory molecule such as CD28, 4-1BB, OX40 and ICOS on the basis of the original structure, and compared with the first generation CARs, the function of the second generation CARs is greatly improved, and the persistence of CAR-T cells and the killing capability of the CAR-T cells on tumor cells are further enhanced. On the basis of the second generation CARs, a plurality of novel immune co-stimulatory molecules such as CD27 and CD134 are connected in series, and the development is three-generation and four-generation CARs.

The extracellular domain of CARs recognizes a specific antigen and subsequently transduces this signal through the intracellular domain, causing activated proliferation, cytolytic toxicity and cytokine secretion of the cell, thereby clearing the target cell. Autologous cells from the patient (or a heterologous donor) are first isolated, activated and genetically engineered to produce immune cells for CAR production, and then injected into the same patient. In this way, the probability of graft versus host disease is very low and antigens are recognized by immune cells in a non-MHC restricted manner.

CAR-immune cell therapy has achieved very high clinical response rates in the treatment of hematological malignancies, which rates were previously unattainable by any therapeutic approach, and have triggered a hot surge of clinical research in the world.

Specifically, the Chimeric Antigen Receptors (CARs) of the invention include an extracellular domain, a transmembrane domain, and an intracellular domain. The extracellular domain includes a target-specific binding member (also referred to as an antigen-binding domain). The intracellular domain includes a costimulatory signaling region and/or a zeta chain moiety. The costimulatory signaling region refers to a portion of the intracellular domain that includes the costimulatory molecule. Costimulatory molecules are cell surface molecules required for efficient response of lymphocytes to antigens, rather than antigen receptors or their ligands.

A linker may be incorporated between the extracellular domain and the transmembrane domain of the CAR, or between the cytoplasmic domain and the transmembrane domain of the CAR. As used herein, the term "linker" generally refers to any oligopeptide or polypeptide that functions to link a transmembrane domain to an extracellular domain or a cytoplasmic domain of a polypeptide chain. The linker may comprise 0-300 amino acids, preferably 2 to 100 amino acids and most preferably 3 to 50 amino acids.

The CARs of the invention, when expressed in T cells, are capable of antigen recognition based on antigen binding specificity. When it binds its associated antigen, it affects the tumor cells, causing the tumor cells to not grow, to be driven to death, or to otherwise be affected, and causing the patient's tumor burden to shrink or be eliminated. The antigen binding domain is preferably fused to an intracellular domain from one or more of the costimulatory molecules and/or the zeta chain. Preferably, the antigen binding domain is fused to the intracellular domain of the 4-1BB signaling domain and/or the CD3zeta signaling domain combination.

As used herein, "antigen binding domain" and "single chain antibody fragment" each refer to an Fab fragment, Fab 'fragment, F (ab') 2 fragment, or single Fv fragment having antigen binding activity. Fv antibodies contain the variable regions of the antibody heavy chain, the variable regions of the light chain, but no constant regions, and have the smallest antibody fragment of the entire antigen binding site. Generally, Fv antibodies also comprise a polypeptide linker between the VH and VL domains and are capable of forming the structures required for antigen binding. The antigen binding domain is typically a scFv (single-chain variable fragment). The size of the scFv is typically 1/6 for a whole antibody. Single chain antibodies are preferably a sequence of amino acids encoded by a single nucleotide chain. In a preferred embodiment of the invention, the scFv comprises an antibody, preferably a single chain antibody, that specifically recognizes the tumor highly expressed antigens CD47 and MSLN.

In the present invention, the scFv of the present invention also includes conservative variants thereof, which means that at most 10, preferably at most 8, more preferably at most 5, and most preferably at most 3 amino acids are replaced with amino acids having similar or similar properties as compared with the amino acid sequence of the scFv of the present invention to form a polypeptide.

In the present invention, the number of amino acids to be added, deleted, modified and/or substituted is preferably not more than 40%, more preferably not more than 35%, more preferably 1 to 33%, more preferably 5 to 30%, more preferably 10 to 25%, more preferably 15 to 20% of the total number of amino acids in the original amino acid sequence.

In the present invention, the number of the amino acids to be added, deleted, modified and/or substituted is usually 1,2, 3, 4 or 5, preferably 1 to 3, more preferably 1 to 2, and most preferably 1.

For the hinge region and transmembrane region (transmembrane domain), the CAR can be designed to include a transmembrane domain fused to the extracellular domain of the CAR. In one embodiment, a transmembrane domain that is naturally associated with one of the domains in the CAR is used. In some examples, the transmembrane domains may be selected, or modified by amino acid substitutions, to avoid binding such domains to the transmembrane domains of the same or different surface membrane proteins, thereby minimizing interaction with other members of the receptor complex.

The extracellular domain of the CAR of the invention includes a Siglec-9 extracellular stretch protein, preferably a Siglec-9 extracellular stretch protein having a specific sequence.

In the present invention, the intracellular domains in the CAR of the invention include the transmembrane region of CD8, the costimulatory factor of 4-1BB, and the signaling domain of CD3 zeta.

In a preferred embodiment of the invention, the amino acid sequence of the CAR is as shown in SEQ ID No. 3.

MLLLLLPLLWGRERAEGQTSKLLTMQSSVTVQEGLCVHVPCSFSYPSHGWIYPGPVVHGYWFREGANTDQDAPVATNNPARAVWEETRDRFHLLGDPHTKNCTLSIRDARRSDAGRYFFRMEKGSIKWNYKHHRLSVNVTALTHRPNILIPGTLESGCPQNLTCSVPWACEQGTPPMISWIGTSVSPLDPSTTRSSVLTLIPQPQDHGTSLTCQVTFPGASVTTNKTVHLNVSYPPQNLTMTVFQGDGTDKPKLFSMKRGEVYIPSISTVLGNGSSLSLPEGQSLRLVCAVDAVDSNPPARLSLSWRGLTLCPSQPSNPGVLELPWVHLRDAAEFTCRAQNPLGSQQVYLNVSLQSKATSGVTQGTTTPAPRPPTPAPTIASQPLSLRPEACRPAAGGAVHTRGLDFACDIYIWAPLAGTCGVLLLSLVITLYCKRGRKKLLYIFKQPFMRPVQTTQEEDGCSCRFPEEEEGGCELRVKFSRSADAPAYKQGQNQLYNELNLGRREEYDVLDKRRGRDPEMGGKPRRKNPQEGLYNELQKDKMAEAYSEIGMKGERRRGKGHDGLYQGLSTATKDTYDALHMQALPPR(SEQ ID NO.:3)

In a preferred embodiment of the invention, the nucleotide sequence of the CAR is as set forth in SEQ ID No. 4:

