CN109306343A

CN109306343A - Novel aspartic dehydrogenase and the application on aspartic acid race amino acids production

Info

Publication number: CN109306343A
Application number: CN201710621030.8A
Authority: CN
Inventors: 朱泰承; 李�浩; 苗良田; 李寅
Original assignee: Institute of Microbiology of CAS
Current assignee: Institute of Microbiology of CAS
Priority date: 2017-07-26
Filing date: 2017-07-26
Publication date: 2019-02-05

Abstract

The present invention relates to aspartic dehydrogenases, it is characterised in that amino acid sequence such as SEQ ID NO:99, shown in 100,101 or 102.

Description

Novel aspartic dehydrogenase and the application on aspartic acid race amino acids production

Technical field

The present invention relates to a kind of novel aspartic dehydrogenase and its answering in production aspartic acid race amino acid With.

Background technique

Aspartic acid race amino acid includes aspartic acid, threonine, lysine, isoleucine, methionine and β-the third Propylhomoserin.Aspartic acid group amino acid is important precursor raw material, has in food additives, cosmetics, field of medicaments and widely answers With, therefore there is important commercial value.

Microbe transformation method, including enzymatic and microbial fermentation are the main of current production aspartic acid race amino acid Method.In the biotransformation of aspartic acid race amino acid, aspartic acid is the key node of physiological metabolism.It is currently known There are the catalysis reactions that three synthesize aspartic acid for nature: one, by aspartic acid enzymatic, using fumaric acid and ammonium root as substrate Synthesize aspartic acid；Two, it is catalyzed by aspartate transaminase, generates aspartic acid using glutamic acid and oxaloacetic acid as substrate reactions And 2-oxoglutaric acid, this essence are one using glutamic acid as the transamination reaction of amino group donor；Three, by aspartic dehydrogenase (Aspartate dehydrogenase, AspDH) catalysis, using dissociate ammonium root as amino group donor ammonification react.

Currently, using aspartic acid as the amino acid fermentation process of precursor, mainly aerobic fermentation.In this process, from Oxaloacetic acid generates aspartic acid, and the catalysis for relying primarily on aspartate transaminase is realized.Aerobic fermentation will lead to highly energy-consuming and The loss of carbon, therefore anaerobic fermentation production amino acid is more attractive from cost.But in anaerobic processes, due to the way TCA Diameter vigor is very weak, enough amino group donor-glutamic acid can not be provided for the amination of oxaloacetic acid, it can thus be anticipated that in anaerobism The aminating reaction efficiency mediated in fermentation by transaminase will significantly reduce.In contrast, aspartic dehydrogenase can be directly with ammonium Radical ion is amino group donor, and does not depend on the supply of glutamic acid, therefore will be latent with important application in anaerobic fermentation process Power.

Compared with Aspartase and aspartate transaminase, aspartic dehydrogenase is found later.For the first time about day The report of aspartic acid dehydrogenase is in 2003, and Yang et al. [1] is in a kind of Thermophilic Bacterium Thermotoga maritima Thermotoga In maritima discovery number be TM1643 ORF have aspartic dehydrogenase activity, but its amino acid sequence and other There is no significant homologys for amino acid dehydrogenase sequence.2006, Yoneda [2] was according to Thermotoga maritima aspartic dehydrogenase sequence Column, discovery derive from the aspartic dehydrogenase of archaeal Archaeoglobus fulgidus, and to its structure^[2]And zymology Matter has done further research.Although both the above aspartic dehydrogenase has good thermal stability, they are normal The enzyme activity showed under temperature is all very low, limits the application value of aspartic dehydrogenase.Li is successively to source within 2011 (hereinafter in Pseudomonas aeruginosa [3] (being abbreviated as Pae below) and Ralstonia eutropha [4] Be abbreviated as Reu) aspartic dehydrogenase studied.It is different from thermophilic type aspartic dehydrogenase before, both days For aspartic acid dehydrogenase optimal reactive temperature all at 37 DEG C, specific enzyme activity reaches 127 and 137U/mg.It 2013, derives from The aspartic acid of Rhodopseudomonas palustris and Bradyrhizobium two kinds of NADPH dependent form of japonicum Dehydrogenase is also reported [5].

So far, only above six kinds of aspartic dehydrogenases are reported.Aspartic dehydrogenase is actually being answered at present The main problem present in is: 1. amination vigor are lower.Through actual test, Pseudomonas aeruginosa and The aspartic dehydrogenase Rate activity in the source Ralstonia eutropha is lower than 1U/mg；2. optimal pH meta-alkalescence, in neutral item Enzyme activity is very low under part.Since bacterium pH intracellular is usually in 7.3~7.7 ranges, which has limited the enzymes in Escherichia coli etc. Application in type strain.3. albumen is unstable, albumen after purification is easy to assemble, this may cause the effective enzyme given expression to Work is very low.

This patent has been screened high catalytic efficiency, has been remained in neutral conditions by the deep excavation to gene database Higher vigor, and the new aspartic dehydrogenase that stability is good are kept, and in aspartic acid race amino acid such as aspartic acid and β- Good effect is shown in the biotransformation of alanine.

Summary of the invention

The main object of the present invention is to provide some aspartic dehydrogenases.

Second object of the present invention is to provide a kind of heterologous in other microorganisms using the aspartic dehydrogenase The method of Expression product aspartic acid race amino acid such as aspartic acid and Beta-alanine.

To achieve the above object, the present invention realizes one by one by the following technical programs:

A kind of aspartic dehydrogenase (AspDH), catalysis oxaloacetic acid is reacted with ammonium root and NAD (P) H generates asparagus fern ammonia Acid and water and NAD (P)+reversible reaction, generated by one or more of following microorganism:

Klebsiella pneumoniae (Klebsiella pneumoniae), deformation spot Serratieae (Serratia Proteamaculans), salt color salt bacillus (Chromohalobacter salexigens), Acinetobacter baumannii are needed (Acinetobacter baumannii), Dell Ford bacterium Csl-4 (Delftia sp.Csl-4), human pallid bacillus (Ochrobactrum anthropi), shank bacterium (Caulobacter sp.), geneva methane Halophiles (Methanohalophilus mahii), the ocean Chai Shi rose bacillus (Dinoroseobacter shibae), acidophilus methane phase Bacterium (Methanosphaerula palustris), cud methane brevibacterium (Methanobrevibacter ruminantium)、Roseibacterium elongatum。

The aspartic dehydrogenase gene order is respectively as shown in SEQ ID NO:2-SEQ ID NO:13.

The aspartic dehydrogenase gene can be expanded to obtain by PCR by the microorganism, can also be by complete Gene chemical synthesis can carry out codon optimization according to host's codon preference.

The present invention also protects a kind of above-mentioned aspartic dehydrogenase of utilization to produce aspartic acid race amino acid such as aspartic acid With the bioconversion method of Beta-alanine.By expression Klebsiella pneumoniae, deformation spot Serratieae, need salt color salt bacillus, Bao Family name's acinetobacter calcoaceticus, Dell Ford bacterium Csl-4, human pallid bacillus, shank bacterium, geneva methane Halophiles, the ocean Chai Shi rose bacillus, The genetic engineering bacterium of acidophilus methanogen and the aspartic dehydrogenase in cud methane brevibacterium source is given birth to as catalyst Object Synthesis aspartic acid race's amino acid such as aspartic acid and Beta-alanine.

Wherein the AspDH gene in above-mentioned bacterial strains source can be used conventional genetic engineering means and obtain, bacterial strain as described above Chromosomal DNA is that template is obtained by PCR or according to its sequent synthesis.It, can be according to different expression systems when using synthetic method The preference united to codon will encode some or all of rare codon for host in these AspDH genes and replace For host's preferred codons.

The AspDH gene can introduce host cell by independently duplicated expression vector in host cell, can also To be integrated on recipient chromosome by such as the methods of homologous recombination.It is conventionally used to be ok in the host strain for carrying out gene expression As the recipient bacterium of expression AspDH, including bacterium, such as Escherichia coli, corynebacterium glutamicum, bacillus；Saccharomycete, such as Saccharomyces cerevisiae, pichia pastoris yeast, Hansenula polymorpha etc.；Mould, including aspergillus oryzae, aspergillus niger etc.；Photosynthetic bacteria, including Synechococcus, cytoalgae etc..Expressing for AspDH gene can use general efficient inducible promoter, constitutive promoter, The promoter of host itself can be used.

The recombinant bacterium of overexpression AspDH gene can use conventional method fermented and cultured, can be aerobic fermentation culture, It is also possible to anaerobic fermentation culture.Culture substrate can be glucose, glycerol, xylose, methanol or CO₂.It can also pass through The mode being directly catalyzed, the substrate of addition can be lactic acid, pyruvic acid, oxaloacetic acid, fumaric acid etc..

Specifically, one aspect of the present invention is related to aspartic dehydrogenase, it is characterised in that amino acid sequence such as SEQ ID NO:99, shown in 100,101 or 102.

In one embodiment of the invention, the amino acid sequence of the aspartic dehydrogenase and SEQ ID NO: Amino acid sequence shown in 99,100,101 or 102 is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homology, and it is respectively derived from Klebsiella pneumoniae (Klebsiella pneumoniae), Dell Ford bacterium Cs1-4 (Delftia sp.Cs1-4), or deformation spot Serratieae (Serratia proteamaculans) or human pallid bacillus (Ochrobactrum anthropi).

In one aspect of the invention, the nucleotide sequence for encoding the aspartic dehydrogenase is provided.

In one embodiment of the invention, the aspartic dehydrogenase is respectively by SEQ ID NO:2, and 3,6 or 7 Nucleotide sequence coded by.

In one embodiment of the invention, it is related to the expression vector comprising the aspartic dehydrogenase.

In one embodiment of the invention, it is related to the host cell comprising the expression vector.

In one embodiment of the invention, SEQ ID NO:2, nucleotide sequence shown in 3,6 or 7 are thin for host Born of the same parents have carried out codon optimization.

In one embodiment of the invention, the host cell is the thin of bacterium, photosynthetic bacteria, yeast or mould Born of the same parents.

In one embodiment of the invention, the host cell is Escherichia coli.

In one embodiment of the invention, it is related to the aspartic dehydrogenase for producing aspartic acid race ammonia The purposes of base acid, wherein aspartic acid race amino acid is selected from aspartic acid, threonine, lysine, isoleucine, first sulphur ammonia Acid and Beta-alanine, or combinations thereof.

The beneficial effects of the invention are as follows the recombination of the aspartic dehydrogenase generated using microorganism described in overexpression is micro- Biological production aspartic acid race amino acid such as aspartic acid or Beta-alanine, production level greatly improves or efficiency of pcr product is significant It is promoted.

Detailed description of the invention

Fig. 1 synthesizes pLlacO1-Tac-duet sequence.

Fig. 2 separate sources aspartic dehydrogenase solubility expression SDS-PAGE.

Fig. 3 separate sources aspartic dehydrogenase insolubility expresses SDS-PAGE.

Fig. 4 deforms spot Serratieae source aspartic dehydrogenase SDS-PAGE.

The SDS-PAGE of Fig. 5 aspartic dehydrogenase C-terminal insertion Histag.

Fig. 6 aspartic dehydrogenase purifies SDS-PAGE.

The pure enzyme of Fig. 7 .KpnAspDH enzyme activity under condition of different pH.

The pure enzyme of Fig. 8 .DelAspDH enzyme activity under condition of different pH.

The pure enzyme of Fig. 9 .SpeAspDH enzyme activity under condition of different pH.

Figure 10 aspartic dehydrogenase optimal reactive temperature result.

Figure 11 aspartic dehydrogenase thermal stability results.

The evaluation of Figure 12 aspartic acid fermenting and producing.

The evaluation of Figure 13 Beta-alanine fermenting and producing.

The yield of Figure 14 Beta-alanine.

The aspartic dehydrogenase (OanAspDH, SpeAspDH, DelAspDH and KpnAspDH) in the tetra- kinds of sources Figure 15 Sequence alignment.

Figure 16 .PaeAspDH and ReuAspDH express SDS-PAGE electrophoresis, and wherein swimming lane 1 and 1 ' indicates empty vectors pair According to solvable and insoluble expression；2 and 2 ' indicate the solvable and insoluble expression of ReuAspDH；3 and 3 ' indicate PaeAspDH's Solvable and insoluble expression；Swimming lane M indicates molecular weight marker.

The aspartic dehydrogenase (OanAspDH, SpeAspDH, DelAspDH and KpnAspDH) in the tetra- kinds of sources Figure 17 Tomograph, Figure 17 a are OanAspDH and SpeAspDH comparison result.Dark grey is OanAspDH, and light gray is SpeAspDH；Figure 17 b is OanAspDH and DelAspDH comparison result.Dark grey is OanAspDH, and light gray is DelAspDH； Figure 17 c is OanAspDH and KpnAspDH comparison result.Dark grey is OanAspDH, and light gray is KpnAspDH.