ATGCTGCTGCTGCTGCTGCCCCTGCTCTGGGGGAGGGAGAGGGCGGAAGGACAGACAAGTAAACTGCTGACGATGCAGAGTTCCGTGACGGTGCAGGAAGGCCTGTGTGTCCATGTGCCCTGCTCCTTCTCCTACCCCTCGCATGGCTGGATTTACCCTGGCCCAGTAGTTCATGGCTACTGGTTCCGGGAAGGGGCCAATACAGACCAGGATGCTCCAGTGGCCACAAACAACCCAGCTCGGGCAGTGTGGGAGGAGACTCGGGACCGATTCCACCTCCTTGGGGACCCACATACCAAGAATTGCACCCTGAGCATCAGAGATGCCAGAAGAAGTGATGCGGGGAGATACTTCTTTCGTATGGAGAAAGGAAGTATAAAATGGAATTATAAACATCACCGGCTCTCTGTGAATGTGACAGCCTTGACCCACAGGCCCAACATCCTCATCCCAGGCACCCTGGAGTCCGGCTGCCCCCAGAATCTGACCTGCTCTGTGCCCTGGGCCTGTGAGCAGGGGACACCCCCTATGATCTCCTGGATAGGGACCTCCGTGTCCCCCCTGGACCCCTCCACCACCCGCTCCTCGGTGCTCACCCTCATCCCACAGCCCCAGGACCATGGCACCAGCCTCACCTGTCAGGTGACCTTCCCTGGGGCCAGCGTGACCACGAACAAGACCGTCCATCTCAACGTGTCCTACCCGCCTCAGAACTTGACCATGACTGTCTTCCAAGGAGACGGCACAGATAAGCCCAAACTGTTCTCGATGAAGCGGGGAGAAGTTTACATTCCCAGCATATCCACAGTCTTGGGAAATGGCTCATCTCTGTCACTCCCAGAGGGCCAGTCTCTGCGCCTGGTCTGTGCAGTTGATGCAGTTGACAGCAATCCCCCTGCCAGGCTGAGCCTGAGCTGGAGAGGCCTGACCCTGTGCCCCTCACAGCCCTCAAACCCGGGGGTGCTGGAGCTGCCTTGGGTGCACCTGAGGGATGCAGCTGAATTCACCTGCAGAGCTCAGAACCCTCTCGGCTCTCAGCAGGTCTACCTGAACGTCTCCCTGCAGAGCAAAGCCACATCAGGAGTGACTCAGGGGACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCACAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACACGAGGGGGCTGGACTTCGCCTGTGATATCTACATCTGGGCGCCCTTGGCCGGGACTTGTGGGGTCCTTCTCCTGTCACTGGTTATCACCCTTTACTGCAAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAGAAGGAGGATGTGAACTGAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACAAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGC(SEQ ID NO.:4)。

chimeric antigen receptor T cells (CAR-T cells)

As used herein, the terms "CAR-T cell", "CAR-T cell of the invention" all refer to a CAR-T cell according to the sixth aspect of the invention, which can target MUC1 protein, for the treatment of tumors with high expression of MUC1, in particular malignant solid tumors.

CAR-T cells have the following advantages over other T cell-based therapies: (1) the action process of the CAR-T cell is not limited by MHC; (2) given that many tumor cells express the same tumor antigen, CAR gene construction for a certain tumor antigen can be widely utilized once it is completed; (3) the CAR can utilize tumor protein antigens and glycolipid non-protein antigens, so that the target range of the tumor antigens is expanded; (4) the use of patient autologous cells reduces the risk of rejection; (5) the CAR-T cell has an immunological memory function and can survive in vivo for a long time.

In the present invention, the CAR of the invention comprises (i) an extracellular domain comprising a Siglec-9 extracellular domain protein; (ii) a transmembrane domain; (iii) a co-stimulatory factor; and (iv) the signaling domain of CD3 ζ.

Chimeric antigen receptor NK cells (CAR-NK cells)

As used herein, the terms "CAR-NK cell", "CAR-NK cell of the invention" all refer to a CAR-NK cell according to the first aspect of the invention. The CAR-NK cell can target MUC1 protein and is used for treating MUC1 high-expression tumors, particularly malignant solid tumors.

Natural Killer (NK) cells are a major class of immune effector cells that protect the body from viral infection and tumor cell invasion through non-antigen specific pathways. By engineering (genetically modifying) NK cells it is possible to obtain new functions, including the ability to specifically recognize tumor antigens and having an enhanced anti-tumor cytotoxic effect.

CAR-NK cells also have the following advantages compared to autologous CAR-T cells, for example: (1) directly kills tumor cells by releasing perforin and granzyme, but has no killing effect on normal cells of an organism; (2) they release very small amounts of cytokines thereby reducing the risk of cytokine storm; (3) is easy to be amplified in vitro and can be developed into ready-made products. Otherwise, similar to CAR-T cell therapy.

Exogenous T cell antigen receptor

As used herein, a foreign T cell antigen receptor (TCR) is a TCR that is exogenously transferred into a T cell by means of genetic engineering, using lentivirus or retrovirus as a vector, by cloning the α chain and β chain of the TCR from a tumor-reactive T cell by gene transfer technique.

The exogenous TCR modified T cell can specifically recognize and kill tumor cells, and affinity of the T cell and tumor can be improved and anti-tumor effect can be improved by optimizing affinity of TCR and tumor specific antigen.

Carrier

Nucleic acid sequences encoding the desired molecule can be obtained using recombinant methods known in the art, such as, for example, by screening libraries from cells expressing the gene, by obtaining the gene from vectors known to include the gene, or by direct isolation from cells and tissues containing the gene using standard techniques. Alternatively, the gene of interest may be produced synthetically.

The present invention also provides a vector into which the expression cassette of the present invention is inserted. Vectors derived from retroviruses such as lentiviruses are suitable tools for achieving long-term gene transfer, since they allow long-term, stable integration of the transgene and its propagation in daughter cells. Lentiviral vectors have advantages over vectors derived from oncogenic retroviruses such as murine leukemia virus, in that they can transduce non-proliferating cells such as hepatocytes. They also have the advantage of low immunogenicity.

In brief summary, an expression cassette or nucleic acid sequence of the invention is typically operably linked to a promoter and incorporated into an expression vector. The vector is suitable for replication and integration into eukaryotic cells. Typical cloning vectors contain transcriptional and translational terminators, initiation sequences, and promoters that may be used to regulate the expression of the desired nucleic acid sequence.

The expression constructs of the invention may also be used for nucleic acid immunization and gene therapy using standard gene delivery protocols. Methods of gene delivery are known in the art. See, for example, U.S. Pat. nos. 5,399,346, 5,580,859, 5,589,466, which are incorporated herein by reference in their entirety. In another embodiment, the invention provides a gene therapy vector.

The nucleic acid can be cloned into many types of vectors. For example, the nucleic acid can be cloned into vectors including, but not limited to, plasmids, phagemids, phage derivatives, animal viruses, and cosmids. Specific vectors of interest include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.

Further, the expression vector may be provided to the cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and other virology and Molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. Generally, suitable vectors comprise an origin of replication, a promoter sequence, a convenient restriction enzyme site, and one or more selectable markers that function in at least one organism (e.g., WO 01/96584; WO 01/29058; and U.S. Pat. No. 6,326,193).

Many virus-based systems have been developed for gene transfer into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. The selected gene can be inserted into a vector and packaged into a retroviral particle using techniques known in the art. The recombinant virus can then be isolated and delivered to the subject cells in vivo or ex vivo. Many retroviral systems are known in the art. In some embodiments, an adenoviral vector is used. Many adenoviral vectors are known in the art. In one embodiment, a lentiviral vector is used.