Specific embodiment

The present invention is illustrated by specific embodiment in further detail below in conjunction with attached drawing.Those skilled in the art should manage Solution, following specific embodiments are merely to illustrate the present invention, rather than limitation of the present invention.

Experimental method used in following embodiments is conventional method unless otherwise specified.

Reagent material as used in the following examples is purchased from routine biochemistry reagent shop unless otherwise specified.

1. enzyme and main agents

Klebsiella pneumoniae used, needs salt color salt bacillus, Acinetobacter baumannii, Dell's Ford at deformation spot Serratieae Bacterium Cs1-4, human pallid bacillus, shank bacterium, geneva methane Halophiles, the ocean Chai Shi rose bacillus, acidophilus methanogen, cud first Alkane brevibacterium, the source Roseibacterium elongatum aspartic dehydrogenase gene and other gene orders are by Suzhou The synthesis of Jin Weizhi company.

Carrier pET30a:Novagen company, e. coli bl21 (DE3): transgen company, restriction enzyme NdeI, BglII:NEB company.Restriction enzyme SphI and XhoI, T4 ligase are purchased from NEB company.

2. molecular biology manipulations

PCR condition, E. coli competent preparation and method for transformation refer to " Molecular Cloning:A Laboratory guide ", DNA gel Recycling, plasmid extraction, DNA purifying, digestion and connection etc. are operated by product description.

1. inducible expression vector pED31 of embodiment building

1, composition sequence pLlacO1-Tac-duet (SEQ ID NO:1).

2, cleavage sequence 1 and carrier pET30a are distinguished with restriction enzyme SphI and XhoI, two segments are in T4 ligase Middle connection overnight, converts bacillus coli DH 5 alpha, obtains pED31.

The building of 2. recombination bacillus coli BL21 (pED31-KpnAspDH) of embodiment

1, double chain DNA molecule, i.e. KpnAspDH shown in the SEQ ID NO:2 of composition sequence table.

2, the clone of Klebsiella pneumoniae aspartic dehydrogenase gene KpnAspDH

Upstream primer: 5 '-TATACATATGAAAAAAGTAATGCTGATTGGT-3 ' (SEQ ID NO:14), underscore is NdeI restriction enzyme site.

Downstream primer: 5 ' TACCCAGATCTTTAAGCCAGTTCGCGACAAG-3 ' (SEQ ID NO:15), underscore is BglII restriction enzyme site.

The double-stranded DNA synthesized using step 1 is template, with the above primer PCR amplifying target genes.It is expanded using touchdown PCR Target gene, reaction condition are as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 15s, annealing temperature is since 60 DEG C, each circulation 1 DEG C is reduced, anneal 15s, and 72 DEG C of extension 30s, totally 10 loops back fire temperature are down to 50 DEG C；At most suitable 55 DEG C of annealing temperature Under the conditions of carry out 20 circulation, equally annealing 15s, 72 DEG C of extension 30s；Finally in 72 DEG C of extension 7min.Expand obtained DNA piece Section is purified after agarose gel electrophoresis is verified with Cycle pure kit.

3, by the KpnAspDH gene of PCR amplification and expression vector pED31 with restriction enzyme NdeI, BglII in 37 DEG C double digestion is stayed overnight, and purpose band is separately recovered in agarose electrophoresis, and two segments connects overnight in T4 ligase, conversion large intestine bar Bacterium DH5 α, obtains pED31-KpnAspDH plasmid.

4, recombinant plasmid pED31-KpnAspDH is imported into BL21 (DE3), obtained recombinant bacterium is BL21 (pED31- KpnAspDH)。

The building of 3. recombination bacillus coli BL21 (pED31-SpeAspDH) of embodiment

1, double chain DNA molecule, i.e. SpeAspDH shown in the SEQ ID NO:6 of composition sequence table.

2, the clone of spot Serratieae aspartic dehydrogenase gene SpeAspDH is deformed

Upstream primer: 5 '-TATACATATGAAAAAAATCATGATGATCGGTT-3 ' (SEQ ID NO:16), underscore It is NdeI restriction enzyme site.

Downstream primer: 5 '-TACCCAGATCTTTATGCGATAAAGCCACC-3 (SEQ ID NO:17) ', underscore is BglII restriction enzyme site.

The double-stranded DNA synthesized using step 1 is template, with the above primer PCR amplifying target genes.PCR reaction condition is as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 15s, for annealing temperature since 60 DEG C, each circulation reduces by 1 DEG C, and anneal 15s, and 72 DEG C are prolonged 30s is stretched, totally 10 loops back fire temperature are down to 50 DEG C；20 circulations are carried out under conditions of most suitable 55 DEG C of annealing temperature, together Sample annealing 15s, 72 DEG C of extension 30s；Finally in 72 DEG C of extension 7min.Obtained DNA fragmentation is expanded to test through agarose gel electrophoresis After card, purified with Cycle pure kit.

3, by the SpeAspDH gene of PCR amplification and expression vector pED31 with restriction enzyme NdeI, BglII in 37 DEG C double digestion is stayed overnight, and purpose band is separately recovered in agarose electrophoresis, and two segments connects overnight in T4 ligase, conversion large intestine bar Bacterium DH5 α, obtains pED31-SpeAspDH plasmid.

4, recombinant plasmid pED31-SpeAspDH is imported into BL21 (DE3), obtained recombinant bacterium is BL21 (pED31- SpeAspDH)。

The building of 4. recombination bacillus coli BL21 (pED31-CsaAspDH) of embodiment

1, double chain DNA molecule, i.e. CsaAspDH shown in the SEQ ID NO:4 of composition sequence table.

2, the clone of salt color salt bacillus aspartic dehydrogenase gene C saAspDH is needed

Upstream primer: 5 '-TATACATATGACTGCGAAAACCGTTATG-3 ' (SEQ ID NO:18), underscore is NdeI restriction enzyme site.

Downstream primer: 5 ' TACCCAGATCTTTATACAACAACCGGTTCC-3 ' (SEQ ID NO:19), underscore is BglII restriction enzyme site.

The double-stranded DNA synthesized using step 1 is template, with the above primer PCR amplifying target genes.PCR reaction condition is as follows: 5min:95 DEG C of denaturation 15s of 95 DEG C of initial denaturations, for annealing temperature since 60 DEG C, each circulation reduces by 1 DEG C, and anneal 15s, and 72 DEG C are prolonged 30s is stretched, totally 10 loops back fire temperature are down to 50 DEG C；20 circulations are carried out under conditions of most suitable 55 DEG C of annealing temperature, together Sample annealing 15s, 72 DEG C of extension 30s；Finally in 72 DEG C of extension 7min.Obtained DNA fragmentation is expanded to test through agarose gel electrophoresis After card, purified with Cycle pure kit.

3, by the CsaAspDH gene of PCR amplification and expression vector pED31 with restriction enzyme NdeI, BglII in 37 DEG C double digestion is stayed overnight, and purpose band is separately recovered in agarose electrophoresis, and two segments connects overnight in T4 ligase, conversion large intestine bar Bacterium DH5 α, obtains pED31-CsaAspDH plasmid.

4, recombinant plasmid pED31-CsaAspDH is imported into BL21 (DE3), obtained recombinant bacterium is BL21 (pED31- CsaAspDH)。

The building of 5. recombination bacillus coli BL21 (pED31-AbcAspDH) of embodiment

1, double chain DNA molecule, i.e. AbcAspDH shown in the SEQ ID NO:5 of composition sequence table.

2, the clone of Acinetobacter baumannii aspartic dehydrogenase Gene A bcAspDH

Upstream primer: 5 '-TATACATATGAAAAAACTGATGATGATTG-3 (SEQ ID NO:20) ', underscore is NdeI restriction enzyme site.

Downstream primer: 5 '-TACCCAGATCTTTAAATCTGGATAGCTTCTAC-3 ' (SEQ ID NO:21), underscore It is BglII restriction enzyme site.

3, by the AbcAspDH gene of PCR amplification and expression vector pED31 with restriction enzyme NdeI, BglII in 37 DEG C double digestion is stayed overnight, and purpose band is separately recovered in agarose electrophoresis, and two segments connects overnight in T4 ligase, conversion large intestine bar Bacterium DH5 α, obtains pED31-AbcAspDH plasmid.

4, recombinant plasmid pED31-AbcAspDH is imported into BL21 (DE3), obtained recombinant bacterium is BL21 (pED31- AbcAspDH)。

The building of 6. recombination bacillus coli BL21 (pED31-DelAspDH) of embodiment

1, double chain DNA molecule, i.e. DelAspDH shown in the SEQ ID NO:3 of composition sequence table.

2, the clone of Dell's Ford bacterium Csl-4 aspartic dehydrogenase gene DelAspDH

Upstream primer: 5 '-TATACATATGAACATCGCTGTAATCGGTTG-3 ' (SEQ ID NO:22), underscore is NdeI restriction enzyme site.

Downstream primer: 5 ' TACCCAGATCTTTAGATAGCGATTGCGGTAG-3 ' (SEQ ID NO:23), underscore is BglII restriction enzyme site.

3, by the DelAspDH gene of PCR amplification and expression vector pED31 with restriction enzyme NdeI, BglII in 37 DEG C double digestion is stayed overnight, and purpose band is separately recovered in agarose electrophoresis, and two segments connects overnight in T4 ligase, conversion large intestine bar Bacterium DH5 α, obtains pED31-DelAspDH plasmid.

4, recombinant plasmid pED31-DelAspDH is imported into BL21 (DE3), obtained recombinant bacterium is BL21 (pED31- DelAspDH)。

The building of 7. recombination bacillus coli BL21 (pED31-OanAspDH) of embodiment

1, double chain DNA molecule, i.e. OanAspDH shown in the SEQ ID NO:7 of composition sequence table.

2, the clone of human pallid bacillus aspartic dehydrogenase gene OanAspDH

Upstream primer: 5 ' TATACATATGTCCGTATCTGAAACC-3 ' (SEQ ID NO:24), underscore is NdeI enzyme Enzyme site.

Downstream primer: 5 '-TACCCAGATCTTCAGATAACGGTAGTTGC-3 ' (SEQ ID NO:25), underscore is BglII restriction enzyme site.

3, by the OanAspDH gene of PCR amplification and expression vector pED31 with restriction enzyme NdeI, BglII in 37 DEG C double digestion is stayed overnight, and purpose band is separately recovered in agarose electrophoresis, and two segments connects overnight in T4 ligase, conversion large intestine bar Bacterium DH5 α, obtains pED31-OanAspDH plasmid.

4, recombinant plasmid pED31-OanAspDH is imported into BL21 (DE3), obtained recombinant bacterium is BL21 (pED31- OanAspDH)。

The building of 8. recombination bacillus coli BL21 (pED31-CakAspDH) of embodiment

1, double chain DNA molecule, i.e. CakAspDH shown in the SEQ ID NO:8 of composition sequence table.

2, the clone of shank bacterium aspartic dehydrogenase gene C akAspDH

Upstream primer: 5 '-TATACATATGGAACGTCGCGTTGCAC-3 ' (SEQ ID NO:26), underscore is NdeI Restriction enzyme site.

Downstream primer: 5 ' TACCCAGATCTTTATGCGAAGCGAACGATAGC-3 ' (SEQ ID NO:27), underscore is BglII restriction enzyme site.

3, by the CakAspDH gene of PCR amplification and expression vector pED31 with restriction enzyme NdeI, BglII in 37 DEG C double digestion is stayed overnight, and purpose band is separately recovered in agarose electrophoresis, and two segments connects overnight in T4 ligase, conversion large intestine bar Bacterium DH5 α, obtains pED31-CakAspDH plasmid.

4, recombinant plasmid pED31-CakAspDH is imported into BL21 (DE3), obtained recombinant bacterium is BL21 (pED31- CakAspDH)。

The building of 9. recombination bacillus coli BL21 (pED31-MmhAspDH) of embodiment

1, double chain DNA molecule, i.e. MImhAspDH shown in the SEQ ID NO:9 of composition sequence table.

2, the clone of geneva methane Halophiles aspartic dehydrogenase gene M mhAspDH

Upstream primer: 5 '-TATACATATGCTGAAAATCGGTGTTTTC-3 ' (SEQ ID NO:28), underscore is NdeI restriction enzyme site.

Downstream primer: 5 '-TACCCAGATCTTTAGGTGCCAACATTGAAG-3 ' (SEQ ID NO:29), underscore is BglII restriction enzyme site.

3, by the MmhAspDH gene of PCR amplification and expression vector pED31 with restriction enzyme NdeI, BglII in 37 DEG C double digestion is stayed overnight, and purpose band is separately recovered in agarose electrophoresis, and two segments connects overnight in T4 ligase, conversion large intestine bar Bacterium DH5 α, obtains pED31-MmhAspDH plasmid.