Additional promoter elements, such as enhancers, may regulate the frequency of transcription initiation. Typically, these are located in the 30-110bp region upstream of the start site, although many promoters have recently been shown to also contain functional elements downstream of the start site. The spacing between promoter elements is often flexible so that promoter function is maintained when the elements are inverted or moved relative to one another. In the thymidine kinase (tk) promoter, the spacing between promoter elements can be increased by 50bp apart, and activity begins to decline. Depending on the promoter, it appears that the individual elements may function cooperatively or independently to initiate transcription.

An example of a suitable promoter is the immediate early Cytomegalovirus (CMV) promoter sequence. The promoter sequence is a strong constitutive promoter sequence capable of driving high level expression of any polynucleotide sequence operably linked thereto. Another example of a suitable promoter is elongation growth factor-1 α (EF-1 α). However, other constitutive promoter sequences may also be used, including, but not limited to, the simian virus 40(SV40) early promoter, the mouse mammary cancer virus (MMTV), the Human Immunodeficiency Virus (HIV) Long Terminal Repeat (LTR) promoter, the MoMuLV promoter, the avian leukemia virus promoter, the Epstein-Barr (Epstein-Barr) virus immediate early promoter, the rous sarcoma virus promoter, and human gene promoters such as, but not limited to, the actin promoter, myosin promoter, heme promoter, and creatine kinase promoter. Further, the present invention should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the invention. The use of an inducible promoter provides a molecular switch that is capable of turning on expression of a polynucleotide sequence operably linked to the inducible promoter when such expression is desired, or turning off expression when expression is not desired. Examples of inducible promoters include, but are not limited to, the metallothionein promoter, the glucocorticoid promoter, the progesterone promoter, and the tetracycline promoter.

To assess the expression of the CAR polypeptide or portion thereof, the expression vector introduced into the cells can also comprise either or both of a selectable marker gene or a reporter gene to facilitate identification and selection of expressing cells from a population of cells sought to be transfected or infected by the viral vector. In other aspects, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both the selectable marker and the reporter gene may be flanked by appropriate regulatory sequences to enable expression in a host cell. Useful selectable markers include, for example, antibiotic resistance genes, such as neo and the like.

Reporter genes are used to identify potentially transfected cells and to evaluate the functionality of regulatory sequences. Typically, the reporter gene is the following: which is not present in or expressed by the recipient organism or tissue and which encodes a polypeptide whose expression is clearly indicated by some readily detectable property, such as enzymatic activity. After the DNA has been introduced into the recipient cell, the expression of the reporter gene is assayed at an appropriate time. Suitable reporter genes may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or green fluorescent protein (e.g., Ui-Tei et al, 2000FEBS Letters479: 79-82). Suitable expression systems are well known and can be prepared using known techniques or obtained commercially. Generally, the construct with the minimum of 5 flanking regions showing the highest level of reporter gene expression was identified as the promoter. Such promoter regions can be linked to reporter genes and used to evaluate the ability of an agent to modulate promoter-driven transcription.

Methods for introducing and expressing genes into cells are known in the art. In the context of expression vectors, the vector may be readily introduced into a host cell by any method known in the art, e.g., mammalian, bacterial, yeast or insect cells. For example, the expression vector may be transferred into a host cell by physical, chemical or biological means.

Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for producing cells comprising vectors and/or exogenous nucleic acids are well known in the art. See, e.g., Sambrook et al (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York). A preferred method for introducing the polynucleotide into a host cell is calcium phosphate transfection.

Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, particularly retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human, cells. Other viral vectors may be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, adeno-associated viruses, and the like. See, for example, U.S. patent nos. 5,350,674 and 5,585,362.

Chemical means of introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads; and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. Exemplary colloidal systems for use as delivery vehicles in vitro and in vivo are liposomes (e.g., artificial membrane vesicles).

In the case of non-viral delivery systems, an exemplary delivery vehicle is a liposome. Lipid formulations are contemplated for use to introduce nucleic acids into host cells (ex vivo or in vivo). In another aspect, the nucleic acid can be associated with a lipid. The nucleic acid associated with the lipid may be encapsulated in the aqueous interior of the liposome, dispersed within the lipid bilayer of the liposome, attached to the liposome via a linker molecule associated with both the liposome and the oligonucleotide, entrapped in the liposome, complexed with the liposome, dispersed in a solution comprising the lipid, mixed with the lipid, associated with the lipid, contained as a suspension in the lipid, contained in or complexed with a micelle, or otherwise associated with the lipid. The lipid, lipid/DNA or lipid/expression vector associated with the composition is not limited to any particular structure in solution. For example, they may be present in a bilayer structure, either as micelles or with a "collapsed" structure. They may also simply be dispersed in a solution, possibly forming aggregates that are not uniform in size or shape. Lipids are fatty substances, which may be naturally occurring or synthetic lipids. For example, lipids include fatty droplets that occur naturally in the cytoplasm as well as such compounds that contain long-chain aliphatic hydrocarbons and their derivatives such as fatty acids, alcohols, amines, amino alcohols, and aldehydes.

In a preferred embodiment of the invention, the vector is a lentiviral vector.

Preparation

The invention provides a CAR according to the second aspect of the invention, a nucleic acid molecule according to the third aspect of the invention, a vector according to the fourth aspect of the invention, or an engineered immune cell according to the sixth aspect of the invention, and a pharmaceutically acceptable carrier, diluent or excipient. In one embodiment, the formulation is a liquid formulation. Preferably, the formulation is an injection. Preferably, the CAR-T cells are present in the formulation at a concentration of 1X 10³-1×10⁸One cell/Kg body weight, more preferably 1X 10⁴-1×10⁷One cell/Kg body weight.

In one embodiment, the formulation may include buffers such as neutral buffered saline, sulfate buffered saline, and the like; carbohydrates such as glucose, mannose, sucrose or dextran, mannitol; a protein; polypeptides or amino acids such as glycine; an antioxidant; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and a preservative. The formulations of the present invention are preferably formulated for intravenous administration.

Therapeutic applications

The invention includes therapeutic applications of cells (e.g., T cells) transduced with Lentiviral Vectors (LV) encoding expression cassettes of the invention. The transduced T cells can target a marker MUC1 protein of tumor cells, and synergistically activate the T cells to cause cellular immune response, so that the killing efficiency of the T cells on tumor cells from malignant tumors is remarkably improved.

Accordingly, the present invention also provides a method of stimulating a T cell-mediated immune response to a target cell population or tissue of a mammal comprising the steps of: administering to the mammal the CAR-T cells of the invention.

In one embodiment, the invention includes a class of cell therapy in which autologous T cells (or allogeneic donors) from a patient are isolated, activated, genetically engineered to produce CAR-T cells, and subsequently injected into the same patient. In this way, the probability of graft versus host disease is very low and antigens are recognized by T cells in an MHC-unrestricted manner. Furthermore, one CAR-T can treat all cancers expressing this antigen. Unlike antibody therapy, CAR-T cells are able to replicate in vivo, resulting in long-term persistence that can lead to sustained tumor control.