4, recombinant plasmid pED31-MmhAspDH is imported into BL21 (DE3), obtained recombinant bacterium is BL21 (pED31- MmhAspDH)。

The building of 10. recombination bacillus coli BL21 (pED31-DshAspDH) of embodiment

1, double chain DNA molecule, i.e. DshAspDH shown in the SEQ ID NO:10 of composition sequence table.

2, the clone of the ocean Chai Shi rose bacillus aspartic dehydrogenase gene DshAspDH

Upstream primer: 5 '-TATACATATGCGTCTGGCGCTGATC-3 ' (SEQ ID NO:30), underscore is NdeI enzyme Enzyme site.

Downstream primer: 5 ' TACCCAGATCTTTAAACCACCCATGCTGCATC-3 ' (SEQ ID NO:31), underscore is BglII restriction enzyme site.

The double-stranded DNA synthesized using step 1 is template, with the above primer PCR amplifying target genes.PCR reaction condition is as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 15s, for annealing temperature since 60 DEG C, each circulation reduces by 1 DEG C, and anneal 15s, and 72 DEG C are prolonged 30s is stretched, totally 10 loops back fire temperature are down to 50 DEG C and carry out 20 circulations under conditions of most suitable 55 DEG C of annealing temperature, equally Anneal 15s, 72 DEG C of extension 30s；Finally in 72 DEG C of extension 7min.Obtained DNA fragmentation is expanded to verify through agarose gel electrophoresis Afterwards, purified with Cycle pure kit.

3, by the DshAspDH gene of PCR amplification and expression vector pED31 with restriction enzyme NdeI, BglII in 37 DEG C double digestion is stayed overnight, and purpose band is separately recovered in agarose electrophoresis, and two segments connects overnight in T4 ligase, conversion large intestine bar Bacterium DH5 α, obtains pED31-DshAspDH plasmid.

4, recombinant plasmid pED31-DshAspDH is imported into BL21 (DE3), obtained recombinant bacterium is BL21 (pED31- DshAspDH)。

The building of 11. recombination bacillus coli BL21 (pED31-MplAspDH) of embodiment

1, double chain DNA molecule, i.e. MplAspDH shown in the SEQ ID NO:11 of composition sequence table.

2, the clone of acidophilus methanogen aspartic dehydrogenase gene M plAspDH

Upstream primer: 5 '-TATACATATGGTAATGGTTGGTATGC-3 ' (SEQ ID NO:32), underscore is NdeI Restriction enzyme site.

Downstream primer: 5 '-TACCCAGATCTTTAAGTGCCCACAACGATC-3 ' (SEQ ID NO:33), underscore is BglII restriction enzyme site.

3, by the MplAspDH gene of PCR amplification and expression vector pED31 with restriction enzyme NdeI, BglII in 37 DEG C double digestion is stayed overnight, and purpose band is separately recovered in agarose electrophoresis, and two segments connects overnight in T4 ligase, conversion large intestine bar Bacterium DH5 α, obtains pED31-MplAspDH plasmid.

4, recombinant plasmid pED31-MplAspDH is imported into BL21 (DE3), obtained recombinant bacterium is BL21 (pED31- MplAspDH)。

The building of 12. recombination bacillus coli BL21 (pED31-MruAspDH) of embodiment

1, double chain DNA molecule, i.e. MruAspDH shown in the SEQ ID NO:12 of composition sequence table.

2, the clone of cud methane brevibacterium aspartic dehydrogenase gene M ruAspDH

Upstream primer: 5 '-TATACATATGATCGTTGGTATTCTGG-3 ' (SEQ ID NO:34), underscore is NdeI Restriction enzyme site.

Downstream primer: 5 ' TACCCAGATCTTTAAGTGCCAACGCTGAAG-3 ' (SEQ ID NO:35), underscore is BglII restriction enzyme site.

3, by the MruAspDH gene of PCR amplification and expression vector pED31 with restriction enzyme NdeI, BglII in 37 DEG C double digestion is stayed overnight, and purpose band is separately recovered in agarose electrophoresis, and two segments connects overnight in T4 ligase, conversion large intestine bar Bacterium DH5 α, obtains pED31-MruAspDH plasmid.

4, recombinant plasmid pED31-MruAspDH is imported into BL21 (DE3), obtained recombinant bacterium is BL21 (pED31- MruAspDH)。

The building of 13. recombination bacillus coli BL21 (pED31-RedAspDH) of embodiment

1, double chain DNA molecule, i.e. RedAspDH shown in the SEQ ID NO:13 of composition sequence table.

2, the clone of Roseibacterium elongatum aspartic dehydrogenase gene RedAspDH

Upstream primer: 5 '-TATACATATGCGCTACCAAGGGGTC-3(SEQ ID NO；36) ', underscore is NdeI enzyme Enzyme site.

Downstream primer: 5 ' TACCCAGATCTTCAGATCACCACCGGTCTG-3 ' (SEQ ID NO:37), underscore is BglII restriction enzyme site.

3, by the RedAspDH gene of PCR amplification and expression vector pED31 with restriction enzyme NdeI, BglII in 37 DEG C double digestion is stayed overnight, and purpose band is separately recovered in agarose electrophoresis, and two segments connects overnight in T4 ligase, conversion large intestine bar Bacterium DH5 α, obtains pED31-RedAspDH plasmid.

4, recombinant plasmid pED31-RedAspDH is imported into BL21 (DE3), obtained recombinant bacterium is BL21 (pED31- RedAspDH)。

The building of 14. recombination bacillus coli BL21 (pED31-PaeAspDH) of embodiment

1, according to document [3], double chain DNA molecule, i.e. PaeAspDH shown in the SEQ ID NO:38 of composition sequence table.

2, the clone of Pseudomonas aeruginosa PAO1 aspartic dehydrogenase gene PaeAspDH

Upstream primer: 5 '-TATACATATGCTGAATATCGTCATGATCG-3(SEQ ID NO；39) ', underscore is NdeI restriction enzyme site.

Downstream primer: 5 '-TACCCAGATCTCTAGATCGAAATCGCGTGGG-3 ' (SEQ ID NO:40), underscore It is BglII restriction enzyme site.

3, by the PaeAspDH gene of PCR amplification and expression vector pED31 with restriction enzyme NdeI, BglII in 37 DEG C double digestion is stayed overnight, and purpose band is separately recovered in agarose electrophoresis, and two segments connects overnight in T4 ligase, conversion large intestine bar Bacterium DH5 α, obtains pED31-PaeAspDH plasmid.

4, recombinant plasmid pED31-PaeAspDH is imported into BL21 (DE3), obtained recombinant bacterium is BL21 (pED31- PaeAspDH)。

The building of 15. recombination bacillus coli BL21 (pED31-ReuAspDH) of embodiment

1, according to document [4], double chain DNA molecule, i.e. ReuAspDH shown in the SEQ ID NO:41 of composition sequence table.

2, the clone of Ralstonia eutropha JMP134 aspartic dehydrogenase gene ReuAspDH

Upstream primer: 5 '-TATACATATGTCCATGCTGCATGTGTC-3(SEQ ID NO；42) ', underscore is NdeI restriction enzyme site.

Downstream primer: 5 ' TACCCAGATCTTCAGATCGATACCGCGTGCG-3 ' (SEQ ID NO:43), underscore is BglII restriction enzyme site.

3, by the ReuAspDH gene of PCR amplification and expression vector pED31 with restriction enzyme NdeI, BglII in 37 DEG C double digestion is stayed overnight, and purpose band is separately recovered in agarose electrophoresis, and two segments connects overnight in T4 ligase, conversion large intestine bar Bacterium DH5 α, obtains pED31-ReuAspDH plasmid.

4, recombinant plasmid pED31-ReuAspDH is imported into BL21 (DE3), obtained recombinant bacterium is BL21 (pED31- ReuAspDH)。

16. recombination bacillus coli polyacrylamide gel electrophoresis of embodiment

The embodiment 2-15 recombination bacillus coli constructed is proceeded as follows respectively:

1, picking single colonie is inoculated in LB liquid medium of the 5mL containing 50 μ g/mL kanamycins, 37 DEG C, 200rpm shake Swing culture 12 hours.

2, the culture solution 1mL in step 1 is taken to be inoculated in LB liquid medium of the 20mL containing 50 μ g/mL kanamycins, 30 DEG C, 200rpm shake culture to OD₆₀₀=0.6-0.8 is added 0.5mM isopropylthiogalactoside (IPTG), 30 DEG C of cultures 12 Hour.

3, the bacterium solution OD after measurement culture in the cultivating system of step 2₆₀₀Value, takes the 10OD bacterium solution 10 of 1mL, 000rpm from The heart 5 minutes, the 100mM Tris-HCl buffer (pH8.0) of 1mL is added, ultrasonic disruption (power 200W, work are carried out after mixing Make 3 seconds, stop 3 seconds, total duration 5 minutes), 10,000rpm centrifugations 5 minutes.

4, it takes 20 μ l of supernatant precipitating in step 3 that isometric 2x loading buffer is added respectively, is reacted in boiling water It 5 minutes, takes 10 μ l to be added in 12% polyacrylamide gel (SDS-PAGE) prepared after reaction and detects protein expression situation.

5, expression of results is as shown in Figure 2, Figure 3 and Figure 4, the aspartic dehydrogenase in Klebsiella pneumoniae source (KpnAspDH) not only there is insoluble expression of the solubility expression there are also half；Source cud methane brevibacterium (MruAspDH), Geneva methane Halophiles (MmhAspDH), human pallid bacillus (OanAspDH), Dell Ford bacterium Cs1-4 (DelAspDH), deformation The aspartic dehydrogenase of spot Serratieae (SpeAspDH) all only has solubility expression；Source needs salt color salt bacillus (CsaAspDH), acidophilus methanogen (MplAspDH), Acinetobacter baumannii (AbcAspDH) aspartic dehydrogenase only have Insoluble expression；Source shank bacterium (CakAspDH), the ocean Chai Shi rose bacillus (DshAspDH), Roseibacterium The aspartic dehydrogenase of elongatum (RedAspDH) is both without solubility expression or without insoluble expression.

PaeAspDH and ReuAspDH has expression (see Figure 16), and albumen size is about 28KDa, and PaeAspDH is solvable Property expression and ReuAspDH has general albumen insoluble.The thick Enzyme activity assay of 17. aspartic dehydrogenase of embodiment

Reaction system: 4mM oxaloacetic acid, 0.2mM NAD (P) H, 100mM NH₄Cl is dissolved in 100mM Tris-HCl Buffer (pH 8.0-9.0), the Expenditure Levels by measuring NAD (P) H at 340nm obtain the reaction speed of enzyme.Enzyme activity list Position uses international unit U, i.e., enzyme amount used in 1 μm of ol NAD (P) H of oxidation per minute is an enzyme-activity unit.

The measurement of thick protein content measures protein concentration using brandford microanalysis.

The thick Enzyme activity assay of 1. aspartic dehydrogenase of table (NADPH) (U/mg)

*:: other include Mpl, Csa, Cak, Dsh, Red

Thick Enzyme activity assay situation of the aspartic dehydrogenase when co-factor is NADPH is as shown in table 1, wherein source The aspartic acid of human pallid bacillus (OanAspDH), Dell's Ford (DelAspDH) and deformation spot Serratieae (SpeAspDH) is de- Hydrogen enzyme shows relatively high specific enzyme activity, is 56.5U/mg, 13.4U/mg and 19.7U/mg respectively under the conditions of 9 pH；Cray primary Family name's pulmonitis strain aspartic dehydrogenase (KpnAspDH) also has the thick enzyme activity of 3.3U/mg；The dehydrogenase enzyme activity in other sources is small In 1, is not expressed in SDS-PAGE or the AspDH of only insoluble expression is nearly all without enzyme activity.

The thick Enzyme activity assay of 2. aspartic dehydrogenase of table (NADH) (U/mg)

	Oan	Del	Spe
				pH 9.0	7.8	10.2	5.6
pH 8.0	5.7	11.4	4

Thick Enzyme activity assay situation of the aspartic dehydrogenase when co-factor is NADH is as shown in table 2, as the result is shown The aspartic acid of human pallid bacillus (OanAspDH), Dell's Ford (DelAspDH) and deformation spot Serratieae (SpeAspDH) is de- Significant enzyme activity can be detected in hydrogen enzyme, wherein DelAspDH enzyme activity highest.

18. cmy vector pED31-OanAspDH-Histag of embodiment building

2, the clone of the human pallid bacillus aspartic dehydrogenase gene OanAspDH-Histag with histidine tag

Upstream primer: 5 ' TATACATATGTCCGTATCTGAAACC-3 ' (SEQ ID NO:44), underscore is NdeI enzyme Enzyme site.

Downstream primer: 5 '-TACCCAGATCTTCAGATAACGGTAGTTG CTAC-3 ' (SEQ ID NO:45), underscore are BglII restriction enzyme sites, and double underline is 6 histidine tags.

3, by the OanAspDH gene of PCR amplification and expression vector pED31 with restriction enzyme NdeI, BglII in 37 DEG C double digestion is stayed overnight, and purpose band is separately recovered in agarose electrophoresis, and two segments connects overnight in T4 ligase, conversion large intestine bar Bacterium DH5 α, obtains pED31-OanAspDH-Histag plasmid.

19. cmy vector pED31-KpnAspDH-Histag of embodiment building

2, the clone of the Klebsiella pneumoniae aspartic dehydrogenase gene KpnAspDH-Histag with histidine tag

Upstream primer: 5 '-TATACATATGAAAAAAGTAATGCTGATTGGT-3 ' (SEQ ID NO:46), underscore is NdeI restriction enzyme site.

Downstream primer: 5 '-TACCCAGATCTTTAAGCCAGTTCGCGAC AAG-3 ' (SEQ ID NO:47), underscore are BglII restriction enzyme sites, and double underline is 6 histidine tags.

3, by the KpnAspDH gene of PCR amplification and expression vector pED31 with restriction enzyme NdeI, BglII in 37 DEG C double digestion is stayed overnight, and purpose band is separately recovered in agarose electrophoresis, and two segments connects overnight in T4 ligase, conversion large intestine bar Bacterium DH5 α, obtains pED31-KpnAspDH-Histag plasmid.

20. cmy vector pED31-SpeAspDH-Histag of embodiment building

2, gram of the deformation spot Serratieae bacterium aspartic dehydrogenase gene SpeAspDH-Histag with histidine tag It is grand

Upstream primer: 5 '-TATACATATGAAAAAAATCATGATGATCGGTT-3 ' (SEQ ID NO:48), underscore It is NdeI restriction enzyme site.

Downstream primer: 5 '-TACCCAGATCTTTATGCGATAAAGCCAC C-3 ' (SEQ ID NO:49), underscore are BglII restriction enzyme sites, and double underline is 6 histidine tags.

3, by the SpeAspDH gene of PCR amplification and expression vector pED31 with restriction enzyme NdeI, BglII in 37 DEG C double digestion is stayed overnight, and purpose band is separately recovered in agarose electrophoresis, and two segments connects overnight in T4 ligase, conversion large intestine bar Bacterium DH5 α, obtains pED31-SpeAspDH-Histag plasmid.

21. cmy vector pED31-DelAspDH-Histag of embodiment building

2, gram of the Dell Ford bacterium Cs1-4 aspartic dehydrogenase gene DelAspDH-Histag with histidine tag It is grand

Upstream primer: 5 '-TATACATATGAACATCGCTGTAATCGGTTG-3 ' (SEQ ID NO:50), underscore is NdeI restriction enzyme site.

Downstream primer: 5 '-TACCCAGATCTTTAGATAGCGATTGCGG TAG-3 ' (SEQ ID NO:51), underscore are BglII restriction enzyme sites, and double underline is 6 histidine tags.

3, by the DelAspDH gene of PCR amplification and expression vector pED31 with restriction enzyme NdeI, BglII in 37 DEG C double digestion is stayed overnight, and purpose band is separately recovered in agarose electrophoresis, and two segments connects overnight in T4 ligase, conversion large intestine bar Bacterium DH5 α, obtains pED31-DelAspDH-Histag plasmid.

The purifying of embodiment 22.OanAspDH, KpnAspDH, SpeAspDH and DelAspDH recombinant aspartic dehydrogenase

The purifying of I.KpnAspDH, SpeAspDH and DelAspDH recombinant aspartic dehydrogenase

The embodiment 18-21 cmy vector constructed is converted into e. coli bl21 respectively respectively, to the recombination large intestine of acquisition Bacillus proceeds as follows:

3, the bacterium solution 10 after cultivating in the cultivating system of step 2,000rpm are centrifuged 5 minutes, and the combination liquid of 5mL is added (50mM sodium phosphate, 300mM sodium chloride, 10mM imidazoles pH8.0), after mixing carry out ultrasonic disruption (power 200W, work 3 seconds, Stop 4 seconds, total duration 10 minutes), 10,000rpm centrifugations 5 minutes.

4, it takes 20 μ l of supernatant precipitating in step 3 that isometric 2x loading buffer is added, reacts 5 points in boiling water Clock takes 10 μ l to be added in 12% polyacrylamide gel (SDS-PAGE) prepared and detects protein expression situation after reaction.As a result As shown in figure 5, OanAspDH C-terminal be added histidine tag after cause albumen can not normal expression, other three aspartic acids The equal normal expression of dehydrogenase.

5,0.22 μm of filter membrane removing impurity of supernatant in step 3 is taken, the affinity media filled layer of pre-cooling is added to after filtering It analyses column nickel column and carries out protein purification, then eluted with rinsing liquid (50mM sodium phosphate, 300mM sodium chloride, 20mM imidazoles pH8.0) miscellaneous Aspartic dehydrogenase is washed with eluent (50mM sodium phosphate, 300mM sodium chloride, 250mM imidazoles pH8.0) after albumen It is de-.It elutes albumen to save in 4 DEG C, and carries out SDS-PAGE detection (Fig. 6)

The purifying of II.OanAspDH recombinant aspartic dehydrogenase

1, e. coli bl21 (pED31-OanAspDH) single colonie that picking constructs embodiment 7 is inoculated in 5mL containing 50 In the LB liquid medium of μ g/mL kanamycins, 37 DEG C, 200rpm shake culture 12 hours.

3, the bacterium solution 10,000rpm after cultivating in the cultivating system of step 2 is centrifuged 5 minutes collection cells.By the thin of collection Born of the same parents are suspended in 10mM kaliumphosphate buffer (pH6.5), contain 1mM EDTA and 20% glycerol.Ultrasonic disruption is carried out after mixing (power 200W works 3 seconds, stops 4 seconds, total duration 10 minutes), and with 37,000 × g, at 4 DEG C.Centrifugation 1 hour

4.DEAE-Sepharose FF anion-exchange chromatography: clasmatosis liquid is loaded onto and uses 0.02mol/LTris- The DEAE-Sepharose FF anion-exchange column of HCl (pH 7.5) buffer balance, is sufficiently weighed with equilibrium liquid and is washed, will do not hung After the albumen of upper prop sufficiently elutes (weighing apparatus washes the stage), line is carried out with the flow velocity of 2.0mL/min with 0.5mol/L NaCl solution Property gradient (0-30%) elute (elution stage), collect concentration weighing apparatus and wash the enzyme activity component of stage and elution stage.

5.Superdex-G75/200 gel chromatography: with the 0.02mol/L Tris-HCl (pH of the NaCl containing 0.15mol/L 7.5) the concentration enzyme solution in 1.2.6 is loaded onto gel column, equilibrium liquid elution, flow velocity 0.5mL/ by buffer balanced gel column min.Collect enzyme activity peak, as pure enzyme solution.

The zymologic property of 23. aspartic dehydrogenase of embodiment measures

By aspartic dehydrogenase after purification measure respectively its optimal reaction pH, optimal reactive temperature, temperature stability, Substrate specificity and kinetic parameter.

Reaction buffer used is as follows in optimal reaction pH experiment: 100mM sodium phosphate (pH6.5-7.5), 100mM Tris- HCl (pH7.5-9.5) and 100mM glycine-NaOH (pH9.5-10.5).As a result as shown in figs. 7 to 9, KpnAspDH Optimal reaction pH is 8.5, and specific enzyme activity is up to 26.5U/mg (Fig. 7)；DelAspDH and SpeAspDH specific enzyme activity highest at pH 8, It is 32.8 and 106.2U/mg (Fig. 8 and Fig. 9) respectively；Oan optimal pH in 8.0~8.5 ranges, specific enzyme activity reach 220U/mg with On.Four kinds of aspartic dehydrogenases all reveal higher enzymatic activity in the environment table of meta-alkalescence, and enzyme activity in neutral conditions Certain enzyme activity can still be kept.Enzyme activity of four kinds of aspartic dehydrogenases in pH7.0 and 7.5 is as shown in the table.

The measurement of a Tris-HCl buffer

The measurement of b sodium phosphate buffer

Embodiment 24 produces the building of the Escherichia coli chassis strains A sp005 of aspartic acid

The building (table 5) of recombinant bacterial strain Asp005 includes following 5 step:

Table 5, aspartic acid produce bacterial strain

1, the knockout of lactic acid dehydrogenase gene ldhA gene

(1) PCR amplification of segment Δ ldhA is knocked out

The first step, with wild-type e. coli BW25113 (Coli Genetic Stock Center (CGSC) strain 7636) genomic DNA is template, carries out PCR amplification using primer ldhA-up and ldhA-2 (table 6).PCR reaction condition is such as Under: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 15s, for annealing temperature since 60 DEG C, each circulation reduces by 1 DEG C, and anneal 15s, and 72 DEG C Extend 30s, totally 10 loops back fire temperature are down to 50 DEG C；20 circulations are carried out under conditions of most suitable 55 DEG C of annealing temperature, Same annealing 15s, 72 DEG C of extension 30s；Finally in 72 DEG C of extension 7min.

Expanding obtained product 1dhA1 size is 446bp, which includes the lactic dehydrogenase of Escherichia coli BW25113 The base of the upstream encoding gene ldhA about 400 and 20, downstream base.

Second step is carried out using the genomic DNA of BW25113 as template using primer ldhA-1 and ldhA-down (table 6) PCR amplification.PCR reaction condition is as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 15s, annealing temperature are each followed since 60 DEG C Ring reduces by 1 DEG C, and anneal 15s, and 72 DEG C of extension 30s, totally 10 loops back fire temperature are down to 50 DEG C；55 DEG C of annealing temperature most suitable Under conditions of carry out 20 circulation, equally annealing 15s, 72 DEG C of extension 30s；Finally in 72 DEG C of extension 7min.

Expanding obtained product ldhA2 size is 403bp, which includes the lactic dehydrogenase of Escherichia coli BW25113 About 400, the downstream encoding gene ldhA base.

Third step, the segment ldhA1 and ldhA2 obtained using above-mentioned two step use primer ldhA-up and ldhA- as template Down (table 6) carries out fusion DNA vaccine amplification.PCR reaction condition is as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 15s, annealing temperature Since 60 DEG C, each circulation reduces by 1 DEG C, and anneal 15s, and 72 DEG C of extension 30s, totally 10 loops back fire temperature are down to 50 DEG C； 20 circulations, equally annealing 15s, 72 DEG C of extension 30s are carried out under conditions of most suitable 55 DEG C of annealing temperature；Finally extend at 72 DEG C 7min。

Expanding obtained product Δ ldhA size is 829bp, which includes the lactic dehydrogenase of Escherichia coli BW25113 Each about 400 bases in the upstream and downstream of encoding gene ldhA.

(2) building of plasmid pTargetF- Δ ldhA

The first step uses primer pTargetF-2 and pTarget- with plasmid pTargetF (being purchased from addgene) for template F-ldhAN20 (table 6) carries out PCR amplification.PCR reaction condition is as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 15s, annealing temperature from 60 DEG C of beginnings, each circulation reduce by 1 DEG C, and anneal 15s, and 72 DEG C of extension 30s, totally 10 loops back fire temperature are down to 50 DEG C；Most 20 circulations, equally annealing 15s, 72 DEG C of extension 30s are carried out under conditions of suitable 55 DEG C of annealing temperature；Finally in 72 DEG C of extension 7min.

Expanding obtained primer size is 2138bp, and product includes the cream of carrier pTargetF and Escherichia coli BW25113 20 bases near the PAM sequence of dehydrogenase-encoding gene ldhA.It will using the cycle pure kit of Omega company Obtained PCR product cleaning, recycling, is then transformed into DH5 α competent cell.Consolidating containing spectinomycin is coated on after recovery On body LB plate, 37 DEG C are incubated overnight.2-3 monoclonal is selected, extracts plasmid, and surveyed using primer pTargetF-F Sequence.Correct plasmid is sequenced and is named as pTargetF- Δ ldhA.

(3) electrotransformation of plasmid pCas

By plasmid pCas (being purchased from addgene), electrotransformation is into the competent cell of wild-type e. coli BW25113, and 30 DEG C recovery after be coated on the solid LB plate containing kanamycins, 30 DEG C are incubated overnight.

(4) knockout of ldhA

By the BW25113 containing pCas plasmid in liquid LB, 30 DEG C of cultures, and lured with the arabinose of final concentration 10mM It leads, then does competent cell.By knockout segment Δ ldhA and plasmid pTargetF- Δ ldhA corotation obtained in (1) and (2) Enter in above-mentioned competence.It after 30 DEG C of recoveries, is coated on containing kanamycin and spectinomycin solid LB plate, 30 DEG C overnight Culture.Primer ldhA-up and ldhA-down is used to carry out bacterium colony PCR verifying, correct PCR product size after obtaining monoclonal For 829bp.