In one embodiment, the CAR-T cells of the invention can undergo robust in vivo T cell expansion and can last for an extended amount of time. In addition, the CAR-mediated immune response can be part of an adoptive immunotherapy step, wherein the CAR-modified T cell induces an immune response specific to the antigen binding domain in the CAR. For example, CAR-T cells of MUC1 elicit a specific immune response against cells expressing MUC 1.

Although the data disclosed herein specifically disclose lentiviral vectors comprising the extracellular stretch protein, hinge and transmembrane regions, and 4-1BB and CD3zeta signaling domains of Siglec-9 against MUC1, the invention should be construed to include any number of variations to each of the construct components.

Treatable cancers include tumors that are not vascularized or have not substantially vascularized, as well as vascularized tumors. The cancer may comprise a non-solid tumor (such as a hematological tumor, e.g., leukemia and lymphoma) or may comprise a solid tumor. The types of cancer treated with the CARs of the invention include, but are not limited to, carcinomas, blastomas and sarcomas, and certain leukemias or lymphoid malignancies, benign and malignant tumors, such as sarcomas, carcinomas and melanomas. Adult tumors/cancers and pediatric tumors/cancers are also included.

Hematologic cancers are cancers of the blood or bone marrow. Examples of hematologic (or hematological) cancers include leukemias, including acute leukemias (such as acute lymphocytic leukemia, acute myelogenous leukemia and myeloblastic, promyelocytic, granulo-monocytic, monocytic and erythrocytic leukemias), chronic leukemias (such as chronic myelogenous (granulocytic) leukemia, chronic myelogenous leukemia and chronic lymphocytic leukemia), polycythemia vera, lymphoma, hodgkin's disease, non-hodgkin's lymphoma (indolent and higher forms), multiple myeloma, waldenstrom's macroglobulinemia, heavy chain disease, myelodysplastic syndrome, hairy cell leukemia and myelodysplasia.

A solid tumor is an abnormal mass of tissue that generally does not contain cysts or fluid regions. Solid tumors can be benign or malignant. Different types of solid tumors are named for the type of cells that form them (such as sarcomas, carcinomas, and lymphomas). Examples of solid tumors such as sarcomas and carcinomas include fibrosarcoma, myxosarcoma, liposarcoma mesothelioma, lymphoid malignancies, pancreatic cancer, ovarian cancer.

The CAR-modified T cells of the invention may also be used as a type of vaccine for ex vivo immunization and/or in vivo therapy of mammals. Preferably, the mammal is a human.

For ex vivo immunization, at least one of the following occurs in vitro prior to administration of the cells into a mammal: i) expanding the cell, ii) introducing a nucleic acid encoding the CAR into the cell, and/or iii) cryopreserving the cell.

Ex vivo procedures are well known in the art and are discussed more fully below. Briefly, cells are isolated from a mammal (preferably a human) and genetically modified (i.e., transduced or transfected in vitro) with a vector expressing a CAR disclosed herein. The CAR-modified cells can be administered to a mammalian recipient to provide a therapeutic benefit. The mammalian recipient can be a human, and the CAR-modified cells can be autologous with respect to the recipient. Alternatively, the cells may be allogeneic, syngeneic (syngeneic), or xenogeneic with respect to the recipient.

In addition to using cell-based vaccines for ex vivo immunization, the present invention also provides compositions and methods for in vivo immunization to elicit an immune response against an antigen in a patient.

The invention provides a method of treating a tumor comprising administering to a subject in need thereof a therapeutically effective amount of a CAR-modified T cell of the invention.

The CAR-modified T cells of the invention can be administered alone or as a pharmaceutical composition in combination with diluents and/or with other components or other cytokines or cell populations. Briefly, a pharmaceutical composition of the invention may comprise a target cell population as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may include buffers such as neutral buffered saline, sulfate buffered saline, and the like; carbohydrates such as glucose, mannose, sucrose or dextran, mannitol; a protein; polypeptides or amino acids such as glycine; an antioxidant; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and a preservative. The compositions of the present invention are preferably formulated for intravenous administration.

The pharmaceutical compositions of the present invention may be administered in a manner suitable for the disease to be treated (or prevented). The number and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease-although the appropriate dosage may be determined by clinical trials.

When it is stated that "is immunologically effectiveAmount "," anti-tumor effective amount "," tumor-inhibiting effective amount "or" therapeutic amount ", the precise amount of the composition of the invention to be administered can be determined by a physician, taking into account the age, weight, tumor size, extent of infection or metastasis and individual differences in the condition of the patient (subject). It can be generally pointed out that: pharmaceutical compositions comprising T cells described herein can be in the range of 10⁴To 10⁹Dosage of individual cells/kg body weight, preferably 10⁵To 10⁶Doses of individual cells per kg body weight (including all integer values within those ranges) were administered. The T cell composition may also be administered multiple times at these doses. Cells can be administered by using infusion techniques well known in immunotherapy (see, e.g., Rosenberg et al, New Eng.J.of Med.319:1676, 1988). Optimal dosages and treatment regimens for a particular patient can be readily determined by those skilled in the medical arts by monitoring the patient for signs of disease and adjusting the treatment accordingly.

Administration of the subject composition may be carried out in any convenient manner, including by spraying, injection, swallowing, infusion, implantation or transplantation. The compositions described herein can be administered to a patient subcutaneously, intradermally, intratumorally, intranodal, intraspinally, intramuscularly, by intravenous (i.v.) injection, or intraperitoneally. In one embodiment, the T cell composition of the invention is administered to a patient by intradermal or subcutaneous injection. In another embodiment, the T cell composition of the invention is preferably administered by i.v. injection. The composition of T cells can be injected directly into the tumor, lymph node or site of infection.

In certain embodiments of the invention, cells activated and expanded using the methods described herein or other methods known in the art for expanding T cells to therapeutic levels are administered to a patient in conjunction with (e.g., prior to, concurrently with, or subsequent to) any number of relevant treatment modalities, including but not limited to treatment with: such as antiviral therapy, cidofovir and interleukin-2, cytarabine (also known as ARA-C) or natalizumab therapy for MS patients or efavirenz therapy for psoriasis patients or other therapy for PML patients. In further embodiments, the T cells of the invention may be used in combination with: chemotherapy, radiation, immunosuppressive agents such as cyclosporine, azathioprine, methotrexate, mycophenolate mofetil, and FK506, antibodies, or other immunotherapeutic agents. In a further embodiment, the cell composition of the invention is administered to the patient in conjunction with (e.g., prior to, concurrently with, or subsequent to) bone marrow transplantation with a chemotherapeutic agent such as fludarabine, external beam radiation therapy (XRT), cyclophosphamide. For example, in one embodiment, the subject may undergo standard treatment with high-dose chemotherapy followed by peripheral blood stem cell transplantation. In some embodiments, after transplantation, the subject receives an injection of the expanded immune cells of the invention. In an additional embodiment, the expanded cells are administered before or after surgery.

The dosage of the above treatments administered to a patient will vary with the precise nature of the condition being treated and the recipient of the treatment. The proportion of doses administered to a human can be effected in accordance with accepted practice in the art. Typically, 1X 10 may be administered per treatment or per course of treatment ⁶1 to 10¹⁰The modified T cells of the invention (e.g., CAR-T20 cells) are administered to a patient, for example, by intravenous infusion.