(5) removal of plasmid pTargetF- Δ ldhA

One plant of correct bacterial strain of verifying in (4) is selected, it is containing kanamycin and IPTG (final concentration 0.5mM) to be inoculated into 2mL Liquid LB in.30 DEG C are incubated overnight, then plate streaking.Screening can be grown, no on LB plate containing kanamycin The monoclonal that can be grown on the LB plate containing spectinomycin again, and it is named as Asp001/pCas.

(6) removal of plasmid pCas

Strains A sp001/pCas is inoculated into 2mL liquid LB, 37 DEG C are incubated overnight.Then plate streaking obtains Dan Ke It is grand.Screening can only be in LB plated growth, the monoclonal that cannot be grown on LB plate containing kanamycin, and is named as Asp001。

Table 6, primer

2, the knockout of aldehyde-alcohol dehydrogenase adhE gene

From recombinant bacterial strain Asp001, using the present embodiment 1 part above, (lactic acid dehydrogenase gene ldhA gene is struck Except) in identical method knock out adhE gene, obtain recombination bacillus coli Asp002.The primer used is shown in Table 6, wherein primer Title corresponds to the title of used primer during knockout ldhA gene, and ldhA is only replaced with adhE.

3, the knockout of fumaric reductase frdBC gene

From recombinant bacterial strain Asp002, using the present embodiment 1 part above, (lactic acid dehydrogenase gene ldhA gene is struck Except) in identical method knock out frdBC gene, obtain recombination bacillus coli Asp003.The primer used is shown in Table 6, wherein primer Title correspond to knock out ldhA gene during used in primer title, ldhA is only replaced with into frdBC.

4, the knockout of glucose PTS permease ptsG gene

From recombinant bacterial strain Asp003, using the present embodiment 1 part above, (lactic acid dehydrogenase gene ldhA gene is struck Except) in identical method knock out ptsG gene, obtain recombination bacillus coli Asp004.The primer used is shown in Table 6, wherein primer Title corresponds to the title of used primer during knockout ldhA gene, and ldhA is only replaced with ptsG.

5, the knockout of methylglyoxal synthase mgsA gene

From recombinant bacterial strain Asp004, using the present embodiment 1 part above, (lactic acid dehydrogenase gene ldhA gene is struck Except) in identical method knock out ptsG gene, obtain recombination bacillus coli Asp005.The primer used is shown in Table 6, wherein primer Title corresponds to the title of used primer during knockout ldhA gene, and ldhA is only replaced with mgsA.

Embodiment 25. produces the building of the recombination bacillus coli of aspartic acid

1, the building of the recombinant bacterial strain of plasmid horizontal expression AspDH

From recombinant bacterial strain Asp005, expression is derived from into human pallid bacillus (Ochrobactrum respectively Anthropi) and deformation spot Serratieae (Serratia proteamaculans) aspartic dehydrogenase carrier PED31-OanAspDH (embodiment 7) and pED31-SpeAspDH (embodiment 3) electrotransformation enter the impression of recombinant bacterial strain Asp005 In state.Plasmid NdeI and BglII digestion verification is extracted, verifying correct Strain Designation is Asp006 and Asp007.

2, the building of the recombinant bacterial strain of genomic level expression OanAspDH

From recombinant bacterial strain Asp005, expression is derived to the day of anthropi (Ochrobactrum anthropi) Aspartic acid dehydrogenase gene OanAspDH is incorporated into the site pyruvate formate-lyase gene pflB of Asp005.Specific steps are such as Under:

(1) PCR amplification of segment pflB-OanAspDH is integrated

The first step uses primer pflB-up and pflB-2 (table using the genomic DNA of Escherichia coli BW25113 as template 6) PCR amplification is carried out.PCR reaction condition is as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 15s, annealing temperature since 60 DEG C, Each circulation reduces by 1 DEG C, and anneal 15s, and 72 DEG C of extension 30s, totally 10 loops back fire temperature are down to 50 DEG C；In most suitable annealing temperature 20 circulations, equally annealing 15s, 72 DEG C of extension 30s are carried out under conditions of 55 DEG C of degree；Finally in 72 DEG C of extension 7min.

Expanding obtained product pflB1 size is 340bp, which includes the pyruvate formate of Escherichia coli BW25113 The base of the upstream lyase gene pflB 340.

Second step uses primer pflB-OanaspDH-F and OanaspDH-R using plasmid pED31-OanAspDH as template (table 6) carries out PCR amplification.PCR reaction condition is as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 15s, annealing temperature are opened from 60 DEG C Begin, each circulation reduces by 1 DEG C, and anneal 15s, and 72 DEG C of extension 30s, totally 10 loops back fire temperature are down to 50 DEG C；It is moved back most suitable 20 circulations, equally annealing 15s, 72 DEG C of extension 30s are carried out under conditions of 55 DEG C of fiery temperature；Finally in 72 DEG C of extension 7min.

Expanding obtained product OanAspDH size is 827bp, which includes the pyruvic acid-of Escherichia coli BW25113 Upstream 20bp and the OanaspDH gene of formate lyase gene pflB.

Third step, using the genomic DNA of Escherichia coli BW25113 as template, using primer OanAspDH-pflB-1 and PflB-down (table 6) carries out PCR amplification.Expanding obtained product pflB2 size is 332bp, which includes OanaspDH base Because of 20bp before terminator codon and about 300, the downstream pyruvate formate-lyase gene pflB base.

4th step, using above-mentioned three obtained segment as template, using primer pflB-up and pflB-down (table 6) into The amplification of row fusion DNA vaccine, the product pflB-OanAspDH size expanded are 1459bp, which includes Escherichia coli The upstream and downstream the pyruvic acid of BW25113-formate lyase gene pflB respectively about 300 bases and OanaspDH gene.

(2) (2)~(6) method step 1 in~(6) and embodiment 22 in (knockout of lactic acid dehydrogenase gene ldhA gene) Suddenly consistent, wherein the title of plasmid and segment, which corresponds to, knocks out ldhA gene used primer and segment in the process, will only go out Bacterium germination strain BW25113 replaces with Asp005；Plasmid pTargetF- Δ ldhA is replaced with into pTargetF- Δ pflB；Piece will be knocked out Section Δ ldhA, which is replaced with, integrates segment pflB-OanAspDH.It is Asp010 by the Strain Designation of successful integration

3, the building of the recombinant bacterial strain of genomic level expression SpeAspDH, DelAspDH and KpnAspDH

From recombinant bacterial strain Asp005, using 2 part above, (genomic level expresses the recombinant bacterial strain of OanAspDH Building) in identical method SpeAspDH, DelAspDH and the KpnAspDH pyruvate formate for being incorporated into Asp005 are split respectively The site enzyme gene pflB is solved, obtains recombination bacillus coli Asp011-Asp013 respectively.The primer used is shown in Table 6, wherein primer Title correspond to integrate during OanAspDH gene used in primer title, only OanAspDH is replaced with respectively The corresponding primer of SpeAspDH, DelAspDH and KpnAspDH.

Embodiment 26. produces the building of the recombination bacillus coli of aspartic acid

1. inducible expression vector pAD is constructed

By pACYC184 (NCTT preservation), with primer pAD-15A-R (ATGATAAGCTGTCAAACATGAG, SEQ ID NO:95 it) is expanded with pAD-15A-F (TAGCACCAGGCGTTTAAGG, SEQ ID NO:96), PCR condition are as follows: 95 DEG C of initial denaturations 3min；95 DEG C of denaturation 15s, 61 DEG C of annealing 15s, 72 DEG C of extension 1min；72 DEG C of extension 7min.It is pure to obtain amplified fragments kit Change.

By pED31 carrier, with primer pED-Duet-F (catgtttgacagcttatcatGCGCCCACCGGAAGGAGC, SEQ ID NO:97) and (cccttaaacgcctggtgctaATCCGGATATAGTTCCTCCTTTCAGCAAAAAACC, SEQ ID NO:98 it) expands, PCR condition are as follows: 95 DEG C of initial denaturation 3min；95 DEG C of denaturation 15s, 70 DEG C of annealing 15s, 72 DEG C of extension 1min；72℃ Extend 7min.Obtain amplified fragments kits.

Above-mentioned segment after purification, by GibsonThe operation of Cloning Kit (NEB company) specification, is obtained Obtain pAD carrier.

The acquisition of 2.PanD gene

Using bacillus amyloliquefaciens (CGMCC 1.936) genomic DNA as template, primer panD-F and panD-R are used (table 6) is that template carries out PCR amplification, and PCR reaction condition is as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 15s, annealing temperature from 60 DEG C of beginnings, each circulation reduce by 1 DEG C, and anneal 15s, and 72 DEG C of extension 30s, totally 10 loops back fire temperature are down to 50 DEG C；? 20 circulations, equally annealing 15s, 72 DEG C of extension 30s are carried out under conditions of 55 DEG C of annealing temperature most suitable；Finally extend at 72 DEG C 7min。

3. the building of recombinant vector and bacterial strain

The site NdeI and BglII that obtained product is connected to pAD carrier is expanded, carrier pAD-panD is obtained.By carrier It converts to Asp005~Asp009, obtain strains A sp014~Asp018.

Embodiment 27 uses recombinant bacterial strain fermenting and producing aspartic acid and Beta-alanine

Seed culture medium consists of the following compositions (solvent is water)

A great number of elements: glucose 20g/L, KH₂PO₄3.5g/L, K₂HPO₄6.55g/L NH₄)₂HPO₄3.5g/L MgSO₄·7H₂O 0.12g/L, Betaine-KCl 0.15g/L, Thiamine-HCl 0.005g/L and MOPS 100mM；

Microelement: FeCl₃·6H₂O 1.5 μ g/L, CoCl₂·6H₂O 0.1 μ g/L, CuCl₂·2H₂0.1 μ g/L of O, ZnCl₂0.1 μ g/L, Na₂MoO₄.2H₂O 0.1 μ g/L, MnCl₂·4H₂O 0.2 μ g/L, H₃BO₃ 0.05μg/L。

Fermentation medium is most of identical with seed culture medium, and difference is in addition to be added to 100mM NaHCO₃And 100mM NH₄Cl。

It is utilized respectively recombinant escherichia coli strain Asp005-013 anaerobic fermentation production aspartic acid and utilizes recombination large intestine Bacillus strain Asp014-18 anaerobic fermentation produces Beta-alanine

(1) seed culture: seed culture medium is 20mL, 115 DEG C of sterilizing 20min in 100mL triangular flask.It will recombination after cooling Escherichia coli are inoculated in seed culture medium according to the inoculum concentration of 1% (v/v), the mistake under conditions of pH=7.0,37 DEG C and 200rpm Night cultivates to obtain seed liquor, is inoculated with for fermentation medium.

(2) fermentation medium: fermentation medium volume is 50mL in 100mL anaerobism bottle, by seed liquor according to final concentration OD₆₀₀=0.1 inoculum concentration is inoculated in fermentation medium, 37 DEG C stationary culture 6 days, obtain fermentation liquid.Fermentation liquid is in anaerobism bottle All substances do not lead to any gas in incubation.

Analysis method: using Agilent (Agilent-1260) high performance liquid chromatograph (HPLC) in the 6th day fermentation liquid Component be measured.1mL fermentation liquid is taken, 12000rpm is centrifuged 3min, supernatant is taken to be measured.Glucose in fermentation liquid The Aminex HPX-87H organic acid analysis column of Bole (Biorad) company is used with organic acid concentration measurement.Mobile phase is 5mM Sulfuric acid, flow velocity 0.5mL/min detected using RID detector.

It takes above-mentioned supernatant to perform the derivatization, then measures aspartic acid yield therein using HPLC.

The method of derivatization: taking 300 μ L dilutions, and the sodium borate buffer liquid of 360 μ L pH=9.5,0.05mol/L is added, Then 240 μ L derivating agents are added, are used with.Room temperature carries out HPLC detection after shaking 2min.Derivating agent by 1.3g o-phthalaldehyde, The sodium borate buffer liquid group of 0.59gN- acetylcysteine, 20mL dehydrated alcohol and 78.11mL pH=9.5,0.05mol/L At.

HPLC detection uses Agilent chromatographic column (Eclipse XDB-C18,4.6 × 150mm), mobile phase 2.871g/ The aqueous sodium acetate solution of L, flow velocity 1mL/min are detected using VWD detector in 334nm (ultraviolet).

The aspartic acid yield of recombinant escherichia coli strain Asp005-013 is as shown in figure 12.Strains A sp014-Asp018 Beta-alanine yield it is as shown in figure 13, yield is as shown in figure 14, and 0.20~0.38g/g of yield is significantly higher than document^[6]Report 0.135g/g

Embodiment 28

Through sequence alignment (Figure 15), find four kinds of sources aspartic dehydrogenase (OanAspDH, SpeAspDH, DelAspDH and KpnAspDH) sequence similarity before 35%-71%, have in the position that N-terminal starts significant auxiliary Factor NAD (P) H binding sequence GxGxxG/A.The wherein sequence phase of OanAspDH and SpeAspDH, DelAspDH and KpnAspDH It is respectively 37.1%, 35.5% and 38.6% like property.

Using SWISS-MODEL (http://www.swissmodel.expasy.org/) program, to derive from The aspartic dehydrogenase structure (PDB ID.2DC1) of Archaeoglobus fulgidus be template, to OanAspDH, SpeAspDH, DelAspDH and KpnAspDH carry out homologous modeling.It will be with using Pymol (http://www.pymol.org/) The OanAspDH three-dimensional structure of upper acquisition is compared with SpeAspDH, DelAspDH and KpnAspDH respectively, to obtain two Two comparing results are such as.Shown in Figure 17 a-c, wherein Figure 17 a is OanAspDH and SpeAspDH comparison result.Dark grey is OanAspDH, light gray are SpeAspDH；Figure 17 b is OanAspDH and DelAspDH comparison result.Dark grey is OanAspDH, Light gray is DelAspDH；Figure 17 c is OanAspDH and KpnAspDH comparison result.Dark grey is OanAspDH, and light gray is KpnAspDH.From comparison result it is found that even if the obtained similitude of aspartic dehydrogenase sequence of screening is not high, but from three Tie up whole similitude with higher in structure, difference section mainly in the region of the periphery of albumen, significant N-terminal There is higher similitude in the region that Rossmann folds module (including GxGxxG/A).

Bibliography:

[1] .Yang, Z., et al., Aspartate dehydrogenase, a novel enzyme identified From structural and functional studies of TM1643.J Biol Chem, 2003.278 (10): p.8804-8.

[2] .Yoneda, K., et al., The first archaeal L-aspartate dehydrogenase From the hyperthermophile Archaeoglobus fulgidus:gene cloning and Enzymological characterization.Biochim Biophys Acta, 2006.1764 (6): p.1087-93.

[3] .Li, Y., et al., A novel L-aspartate dehydrogenase from the Mesophilic bacterium Pseudomonas aeruginosa PAO1:molecular characterization And application for L-aspartate production.Appl Microbiol Biotechnol, 2011.90 (6): p.1953-62.

[4] .Li, Y., et al., A non-NadB type L-aspartate dehydrogenase from Ralstonia eutropha strain JMP134:molecular characterization and physiological Functions.Biosci Biotechnol Biochem, 2011.75 (8): p.1524-32.

[5] .Kuvaeva, T.M., et al., Novel NADPH Dependent L Aspartate Dehydrogenases from the Mesophilic Nitrogen Fixing Bacteria Rhodopseudomonas Palustris and Bradyrhizobium japonicum.Applied Biochemistry and Microbiology, 2013.49 (2): p.155-63.

[6] Chan W S, Lee J, Ko Y S, et al.Metabolic engineering of Escherichia Coli, for the production of 3-aminopropionic acid [J] .Metabolic Engineering, 2015,30 (3): 121.

SEQUENCE LISTING

<110>Institute of Microorganism, Academia Sinica

<120>novel aspartic dehydrogenase and the application on aspartic acid race amino acids production

<130> IB178419

<160> 102

<170> PatentIn version 3.1

<210> 1

<211> 397

<212> DNA

<213>artificial sequence

<400> 1

gactgagagt cgcatgcaat tgtgagcgga taacaattga cattgtgagc ggataacaag 60

atactgagca catcagcagg acgcactgac ccctctagaa ataattttgt ttaactttaa 120

gaaggagata tacatatgtt cgaaagatct gggtacctta attaacctag ggcggccgca 180

taatgcttaa gtcgaacaga aagtaatcgt attgtacacg gccgcataat cgaaatgagc 240

tgcaccggcg ttgacaatta atcatcggct cgtataatgt gtggaattgt gagcggataa 300

caattgaatt cctgtagaaa taattttgtt taactttaat aaggagatat accatgggca 360

gcagcggatc cgagctccgt cgacaagctt actcgag 397

<210> 2

<211> 765

<212> DNA

<213>Klebsiella pneumoniae (Klebsiella pneumoniae)

<400> 2

atgaaaaaag taatgctgat tggttacggc gcaatggctc aggcagttat cgaacgtctg 60

ccgccgcagg tacgcgttga atggatcgtt gcacgcgaga gccatcacgc ggctatctgt 120

ctgcaattcg gccaggcggt aaccccgctg actgatccgc tgcagtgcgg tggcaccccg 180

gacctggttc tggaatgcgc tagccagcag gctgttgctc agtacggtga ggcggtactg 240

gctcgtggct ggcacctggc tgtaatctct accggtgcac tggcggactc cgaactggaa 300

cagcgtctgc gccaagcggg tggtaagctg accctgctgg ctggtgcagt ggctggtatc 360

gatggccttg cggctgctaa agagggcggt ctggaacgcg taacctaccg ctctcgtaag 420

tctccggcat cttggcgtgg ttcttacgca gaacagctga tcgatctgtc cgctgtaaac 480

gaggctaaaa tcttctttga aggttctgcg cgcgaagcgg cacgtctgtt cccggctaac 540

gctaacgttg ctgcaaccat cgcactgggt ggtatcggtc tggatgcaac ccgtgttcag 600

ctcatggtag acccggctac ccagcgtaac acccataccc tgcatgctga aggtctgttc 660

ggcgaatttc acctggaact gtctggtctg ccgctggctt ctaacccaaa aacttctacc 720

ctggcagctc tgtctgctgt gcgtgcttgt cgcgaactgg cttaa 765

<210> 3

<211> 798

<212> DNA

<213>Dell's Ford bacterium Cs1-4(Delftia sp. Cs1-4)

<400> 3

atgaacatcg ctgtaatcgg ttgcggtgcg attggcgcgt ctgtactgga actgctgaag 60

ggtcacgctg cggttcaggt gggctgggtt ctggttccgg aagttaccga cgctgtacgt 120

gcaaccctgg cacgtcatgc gccgcaggca cgcgctctgc cagcactgac caccgaagac 180

cgtccggacc tgatcgttga atgtgcaggt cacactgcta tcgaagagca cgtactgccg 240

gcgctgcgcc gtggcatccc ggctgtagtg gctagcatcg gtgctctgag cgctccgggt 300

atggcagaag cagtgcaggc agcagctgag gctggtggta ctcaggtaca gctgctgtcc 360

ggtgctatcg gcggtgttga tgcactggct gctgctcgta tcggcggtct ggacgaagta 420

gtttacactg gccgtaaacc accgctggct tggaccggta ctccggctga acagcgttgc 480

gatcttgcga gcctgaaaga ggcattttgc atcttcgaag gctccgcacg tgaagctgct 540

cagctgtacc caaaaaacgc gaatgtggca gctaccctgt ctctggcggg catgggtctg 600

gatcgcacta ccgtgcgtct gtacgcagat ccagcagtgg atgaaaacgt acaccatgta 660

gcggctcgcg gcgcgttcgg ttctatggaa ctgactatgc gtggtaaacc gctggaagcg 720

aacccgaaga cctctgctct gaccgtatac tctgtagtgc gtgcggttct gaaccaggct 780

accgcaatcg ctatctaa 798

<210> 4

<211> 798

<212> DNA

<213>salt color salt bacillus (Chromohalobacter salexigens) is needed

<400> 4

atgactgcga aaaccgttat gatgatcggt tacggtgcaa tgggccgtgc agtacacgaa 60

ctgctgccga gcggcctggc actccgttgg gtagttgttc cagaactctc tgttgcggaa 120

actgttgctc gtctgggcca ggacgttgaa gtaatgactt ctgttgatac ttgccgcgaa 180

cgtccggacc tggttgttga atgcgctggc caggctggcc tggctgaaca cggcggcgca 240

gttctggcac gtggctggtc cctggctgtt gtttctgtgg gtgcgctggc agatgacgca 300

ctgtatggtc gtctgcatga cgcagctcgt cgctccggtg gcaaactcca cgtgctggct 360

ggcgctgttg cgggtatgga cggtctggct gcagctcgcg agggcggcct cgaatccgta 420

acttacgagg ctcgcaaagc accggcaagc tggcgtggtt cccacgctga agaactggtg 480

gatctggacg cggtaaccca gccgaccgtg ttctttgaag gttctgcggg cgacgctgca 540

cgccgttttc cggctaacgc aaacgttgcg gcaaccgtag cactggctgg tctgggcatg 600

gaaaacacta ccgttcgcct gaccgttgac ccagacacca ctcgcaacac tcaccgcatc 660

cacgcgcgtg gccacttcgg tgagttcgaa atcgaactgt ccggttaccc gctggcatct 720

aacccgaaaa ccagcactct ggcggctctc tctgttgttc gtgcttgccg tcaggtactg 780

gaaccggttg ttgtataa 798

<210> 5

<211> 792

<212> DNA

<213>Acinetobacter baumannii (Acinetobacter baumannii)

<400> 5

atgaaaaaac tgatgatgat tggcttcggt gctatggcgg cagaagttta cgcacacctg 60

ccgcaggacc tgcagctgaa atggatcgtt gttccaagcc gttccatcga aaaggtacag 120

agccaggttt cctctgacat tcaggttatc tccgacattg aacagtgcga tggcactccg 180

gactacgtaa tcgaggttgc tggccaggcg gctgttaaag agcacgcaca gaaagttctg 240

gcaaaaggct ggaccattgg tctgatctct gttggcaccc ttgctgactc tgaatttctg 300

gttcagctga aacagactgc ggagaaaaac gacgcgcacc tgcacctcct cgcgggtgct 360

atcgctggca tcgatggcat ctccgcagca aaagaaggcg gcctgcagaa agtaacttat 420

aaaggttgca aaagcccgaa atcctggaaa ggctcctacg cagaacagct ggtagacctg 480

gatcacgttt ctgagccgac tgttttcttc accggtaccg ctcgtgaagc tgcaatgaaa 540

ttcccagcta acgctaacgt agctgctacc atcgcgctgg cgggtctggg catggacgaa 600

actatggtag aactgaccgt agatccgacc atcaacaaaa acaagcacac catcgttgca 660

gaaggtggtt tcggccagat gactattgaa ctggttggtg ttccgctgcc gtccaacccg 720

aaaaccagca ccctggctgc tctgtccgtt attcgtgcgt gccgtaactc tgtagaagct 780

atccagattt aa 792

<210> 6

<211> 795

<212> DNA

<213>spot Serratieae (Serratia proteamaculans) is deformed

<400> 6

atgaaaaaaa tcatgatgat cggttatggc gcgatggctc gtgaggtact gtctcgtctg 60

ccggatggcg tttccgttgg ctggattctg gctcgtgctg ctcaccacgc agctatcgat 120

agcgctttcg gtggtcaggt tcaggctctg actcacccgg atcagtgcac tgagcaacca 180

gacctggtac tggaatgcgc atcccagcaa gcggttgcgg aatttggtga agctgttgtt 240

acccgtggtt ggccgctggc ggttatttcc accggcgctc tggcagacgc agctctgcag 300

cagcgtctgc agcaggcgtg ccgtcagcac caaggtcagc tcatcgttct gagcggcgca 360

gttgctggta tggatggtct ggctagcgct cgtgaaggcg gtctggattc tgttacttat 420

caggcttgta aatctccggc atcttggcgt ggttccatgg ctgagcagct gatcgacctg 480

gacgctgttt ccgaagcgca ggttttcttc gaaggtagcg ctcgtgaagc tgctcgcctc 540

ttcccggcta acgctaacgt tgcagctacc atcgctctga acggcctggg catggacgca 600

actcgtgtac gtctgctggt agacccggca acccgtcgta acacccatcg tctccaagta 660

tgcggtaact tcggtgagtt ccagatcgaa ctgtctggca acccactggc gtctaacccg 720

aaaacctcta ccctggcggc actgtccgcg gtacaggctt gccgtcgtct ggtagacggt 780

ggctttatcg cataa 795

<210> 7

<211> 807

<212> DNA

<213>human pallid bacillus (Ochrobactrum anthropi)

<400> 7

atgtccgtat ctgaaaccat cgttctggtt ggctggggcg cgatcggcaa acgcgtagcg 60

gatctgctgg ctgaacgcaa atcctctgtt cgcatcggtg ctgttgcagt acgtgatcgc 120

tctgcgtccc gcgaccgtct gccggctggt gctgttctga ttgaaaaccc ggctgaactg 180

gcggcatctg gtgcatctct ggtagtggag gctgctggtc gtccgagcgt tctgccgtgg 240

ggcgaagcag cactgtctac tggcatggat ttcgcggtta gctccactag cgcattcgta 300

gatgacgctc tgtttcagcg cctgaaagat gctgcggcgg ctagcggtgc gaaactgatc 360

atcccgccgg gtgctctggg tggtattgac gcgctctctg ctgcatctcg tctttccatc 420

gaatctgtag aacaccgtat catcaaaccg gcaaaagcat gggctggtac ccaggcagca 480

cagctggttc cactggatga aatctctgaa gcaaccgtat tctttaccga caccgctcgt 540

aaagcagctg acgctttccc gcagaacgct aacgttgctg ttatcacctc tctggctggt 600

attggtcttg accgtacccg cgttactctg gttgcggacc ctgctgcgcg cctgaacacc 660

cacgaaatca tcgcagaagg tgacttcggt cgtatgcatc tgcgtttcga aaacggtccg 720

ctggcgacta acccgaaatc ttctgaaatg accgctctta acctggtgcg cgctatcgaa 780

aaccgcgtag caactaccgt tatctga 807

<210> 8

<211> 813

<212> DNA

<213>shank bacterium (Caulobacter sp.)