The main advantages of the invention include:

(1) the engineered immune cells of the invention can specifically target MUC1, thereby selectively killing tumor cells from malignant tumors with high specificity expression of MUC 1.

(2) The invention firstly proposes the targeting of the chimeric antigen receptor T cell by using Siglec-9, and provides a brand new targeting for CAR-T cell therapy.

(3) According to the invention, the extracellular segment sequence of the inhibitory receptor Siglec-9 on the NK cell is used as the extracellular segment of the CAR structure for the first time, and is combined with the tumor cell highly expressing the ligand through the binding force of the receptor and the ligand, so that the binding force is tighter, and the targeted CAR-T cell can kill various tumor cells, and the cost is lower, and the CAR-T cell is safer and efficient.

(4) The invention can be used for treating various cancers with high MUC1 expression, such as breast cancer, pancreatic cancer, colon cancer, gastric cancer, lung cancer, renal cell carcinoma, liver cancer, ovarian cancer, esophageal adenocarcinoma, cholangiocarcinoma, prostatic cancer, cervical cancer, multiple sarcoma and the like, and provides a new method and a new idea for treating various solid tumors.

(5) The Siglec-9 extracellular domain used in the invention is humanized, and the immunogenicity problem of the murine single-chain antibody as a target is overcome.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are by weight.

Unless otherwise specified, materials and reagents used in examples of the present invention are commercially available products.

Example 1 acquisition of Siglec-9 extracellular Gene sequences

The invention screens an extracellular segment gene sequence from the full-length gene sequence of Siglec-9 by a large amount of screening. Designing by SnapGene software, synthesizing primers in the company, amplifying an extracellular segment of Siglec-9 by using cDNA of an NK-92 cell line as a template in an RT-PCR mode, and sequencing an RT-PCR product to obtain a Siglec-9 extracellular segment sequence as follows:

ATGCTGCTGCTGCTGCTGCCCCTGCTCTGGGGGAGGGAGAGGGCGGAAGGACAGACAAGTAAACTGCTGACGATGCAGAGTTCCGTGACGGTGCAGGAAGGCCTGTGTGTCCATGTGCCCTGCTCCTTCTCCTACCCCTCGCATGGCTGGATTTACCCTGGCCCAGTAGTTCATGGCTACTGGTTCCGGGAAGGGGCCAATACAGACCAGGATGCTCCAGTGGCCACAAACAACCCAGCTCGGGCAGTGTGGGAGGAGACTCGGGACCGATTCCACCTCCTTGGGGACCCACATACCAAGAATTGCACCCTGAGCATCAGAGATGCCAGAAGAAGTGATGCGGGGAGATACTTCTTTCGTATGGAGAAAGGAAGTATAAAATGGAATTATAAACATCACCGGCTCTCTGTGAATGTGACAGCCTTGACCCACAGGCCCAACATCCTCATCCCAGGCACCCTGGAGTCCGGCTGCCCCCAGAATCTGACCTGCTCTGTGCCCTGGGCCTGTGAGCAGGGGACACCCCCTATGATCTCCTGGATAGGGACCTCCGTGTCCCCCCTGGACCCCTCCACCACCCGCTCCTCGGTGCTCACCCTCATCCCACAGCCCCAGGACCATGGCACCAGCCTCACCTGTCAGGTGACCTTCCCTGGGGCCAGCGTGACCACGAACAAGACCGTCCATCTCAACGTGTCCTACCCGCCTCAGAACTTGACCATGACTGTCTTCCAAGGAGACGGCACAGATAAGCCCAAACTGTTCTCGATGAAGCGGGGAGAAGTTTACATTCCCAGCATATCCACAGTCTTGGGAAATGGCTCATCTCTGTCACTCCCAGAGGGCCAGTCTCTGCGCCTGGTCTGTGCAGTTGATGCAGTTGACAGCAATCCCCCTGCCAGGCTGAGCCTGAGCTGGAGAGGCCTGACCCTGTGCCCCTCACAGCCCTCAAACCCGGGGGTGCTGGAGCTGCCTTGGGTGCACCTGAGGGATGCAGCTGAATTCACCTGCAGAGCTCAGAACCCTCTCGGCTCTCAGCAGGTCTACCTGAACGTCTCCCTGCAGAGCAAAGCCACATCAGGAGTGACTCAGGGG(SEQ ID NO.:2)

example 2 construction of pCDH-exSiglec-9-CAR2-IRES-zsGREEN vector

The Siglec-9 extracellular domain sequence obtained in example 1 and the second generation CAR sequence (CD8-CD3zeta-4-1BB) that has been constructed in this laboratory were ligated together by means of overlap PCR. The exSIGLEC-9-CAR2 sequence was ligated to the PLVX vector by enzymatic ligation using the fast-cutting enzymes XhoI and XbaI. And then the exSIGLEC-9-CAR2-IRES-zsGREEN sequence on the PLVX-exSiglec-9-CAR2-IRES-zsGREEN vector is connected to the PCDH vector by using BamH I and SalI enzyme digestion.

The specific method comprises the following steps: PLVX-exSiglec-9-CAR2-IRES-zsGREEN vector was first digested with XhoI, XbaI, and the exSiglec-9-CAR2-IRES-zsGREEN fragment was recovered, after which the cohesive ends were filled in with Klenow enzyme, and the phosphorylation was removed with CIP enzyme. The pCDH empty vector was digested with BamHI and Sal I, the large fragment was recovered, the cohesive ends were similarly filled with Klenow enzyme, and phosphorylation was removed with CIP enzyme. The two were then ligated overnight using T4DNA ligase and the pCDH-exSiglec-9-CAR2-IRES-zsGREEN vectors were constructed by blunt end ligation. The block diagram is shown in fig. 1.

The map and the identification result are shown in fig. 2 and 3.

The result shows that the pCDH-exSiglec-9-CAR2-IRES-zsGREEN vector is successfully constructed, and a 1022bp fragment can be cut out from the pCDH-exSiglec-9-CAR2-IRES-zsGREEN vector after EcoRI single enzyme digestion according to the map information. While pCDH is not.

Example 3 viral packaging

Amplification and viral packaging of PCDH and PCDH-exSiglec-9-CAR2-IRES-zsGREEN plasmids

3.1 plasmid transfection

1) Placing the plasmid, PEI and Opti-MEM culture medium at room temperature for 5 min;

2) putting 436 μ l of Opti-MEM into a 1.5ml EP tube, adding 64 μ g of PEI, mixing uniformly, and standing at room temperature for 5 min;

3) taking 12 μ g of vector plasmid PCDH and PCDH-exSiglec-9-CAR2-IRES-zsGREEN, 8 μ g of psPA X2, 4 μ g of pMD2.G, adding Opti-MEM to 500 μ l, standing at room temperature for 5 min;

4) adding the prepared PEI-Opti-MEM solution into the Opti-MEM containing the plasmid, and standing for 20min at room temperature;

5) slowly dropping 1ml of DNA/PEI mixture into a 293T culture dish paved the day before, gently mixing, incubating in an incubator at 37 ℃, replacing fresh culture medium after 6-8h, and putting into the incubator at 37 ℃ for further incubation.