<400> 8

atggaacgtc gcgttgcact catcggtctg ggcaccatcg gtgcttctgt tgctgcacag 60

tggcgtctcc gtccgccgcg tgacatgcgt ctggcagcgg tttgcgttcg tccgggtcgt 120

gctcaggcag ctcgtgctgc actgccggct ggtgtagcaa tcgttaccca agtagaagac 180

ctgatcgcgc tggctccgga cattgtaatc gagactgcag gtcacgctgg tctggaggcg 240

tggggtgaaa ccgcactggc ttgccgtgcg gctctgtacg ttctgagcgt tggcgcgctg 300

gctgacgaag cgctgcgtgc taagctcgta gacgcagcag cgcgtcacgg cggtcagatt 360

tgcgttccgg cgggtgctct ggcaggcttt gatggtctgc gtagcctggc acgttctggt 420

ctggaatggg ctcgctacac cagcactaaa ccgccggcag cttggcgtga caccccggct 480

gaagcgctga tcgacctgaa caccctgagc gtaccgactg taatcttcga aggtagcgct 540

gctcgtgctg ctcagctgta cccgcgcaac gcgaacctgg ctgctgctgt tgctctggcg 600

ggcctgggtt tcgaccagac tgaagtacgt ctcgtagcag acccagcggc actgggtaat 660

agcgcgctga tcgaagcacg tggtggtggc gcacgtctgc gtgctgaact ggcaggtgaa 720

gcatccccgg ataacccaaa aactagcgct atcgtagctc attctgtact ggcagctctc 780

gacaacgaaa ccgctatcgt tcgcttcgca taa 813

<210> 9

<211> 816

<212> DNA

<213>geneva methane Halophiles (Methanohalophilus mahii)

<400> 9

atgctgaaaa tcggtgtttt cggttgcggt gcaatcggtg gtgagatttg ccgtgctatc 60

gacaacggcc agatcgaagc ggagctgtac gcaatctacg accgccacga cgaatctctg 120

aaccgtgtta agagcagcct ggaaaacttc gacccgcaga tcatggaaat tgttgaaatg 180

gttcgtgaag ttgatctggt tgtagaatgc gctagccagc aggcggtgta cgaagtagta 240

ccgaccgcgc tgcacgcaaa atgtgacgtg atggtagttt ctgttggtgc attcgctgac 300

actcagctgc tggaaatgac cgaaaacatc gcacgtgaaa agaactgccg tatctacgta 360

ccgtctggcg caatctgcgg cattgacggt ctgatctctg cgagcgcagc tggtctgcac 420

tccgttaccc tgactaccga aaagccgccg ggtggcctgc gtggtgctcc attcgtgctg 480

gaaaacaaca tcgacattga ctctatcacc ggccgcactg ttctgttcga gggctctgcg 540

actgaagcag ttcaggcttt cccggcaaac gtaaacgtag ctgcgactct gtccctggct 600

ggtatcggtt tcgataacac tcgcgtacgt atcgttgtga acccggctct gactcgcaac 660

attcacgaaa tcgcggttga gggcgagttc ggtcgtttta cctctcgtgt tgaaaacgta 720

ccatctccga ctaatccgaa aacttcttat ctggctccac tctctgttat cagcaccctg 780

aaaaaactga ctcagtcctt caatgttggc acctaa 816

<210> 10

<211> 762

<212> DNA

<213>ocean Chai Shi rose bacillus (Dinoroseobacter shibae)

<400> 10

atgcgtctgg cgctgatcgg tctgggtgct atcaaccgtg cagttgcagc tggtatggcg 60

ggtcaggcgg aaatggtagc tctgacccgt tccggtgcag aggctccggg cgtgatggcg 120

gtatctgacc tgtccgcact gcgtgttttc gcgccggacc tggttgttga ggctgctggc 180

cacggtgcgg cacgtgcata tctgccgggc ctgctggcag ctggtatcga tgttctcatg 240

gcatccgtag gcgttctggc tgacccagaa accgaagctg cattccgtgc tgctccggca 300

cacggcgcgc agctgactat cccggcgggt gcgatcggtg gtctggacct gctggcggct 360

ctgccaaaag actccctgcg cgcagtacgt tacactggtg tgaaaccacc ggcggcttgg 420

gctggtagcc cggctgctga cggtcgcgac ctgagcgcgc tcgacggccc ggttaccctg 480

ttcgaaggca ccgctcgtca agcggctctg cgcttcccga acaacgcgaa cgtagcagcg 540

accctggctc tggctggtgc gggcttcgac cgtaccgagg ctcgtctggt tgctgatccg 600

gacgcagctg gtaacggtca tgcatacgac gttatttctg acaccgcaga aatgactttc 660

tccgtacgtg ctcgtccgtc tgatactccg ggcacctctg cgaccaccgc aatgtccctg 720

ctgcgcgcta tccgtaaccg tgatgcagca tgggtggttt aa 762

<210> 11

<211> 909

<212> DNA

<213>acidophilus methanogen (Methanosphaerula palustris)

<400> 11

atggtaatgg ttggtatgca gggtcgcggc gttgctgtga ccggcgcaca gtacggcatt 60

gacgtactga tcggtaaagg ttccgctcag gaagacgata acggtcgtct gcacgcggca 120

ttcatcggtg gtgaagacca cagctcttcc gttctgcgtg ttggtctgct gggctgcggc 180

aacatcggtt tcctcatcgc tgcacacgca gacggcttcg aagtagcagc tctctacgac 240

caagctccgg gcctggcacc ggaactggcg ggccgttgcg gtggtaccgc gtacgactct 300

ttcgagacct tcgtatctgc tgacgttgac ctggtagttg aagcggcaag cccggctgct 360

gttcgcgttt acggtgaagc agtactgcgt gcaggtaaag acctggttgt aatgagcgta 420

ggcgctctgg ctgacccggc tgttctgggt cgcctgcgtg aagctgcgat cgctagcggt 480

cgtcgtgttc gcatcccgtc tggtgctgtt atgggtctgg ataacctgaa aatcggtcgt 540

atcggtggca tcgaccgtct ggttctgcgt actaccaaga acccggctag ccttggtctg 600

accgttgcag aacgtgttct ggtgttcaag ggccgtgcgg aagaatgtgt gcgtgctttc 660

ccgaaaaaca tcaacgtttc tgctgcaatt gctatcgctg ctggtcaaga aatcgaagtt 720

gagctgtggg cagatccgac cgttgatcgt aacatccacg aaattttcgc tgagggtccg 780

ttcggtgacg cgtgcctgca ggttcgtaac gttccgtctc cggacaaccc ggcgacttct 840

tatcttgctg ctctgtccgt tctgactctg ctgcgtgatc tgtccgaacc gatcgttgtg 900

ggcacttaa 909

<210> 12

<211> 762

<212> DNA

<213>cud methane brevibacterium (Methanobrevibacter ruminantium)