3.2 Virus Collection and concentration

1) After plasmid transfection for 48h, collecting supernatant, adding 10ml of fresh culture medium, continuously culturing for 72h, collecting supernatant again, mixing with the supernatant collected for 48h, and placing in a refrigerator at 4 ℃ for later use;

2) centrifuging at 4 deg.C and 4000g for 10min to remove cell debris;

3) the resulting supernatant was filtered through a 0.45 μm filter;

4) transferring the filtered virus supernatant into an ultracentrifuge tube, centrifuging for 2h at 25000 r, diluting with PBS (1/100) in the volume of the supernatant, repeatedly blowing and transferring into a sealed centrifuge tube for overnight standing at 4 ℃;

5) the virus solution was dispensed to appropriate volumes, stored at-80 ℃ and 200. mu.l virus was titered.

3.3 Virus titre assay

1) Digesting 293T cells, centrifuging, counting, preparing cell suspension with serum-containing medium, and adjusting cell density to 4 × 10⁵Polybrene was added to 12. mu.g/ml per ml, and 0.5ml of cell suspension was added to each well of a 24-well plate;

2) viral supernatants were diluted with whole medium in the following proportions: 1: 3; 1: 9; 1: 27;

3) respectively adding 100 mul of virus stock solution and virus solution diluted according to different proportions into a 24-well plate inoculated with cells;

4) after 16h, the infection supernatant was discarded, and 0.5ml of fresh whole medium was added;

5) after 48 hours, detecting the target gene expression of the infected cells in a flow mode;

6) calculate titer, titer 2 x 10⁵Infection efficiency fold dilution.

The results are as follows: after the virus is collected and concentrated, the titer of lenti-PCDH and lenti-exSiglec-9-CAR2-IRES-zsGREEN two lentiviruses is 1.92 multiplied by 10 respectively by the detection of the titer⁸、1.35×10⁸。

Example 4CAR-T cell preparation

Culturing Jurkat cells, centrifuging and changing the liquid, adding lentivirus Lenti-PCDH and Lenti-PCDH-exSiglec-9-CAR2-IRES-zsGREEN into a culture medium according to the proportion of MOI (molar equivalent to 10: 1) respectively, centrifuging and changing the liquid after 16h, adding a fresh culture medium and continuing culturing to obtain two Jurkat-T cells which are named as Jurkat-PCDH and Jurkat-exSiglec-9 respectively.

The cells were collected for flow detection, and the results showed that the positivity of Jurkat-PCDH and Jurkat-exSiglec-9 JurCAR-T cells was 99.6% and 96.2%, respectively.

Example 5 target cell selection and Selective killing of target cells by Jurkat-ExSiglec-9 cells

5.1 pancreatic cancer cell line PANC-1 (purchased from ATCC in USA) highly expressing MUC1 protein was obtained.

5.2 target cell labeling

Single cell suspension 1X 10 for preparing pancreatic cancer cell strain⁶And/ml. 2ml of PBS was added and washed twice by centrifugation, and the serum was washed off. Resuspend the cells in PBS, adjust the cell density to 2X 10⁶And/ml. Adding equal volume of 10 mu M eFluor 670 reagent, vortexing the cells, and incubating for 10 minutes at 37 ℃ in the dark; adding 4-5 times volume of pre-cooled complete culture medium of 10% serum, and incubating for 5min on ice; complete medium was washed 3 times. Pancreatic cancer cell line PANC-1 is marked with eFluor 670 dye.

5.3 Mixed culture of target cells and Effector cells

The PANC-1 dyed by the eFluor 670 is respectively according to 4 x 10⁴Number of wells inoculated toCulturing the ultra-low adsorption cells in a 48-pore plate;

two Jurkat cells, namely Jurkat-PCDH and Jurkat-exSiglec-9, and Jurkat cells without virus infection are respectively inoculated into target cells PANC-1 according to the effective target ratio of 1:1, 2.5:1, 5:1,10:1 and 20:1, two repeats are arranged in each group, and the liquid is replenished to 200ul in each hole;

placing the culture plate with the mixed cells into an incubator at 37 ℃ for 14 h;

after 14h, all cells in each well were collected, transferred to a flow tube, and incubated with the addition of the flow antibody Anexin-V, and detected on an up-flow cytometer.

5.4 killing efficiency analysis

Selecting an FL4 channel on a flow cytometer to detect the eFluor 670, and trapping all cells positive to the eFluor 670; after the positive circle of the eFluor 670, selecting an FL2 channel to perform Anexin-V staining detection, wherein the cells with positive Anexin-V staining are the apoptosis target cells. From the flow results, the killing efficiency of the two groups of Jurkat-PCDH and Jurkat-exSiglec-9 on pancreatic cancer cells PANC-1 was calculated, as shown in FIG. 4.

FIG. 4 results show that Jurkat-PCDH pairs MUC1⁺The killing result of the PANC-1 cells is similar to that of Jurkat cells, and the killing effect is basically not generated; while Jurkat-exSiglec-9 pairs MUC1⁺The killing effect of the PANC-1 cells is obviously improved compared with that of Jurkat-PCDH and Jurkat cells of two control groups, and can reach 54 percent when the effective target ratio is 20:1, thereby showing very good killing effect.

Discussion of the related Art

CAR-T therapy as a novel cellular immunotherapy provides a new idea for tumor treatment, the CAR-T therapy has been successful in clinical treatment of hematologic tumors, and the first CAR-T drugs for treating B-cell acute lymphoblastic leukemia have been approved by FDA and put on the market. Although the application of CAR-T therapy to the treatment of solid tumors has been somewhat targeted into clinical research, a number of problems and deficiencies remain.

The invention takes the extracellular segment of an immunoglobulin family member Siglec-9 combined by inhibitory receptor sialic acid on NK cells as a target, takes MUC1 as a target spot, and exSigle is obtained through the combination action of the receptor and a ligandc-9-CAR-T cells with MUC1⁺The target cells are tightly combined, thereby playing a role in killing tumors. The invention takes a pancreatic cancer cell strain PANC-1 with high MUC1 expression as an example to verify the killing function of exSiglec-9-CAR-T cells, and the result shows that the CAR-T cells with Siglec-9 extracellular segments as targets have obvious killing effect on tumor cells with MUC1 positive expression compared with a control group, which shows that exSiglec-9⁺The killing effect of the CAR-T cells is obvious.

The invention can be used for treating various cancers with high MUC1 expression, such as breast cancer, pancreatic cancer, colon cancer, gastric cancer, lung cancer, renal cell carcinoma, liver cancer, ovarian cancer, esophageal adenocarcinoma, cholangiocarcinoma, prostatic cancer, cervical cancer, multiple sarcoma and the like, and provides a new method and a new idea for treating various solid tumors.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> university of east China

Shanghai Bangyao Biological Technology Co.,Ltd.

<120> Siglec-9 targeted chimeric antigen receptor T cell and application thereof

<130> P2018-0745

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 249

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 1

Met Leu Leu Leu Leu Leu Pro Leu Leu Trp Gly Arg Glu Arg Ala Glu

1 5 10 15

Gly Gln Thr Ser Lys Leu Leu Thr Met Gln Ser Ser Val Thr Val Gln

20 25 30

Glu Gly Leu Cys Val His Val Pro Cys Ser Phe Ser Tyr Pro Ser His

35 40 45

Gly Trp Ile Tyr Pro Gly Pro Val Val His Gly Tyr Trp Phe Arg Glu

50 55 60

Gly Ala Asn Thr Asp Gln Asp Ala Pro Val Ala Thr Asn Asn Pro Ala

65 70 75 80

Arg Ala Val Trp Glu Glu Thr Arg Asp Arg Phe His Leu Leu Gly Asp

85 90 95

Pro His Thr Lys Asn Cys Thr Leu Ser Ile Arg Asp Ala Arg Arg Ser

100 105 110

Asp Ala Gly Arg Tyr Phe Phe Arg Met Glu Lys Gly Ser Ile Lys Trp

115 120 125

Asn Tyr Lys His His Arg Leu Ser Val Asn Val Thr Ala Leu Thr His

130 135 140

Arg Pro Asn Ile Leu Ile Pro Gly Thr Leu Glu Ser Gly Cys Pro Gln

145 150 155 160

Asn Leu Thr Cys Ser Val Pro Trp Ala Cys Glu Gln Gly Thr Pro Pro

165 170 175

Met Ile Ser Trp Ile Gly Thr Ser Val Ser Pro Leu Asp Pro Ser Thr

180 185 190

Thr Arg Ser Ser Val Leu Thr Leu Ile Pro Gln Pro Gln Asp His Gly

195 200 205

Thr Ser Leu Thr Cys Gln Val Thr Phe Pro Gly Ala Ser Val Thr Thr

210 215 220

Asn Lys Thr Val His Leu Asn Val Ser Tyr Pro Pro Gln Asn Leu Thr

225 230 235 240

Met Thr Val Phe Gln Gly Asp Gly Thr

245

<210> 2

<211> 1095

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 2

atgctgctgc tgctgctgcc cctgctctgg gggagggaga gggcggaagg acagacaagt 60

aaactgctga cgatgcagag ttccgtgacg gtgcaggaag gcctgtgtgt ccatgtgccc 120

tgctccttct cctacccctc gcatggctgg atttaccctg gcccagtagt tcatggctac 180

tggttccggg aaggggccaa tacagaccag gatgctccag tggccacaaa caacccagct 240

cgggcagtgt gggaggagac tcgggaccga ttccacctcc ttggggaccc acataccaag 300

aattgcaccc tgagcatcag agatgccaga agaagtgatg cggggagata cttctttcgt 360

atggagaaag gaagtataaa atggaattat aaacatcacc ggctctctgt gaatgtgaca 420

gccttgaccc acaggcccaa catcctcatc ccaggcaccc tggagtccgg ctgcccccag 480

aatctgacct gctctgtgcc ctgggcctgt gagcagggga caccccctat gatctcctgg 540

atagggacct ccgtgtcccc cctggacccc tccaccaccc gctcctcggt gctcaccctc 600

atcccacagc cccaggacca tggcaccagc ctcacctgtc aggtgacctt ccctggggcc 660

agcgtgacca cgaacaagac cgtccatctc aacgtgtcct acccgcctca gaacttgacc 720

atgactgtct tccaaggaga cggcacagat aagcccaaac tgttctcgat gaagcgggga 780

gaagtttaca ttcccagcat atccacagtc ttgggaaatg gctcatctct gtcactccca 840

gagggccagt ctctgcgcct ggtctgtgca gttgatgcag ttgacagcaa tccccctgcc 900

aggctgagcc tgagctggag aggcctgacc ctgtgcccct cacagccctc aaacccgggg 960

gtgctggagc tgccttgggt gcacctgagg gatgcagctg aattcacctg cagagctcag 1020

aaccctctcg gctctcagca ggtctacctg aacgtctccc tgcagagcaa agccacatca 1080

ggagtgactc agggg 1095

<210> 3

<211> 588

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 3

Met Leu Leu Leu Leu Leu Pro Leu Leu Trp Gly Arg Glu Arg Ala Glu

1 5 10 15

Gly Gln Thr Ser Lys Leu Leu Thr Met Gln Ser Ser Val Thr Val Gln

20 25 30

Glu Gly Leu Cys Val His Val Pro Cys Ser Phe Ser Tyr Pro Ser His

35 40 45

Gly Trp Ile Tyr Pro Gly Pro Val Val His Gly Tyr Trp Phe Arg Glu

50 55 60

Gly Ala Asn Thr Asp Gln Asp Ala Pro Val Ala Thr Asn Asn Pro Ala

65 70 75 80

Arg Ala Val Trp Glu Glu Thr Arg Asp Arg Phe His Leu Leu Gly Asp

85 90 95

Pro His Thr Lys Asn Cys Thr Leu Ser Ile Arg Asp Ala Arg Arg Ser

100 105 110

Asp Ala Gly Arg Tyr Phe Phe Arg Met Glu Lys Gly Ser Ile Lys Trp

115 120 125

Asn Tyr Lys His His Arg Leu Ser Val Asn Val Thr Ala Leu Thr His

130 135 140

Arg Pro Asn Ile Leu Ile Pro Gly Thr Leu Glu Ser Gly Cys Pro Gln

145 150 155 160

Asn Leu Thr Cys Ser Val Pro Trp Ala Cys Glu Gln Gly Thr Pro Pro

165 170 175

Met Ile Ser Trp Ile Gly Thr Ser Val Ser Pro Leu Asp Pro Ser Thr

180 185 190

Thr Arg Ser Ser Val Leu Thr Leu Ile Pro Gln Pro Gln Asp His Gly

195 200 205

Thr Ser Leu Thr Cys Gln Val Thr Phe Pro Gly Ala Ser Val Thr Thr

210 215 220

Asn Lys Thr Val His Leu Asn Val Ser Tyr Pro Pro Gln Asn Leu Thr

225 230 235 240

Met Thr Val Phe Gln Gly Asp Gly Thr Asp Lys Pro Lys Leu Phe Ser

245 250 255

Met Lys Arg Gly Glu Val Tyr Ile Pro Ser Ile Ser Thr Val Leu Gly

260 265 270

Asn Gly Ser Ser Leu Ser Leu Pro Glu Gly Gln Ser Leu Arg Leu Val

275 280 285

Cys Ala Val Asp Ala Val Asp Ser Asn Pro Pro Ala Arg Leu Ser Leu

290 295 300

Ser Trp Arg Gly Leu Thr Leu Cys Pro Ser Gln Pro Ser Asn Pro Gly

305 310 315 320

Val Leu Glu Leu Pro Trp Val His Leu Arg Asp Ala Ala Glu Phe Thr

325 330 335

Cys Arg Ala Gln Asn Pro Leu Gly Ser Gln Gln Val Tyr Leu Asn Val

340 345 350

Ser Leu Gln Ser Lys Ala Thr Ser Gly Val Thr Gln Gly Thr Thr Thr

355 360 365

Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro

370 375 380

Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val

385 390 395 400

His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro

405 410 415

Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu

420 425 430

Tyr Cys Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro

435 440 445

Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys

450 455 460

Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe

465 470 475 480

Ser Arg Ser Ala Asp Ala Pro Ala Tyr Lys Gln Gly Gln Asn Gln Leu

485 490 495

Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp

500 505 510

Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys

515 520 525

Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala

530 535 540

Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys

545 550 555 560

Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr

565 570 575

Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg

580 585

<210> 4

<211> 1767

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 4

atgctgctgc tgctgctgcc cctgctctgg gggagggaga gggcggaagg acagacaagt 60

aaactgctga cgatgcagag ttccgtgacg gtgcaggaag gcctgtgtgt ccatgtgccc 120

tgctccttct cctacccctc gcatggctgg atttaccctg gcccagtagt tcatggctac 180

tggttccggg aaggggccaa tacagaccag gatgctccag tggccacaaa caacccagct 240

cgggcagtgt gggaggagac tcgggaccga ttccacctcc ttggggaccc acataccaag 300

aattgcaccc tgagcatcag agatgccaga agaagtgatg cggggagata cttctttcgt 360

atggagaaag gaagtataaa atggaattat aaacatcacc ggctctctgt gaatgtgaca 420

gccttgaccc acaggcccaa catcctcatc ccaggcaccc tggagtccgg ctgcccccag 480

aatctgacct gctctgtgcc ctgggcctgt gagcagggga caccccctat gatctcctgg 540

atagggacct ccgtgtcccc cctggacccc tccaccaccc gctcctcggt gctcaccctc 600

atcccacagc cccaggacca tggcaccagc ctcacctgtc aggtgacctt ccctggggcc 660

agcgtgacca cgaacaagac cgtccatctc aacgtgtcct acccgcctca gaacttgacc 720

atgactgtct tccaaggaga cggcacagat aagcccaaac tgttctcgat gaagcgggga 780

gaagtttaca ttcccagcat atccacagtc ttgggaaatg gctcatctct gtcactccca 840

gagggccagt ctctgcgcct ggtctgtgca gttgatgcag ttgacagcaa tccccctgcc 900

aggctgagcc tgagctggag aggcctgacc ctgtgcccct cacagccctc aaacccgggg 960

gtgctggagc tgccttgggt gcacctgagg gatgcagctg aattcacctg cagagctcag 1020

aaccctctcg gctctcagca ggtctacctg aacgtctccc tgcagagcaa agccacatca 1080

ggagtgactc aggggaccac gacgccagcg ccgcgaccac caacaccggc gcccaccatc 1140

gcgtcacagc ccctgtccct gcgcccagag gcgtgccggc cagcggcggg gggcgcagtg 1200

cacacgaggg ggctggactt cgcctgtgat atctacatct gggcgccctt ggccgggact 1260

tgtggggtcc ttctcctgtc actggttatc accctttact gcaaacgggg cagaaagaaa 1320

ctcctgtata tattcaaaca accatttatg agaccagtac aaactactca agaggaagat 1380

ggctgtagct gccgatttcc agaagaagaa gaaggaggat gtgaactgag agtgaagttc 1440

agcaggagcg cagacgcccc cgcgtacaag cagggccaga accagctcta taacgagctc 1500

aatctaggac gaagagagga gtacgatgtt ttggacaaga gacgtggccg ggaccctgag 1560

atggggggaa agccgagaag gaagaaccct caggaaggcc tgtacaatga actgcagaaa 1620

gataagatgg cggaggccta cagtgagatt gggatgaaag gcgagcgccg gaggggcaag 1680

gggcacgatg gcctttacca gggtctcagt acagccacca aggacaccta cgacgccctt 1740

cacatgcagg ccctgccccc tcgctaa 1767

Claims (14)

1. The extracellular domain protein is characterized by being a protein with an amino acid sequence shown as SEQ ID NO. 1.

2. A Chimeric Antigen Receptor (CAR), wherein the CAR comprises the Siglec-9 extracellular segment protein of claim 1, and wherein the Chimeric Antigen Receptor (CAR) comprises from N-terminus to C-terminus:

(i) the Siglec-9 extracellular domain protein of claim 1,

(ii) (ii) a transmembrane domain which is capable of,

(iii) at least one co-stimulatory domain, and

(iv) an intracellular signaling domain.

3. The chimeric antigen receptor according to claim 2, wherein said CAR has the structure shown in formula I:

L-T-H-TM-C-CD3ζ I

in the formula (I), the compound is shown in the specification,

l is an optional signal peptide sequence;

t is the Siglec-9 extracellular domain protein of claim 1;

h is a null or hinge region;

TM is a transmembrane domain;

c is a costimulatory signal molecule;

CD3 ζ is an intracellular signaling domain derived from CD3 ζ;

and in each of the above formulae, each "-" is independently a linker peptide or a peptide bond.

4. The chimeric antigen receptor according to claim 2, wherein the amino acid sequence of said CAR is as set forth in SEQ ID No. 3.

5. A recombinant protein, said recombinant protein comprising:

(i) the Siglec-9 extracellular domain protein of claim 1; and

(ii) optionally a tag sequence to assist expression and/or purification.

6. A drug conjugate, said drug conjugate comprising:

(a) the Siglec-9 extracellular domain protein of claim 1; and

(b) a coupling moiety coupled to the extracellular domain protein moiety, the coupling moiety selected from the group consisting of: a detectable label, a drug, a toxin, a cytokine, an enzyme, or a combination thereof.

7. A nucleic acid molecule encoding the Siglec-9 extracellular stretch protein of claim 1, the Chimeric Antigen Receptor (CAR) of claim 2, or the recombinant protein of claim 5.

8. The nucleic acid molecule of claim 7, wherein the nucleic acid molecule encoding the Chimeric Antigen Receptor (CAR) of claim 2 has a sequence as set forth in SEQ ID NO:4, respectively.

9. A vector comprising the nucleic acid molecule of claim 7.

10. A host cell comprising the vector or chromosome of claim 9 into which has been integrated an exogenous nucleic acid molecule of claim 7.

11. A method of making an engineered immune cell expressing the CAR of claim 2, wherein the method comprises the steps of: transferring the nucleic acid molecule of claim 7 or the vector of claim 9 into an immune cell, thereby obtaining the engineered immune cell.

12. A pharmaceutical composition comprising the host cell of claim 10, and a pharmaceutically acceptable carrier, diluent or excipient.

13. Use of the host cell of claim 10 or the pharmaceutical composition of claim 12 for the preparation of a medicament or formulation for selective killing of tumor cells, wherein the tumor is a tumor highly expressed by MUC1, and is selected from the group consisting of: breast cancer, pancreatic cancer, colon cancer, gastric cancer, lung cancer, renal cell carcinoma, liver cancer, ovarian cancer, esophageal adenocarcinoma, cholangiocarcinoma, prostate cancer, cervical cancer, multiple sarcoma, or a combination thereof.

14. A kit for selectively killing tumor cells, the kit comprising a container and the host cell of claim 10 disposed within the container, wherein the tumor is a tumor highly expressed by MUC1, and wherein the tumor is selected from the group consisting of: breast cancer, pancreatic cancer, colon cancer, gastric cancer, lung cancer, renal cell carcinoma, liver cancer, ovarian cancer, esophageal adenocarcinoma, cholangiocarcinoma, prostate cancer, cervical cancer, multiple sarcoma, or a combination thereof.

Images