<400> 12

atgatcgttg gtattctggg ttgcggtgca atcgctaaca ctatcgtaaa cgagtttctg 60

tccgatgacg gtatcgatat caaatacttc tacgataccg acatcgaacg tgcagaaaac 120

ctcgcacaga tttctaacgg tatcgcggta ctggaaatgg acgagatgct ggacaacgta 180

gacctggtac tggaatccgc ttccccgatt gcactgaagg tacatgctct gaacatcatc 240

gaaaacggca aagacctgat ggttatgtct gttggtgcac tgatggacaa agaatttcgc 300

cagaaaatcc acaaagctgc tcaggcgaac aacgctaaag tttacgctcc gagcggcgca 360

atcgtaggtc tggacggcat caaagcagct agcattggca aaatcaagaa agcatccctg 420

accacccgca aatctccgaa atctctgggt cgcgaagttg aggaagaaga aatcctgttc 480

gagggtaaag caagcgaagc ggtagaacgt tttccggtaa acatcaacgt agcggcttct 540

ctgagcatcg cttgcaacat ggacatcgac gttaaaatca tcgtagaccc gaaagttgac 600

cgtaacgttc atgaagttct ggtacagggc gacttcggcg agttccgttc ttctagcgaa 660

aacgttccat tcgcagctaa cccgaaaacc tctatgctgg cggcttttag cgctatcaaa 720

ctgctgaaat ctttcagcga atgcttcagc gttggcactt aa 762

<210> 13

<211> 381

<212> DNA

<213> Roseibacterium elongatum

<400> 13

atgcgctacc aaggggtcaa accgcccgcc gcctggctgg gcacggcggc cgaggcaagc 60

ctcgatctgg atcggctgga tgcgcccacg gcctttttca acggctcggc gcgcgaggcc 120

gcgttgacgt accccaagaa cgccaatgtt gcggcgacct tggcgctggc gggggcgggg 180

ttggatgcaa cccgggtcga actgatcgcg gaccccgccg cgaccggcaa ccgccacagc 240

tacgaggtga cctcgcccgt ggcgcggttc cgggtgcaga tcgacaacgc ggcgtcgggc 300

ggcaatgcca agacatccat ggccacgatc tacagcctgc tgcgcgagat caaccgccgc 360

cgcagaccgg tggtgatctg a 381

<210> 14

<211> 31

<212> DNA

<213>artificial sequence

<400> 14

tatacatatg aaaaaagtaa tgctgattgg t 31

<210> 15

<211> 31

<212> DNA

<213>artificial sequence

<400> 15

tacccagatc tttaagccag ttcgcgacaa g 31

<210> 16

<211> 32

<212> DNA

<213>artificial sequence

<400> 16

tatacatatg aaaaaaatca tgatgatcgg tt 32

<210> 17

<211> 29

<212> DNA

<213>artificial sequence

<400> 17

tacccagatc tttatgcgat aaagccacc 29

<210> 18

<211> 28

<212> DNA

<213>artificial sequence

<400> 18

tatacatatg actgcgaaaa ccgttatg 28

<210> 19

<211> 30

<212> DNA

<213>artificial sequence

<400> 19

tacccagatc tttatacaac aaccggttcc 30

<210> 20

<211> 29

<212> DNA

<213>artificial sequence

<400> 20

tatacatatg aaaaaactga tgatgattg 29

<210> 21

<211> 32

<212> DNA

<213>artificial sequence

<400> 21

tacccagatc tttaaatctg gatagcttct ac 32

<210> 22

<211> 30

<212> DNA

<213>artificial sequence

<400> 22

tatacatatg aacatcgctg taatcggttg 30

<210> 23

<211> 31

<212> DNA

<213>artificial sequence

<400> 23

tacccagatc tttagatagc gattgcggta g 31

<210> 24

<211> 25

<212> DNA

<213>artificial sequence

<400> 24

tatacatatg tccgtatctg aaacc 25

<210> 25

<211> 29

<212> DNA

<213>artificial sequence

<400> 25

tacccagatc ttcagataac ggtagttgc 29

<210> 26

<211> 26

<212> DNA

<213>artificial sequence

<400> 26

tatacatatg gaacgtcgcg ttgcac 26

<210> 27

<211> 32

<212> DNA

<213>artificial sequence

<400> 27

tacccagatc tttatgcgaa gcgaacgata gc 32

<210> 28

<211> 28

<212> DNA

<213>artificial sequence

<400> 28

tatacatatg ctgaaaatcg gtgttttc 28

<210> 29

<211> 30

<212> DNA

<213>artificial sequence

<400> 29

tacccagatc tttaggtgcc aacattgaag 30

<210> 30

<211> 25

<212> DNA

<213>artificial sequence

<400> 30

tatacatatg cgtctggcgc tgatc 25

<210> 31

<211> 32

<212> DNA

<213>artificial sequence

<400> 31

tacccagatc tttaaaccac ccatgctgca tc 32

<210> 32

<211> 26

<212> DNA

<213>artificial sequence

<400> 32

tatacatatg gtaatggttg gtatgc 26

<210> 33

<211> 30

<212> DNA

<213>artificial sequence

<400> 33

tacccagatc tttaagtgcc cacaacgatc 30

<210> 34

<211> 26

<212> DNA

<213>artificial sequence

<400> 34

tatacatatg atcgttggta ttctgg 26

<210> 35

<211> 30

<212> DNA

<213>artificial sequence

<400> 35

tacccagatc tttaagtgcc aacgctgaag 30

<210> 36

<211> 25

<212> DNA

<213>artificial sequence

<400> 36

tatacatatg cgctaccaag gggtc 25

<210> 37

<211> 30

<212> DNA

<213>artificial sequence

<400> 37

tacccagatc ttcagatcac caccggtctg 30

<210> 38

<211> 804

<212> DNA

<213> Pseudomonas aeruginosa

<400> 38

atgctgaata tcgtcatgat cggctgcggc gccatcggcg ccggcgtcct ggaactgttg 60

gagaacgatc cgcaactgag ggtcgatgcg gtgatcgttc ctcgcgactc cgagacccag 120

gtccgccatc gcctggccag cctgcgccgg ccgccgcggg tactcagcgc gctgccggcc 180

ggagagcgcc ccgatcttct ggtggagtgc gccgggcacc gcgccatcga gcagcacgtg 240

ctgccggcgc tggcccaagg cattccctgc ctggtggtct cggtgggcgc gctgtccgag 300

ccgggcctgg tggagcgcct ggaagccgcg gcgcaggccg gaggcagccg catcgagctg 360

ctgcccggcg ccatcggcgc catcgatgcg ctgtcggcgg ccagggtcgg tggcctcgaa 420

tcggtgcgct acaccgggcg caagccggcg agcgcctggc tgggcacgcc aggcgagacg 480

gtctgcgacc tgcagcgcct ggagaaggcg cgggtgatct tcgacggcag cgcccgcgag 540

gcggcgcggc tctatccgaa gaacgccaat gtcgccgcca ccctgtcgct cgccggcctc 600

ggcctggacc gcacccaggt gcgcctgatc gccgaccccg aaagctgcga gaacgtgcac 660

caggtggaag ccagcggcgc cttcggcggc ttcgaactga ccttgcgcgg caaaccgctg 720

gcggccaacc cgaagacatc ggcgctgacc gtgtacagcg tggtccgagc gttgggcaac 780

cacgcccacg cgatttcgat ctag 804

<210> 39

<211> 29

<212> DNA

<213>artificial sequence

<400> 39

tatacatatg ctgaatatcg tcatgatcg 29

<210> 40

<211> 31

<212> DNA

<213>artificial sequence

<400> 40

tacccagatc tctagatcga aatcgcgtgg g 31

<210> 41

<211> 807

<212> DNA

<213> Ralstonia eutropha

<400> 41

atgtccatgc tgcatgtgtc catggtggga tgcggcgcga tcggccgtgg cgtgctggag 60

ctgctgaagg cggatcccga tgtcgcgttc gacgtggtga tcgtgccgga aggccagatg 120

gatgaggcac gcagcgcgct gtccgcgctc gcgcccaacg tccgtgtggc cacgggcctc 180

gacggtcagc gccccgacct gctggtcgag tgcgcgggcc accaggcgct cgaagagcac 240

atcgtgccgg cgctcgagcg cggcatcccg tgcatggtgg tgtcggtcgg cgcgctgtcc 300

gagccgggcc tggtcgagcg gctggaagcc gccgcgcgcc gcggcaacac gcaagtgcaa 360

ctgctgtccg gcgcgatcgg tgcgatcgac gcgctggccg cggcacgtgt gggcggcctc 420

gacgaggtca tctacaccgg ccgcaagccg gcgcgcgcct ggaccggcac gccggccgcc 480

gagctgttcg acctggaagc cctgaccgag cccacggtga tcttcgaagg caccgcgcgc 540

gacgcggccc gcctgtaccc gaagaacgcc aacgtggcgg ccacggtatc gctggccggc 600

ctcgggctgg atcgcacttc ggtgcggctg ctggccgacc cgaatgccgt ggagaacgtc 660

caccacatcg aagcacgtgg cgcgttcggc ggcttcgagc tgaccatgcg cggcaagccg 720

ctcgcggcca accccaagac ttcggcgctg acggtgttca gcgtggtgcg cgcactgggc 780

aaccgggcgc acgcggtatc gatctga 807

<210> 42

<211> 27

<212> DNA

<213>artificial sequence

<400> 42

tatacatatg tccatgctgc atgtgtc 27

<210> 43

<211> 31

<212> DNA

<213>artificial sequence

<400> 43

tacccagatc ttcagatcga taccgcgtgc g 31

<210> 44

<211> 25

<212> DNA

<213>artificial sequence

<400> 44

tatacatatg tccgtatctg aaacc 25

<210> 45

<211> 50

<212> DNA

<213>artificial sequence

<400> 45

tacccagatc ttcagtggtg gtggtggtgg tggataacgg tagttgctac 50

<210> 46

<211> 31

<212> DNA

<213>artificial sequence

<400> 46

tatacatatg aaaaaagtaa tgctgattgg t 31

<210> 47

<211> 49

<212> DNA

<213>artificial sequence

<400> 47

tacccagatc tttagtggtg gtggtggtgg tgagccagtt cgcgacaag 49

<210> 48

<211> 32

<212> DNA

<213>artificial sequence

<400> 48

tatacatatg aaaaaaatca tgatgatcgg tt 32

<210> 49

<211> 47

<212> DNA

<213>artificial sequence

<400> 49

tacccagatc tttagtggtg gtggtggtgg tgtgcgataa agccacc 47

<210> 50

<211> 30

<212> DNA

<213>artificial sequence

<400> 50

tatacatatg aacatcgctg taatcggttg 30

<210> 51

<211> 49

<212> DNA

<213>artificial sequence

<400> 51

tacccagatc tttagtggtg gtggtggtgg tggatagcga ttgcggtag 49

<210> 52

<211> 36

<212> DNA

<213>artificial sequence

<400> 52

actagtatta tacctaggac tgagctagct gtcaag 36

<210> 53

<211> 22

<212> DNA

<213>artificial sequence

<400> 53

attaccgcct ttgagtgagc tg 22

<210> 54

<211> 20

<212> DNA

<213>artificial sequence

<400> 54

gataacggag atcgggaatg 20

<210> 55

<211> 20

<212> DNA

<213>artificial sequence

<400> 55

tctggaaaaa ggcgaaacct 20

<210> 56

<211> 41

<212> DNA

<213>artificial sequence

<400> 56

aggtttcgcc tttttccaga tttgtgctat aaacggcgag t 41

<210> 57

<211> 20

<212> DNA

<213>artificial sequence

<400> 57

ctttggctgt cagttcacca 20

<210> 58

<211> 59

<212> DNA

<213>artificial sequence

<400> 58

tcctaggtat aatactagtc agagagaagt tagcatcacg ttttagagct agaaatagc 59

<210> 59

<211> 21

<212> DNA

<213>artificial sequence

<400> 59

catgctaatg tagccaccaa a 21

<210> 60

<211> 20

<212> DNA

<213>artificial sequence

<400> 60

tccggctaaa gctgagaaaa 20

<210> 61

<211> 40

<212> DNA

<213>artificial sequence

<400> 61

ttttctcagc tttagccgga gtgcgttaag ttcagcgaca 40

<210> 62

<211> 20

<212> DNA

<213>artificial sequence

<400> 62

ttgcaccacc atccagataa 20

<210> 63

<211> 59

<212> DNA

<213>artificial sequence

<400> 63

tcctaggtat aatactagtt atgcggcttt aaccatgccg ttttagagct agaaatagc 59

<210> 64

<211> 20

<212> DNA

<213>artificial sequence

<400> 64

tgcagaaaac catcgacaag 20

<210> 65

<211> 20

<212> DNA

<213>artificial sequence

<400> 65

gccaccatcg taatcctgtt 20

<210> 66

<211> 40

<212> DNA

<213>artificial sequence

<400> 66

aacaggatta cgatggtggc atagcgcacc acctcaattt 40

<210> 67

<211> 20

<212> DNA

<213>artificial sequence

<400> 67

caccaatcag cgtgacaact 20

<210> 68

<211> 59

<212> DNA

<213>artificial sequence

<400> 68

tcctaggtat aatactagtg accagcggta gctcaggtcg ttttagagct agaaatagc 59

<210> 69

<211> 20

<212> DNA

<213>artificial sequence

<400> 69

gaagaactgg cgcaggtaac 20

<210> 70

<211> 20

<212> DNA

<213>artificial sequence

<400> 70

cctgaaaacc gagatggatg 20

<210> 71

<211> 40

<212> DNA

<213>artificial sequence

<400> 71

catccatctc ggttttcagg catcagcgat ttaccgacct 40

<210> 72

<211> 20

<212> DNA

<213>artificial sequence

<400> 72

aaggaaacgc cgttaatcct 20

<210> 73

<211> 59

<212> DNA

<213>artificial sequence

<400> 73

tcctaggtat aatactagtg aaaacctgac ctgctgcgtg ttttagagct agaaatagc 59

<210> 74

<211> 20

<212> DNA

<213>artificial sequence

<400> 74

cagctcatca accaggtcaa 20

<210> 75

<211> 20

<212> DNA

<213>artificial sequence

<400> 75

agcgttatct cgcggaccgt 20

<210> 76

<211> 40

<212> DNA

<213>artificial sequence

<400> 76

acggtccgcg agataacgct aagtgcgagt cgtcagttcc 40

<210> 77

<211> 20

<212> DNA

<213>artificial sequence

<400> 77

aaaagccgtc acgttattgg 20

<210> 78

<211> 59

<212> DNA

<213>artificial sequence

<400> 78

tcctaggtat aatactagtc atcgcgttga cgttcatgcg ttttagagct agaaatagc 59

<210> 79

<211> 20

<212> DNA

<213>artificial sequence

<400> 79

agcgttcatt atggtgctgc 20

<210> 80

<211> 37

<212> DNA

<213>artificial sequence

<400> 80

gcaactaccg ttatctgatt agatttgact gaaatcg 37

<210> 81

<211> 23

<212> DNA

<213>artificial sequence

<400> 81

gtaacaccta ccttcttaag tgg 23

<210> 82

<211> 38

<212> DNA

<213>artificial sequence

<400> 82

cttaagaagg taggtgttac atgtccgtat ctgaaacc 38

<210> 83

<211> 23

<212> DNA

<213>artificial sequence

<400> 83

tcagataacg gtagttgcta cgc 23

<210> 84

<211> 20

<212> DNA

<213>artificial sequence

<400> 84

cgcggttatg acaatacagg 20

<210> 85

<211> 59

<212> DNA

<213>artificial sequence

<400> 85

tcctaggtat aatactagtc atcgtattcc ggagtacgcg ttttagagct agaaatagc 59

<210> 86

<211> 43

<212> DNA

<213>artificial sequence

<400> 86

cttaagaagg taggtgttac atgaaaaaaa tcatgatgat cgg 43

<210> 87

<211> 21

<212> DNA

<213>artificial sequence

<400> 87

ttatgcgata aagccaccgt c 21

<210> 88

<211> 38

<212> DNA

<213>artificial sequence

<400> 88

cggtggcttt atcgcataat tagatttgac tgaaatcg 38

<210> 89

<211> 40

<212> DNA

<213>artificial sequence

<400> 89

cttaagaagg taggtgttac atgaacatcg ctgtaatcgg 40

<210> 90

<211> 23

<212> DNA

<213>artificial sequence

<400> 90

ttagatagcg attgcggtag cct 23

<210> 91

<211> 39

<212> DNA

<213>artificial sequence

<400> 91

ctaccgcaat cgctatctaa ttagatttga ctgaaatcg 39

<210> 92

<211> 42

<212> DNA

<213>artificial sequence

<400> 92

cttaagaagg taggtgttac atgaaaaaag taatgctgat tg 42

<210> 93

<211> 23

<212> DNA

<213>artificial sequence

<400> 93

ttaagccagt tcgcgacaag cac 23

<210> 94

<211> 39

<212> DNA

<213>artificial sequence

<400> 94

cttgtcgcga actggcttaa ttagatttga ctgaaatcg 39

<210> 95

<211> 22

<212> DNA

<213>artificial sequence

<400> 95

atgataagct gtcaaacatg ag 22

<210> 96

<211> 19

<212> DNA

<213>artificial sequence

<400> 96

tagcaccagg cgtttaagg 19

<210> 97

<211> 38

<212> DNA

<213>artificial sequence

<400> 97

catgtttgac agcttatcat gcgcccaccg gaaggagc 38

<210> 98

<211> 54

<212> DNA

<213>artificial sequence

<400> 98

cccttaaacg cctggtgcta atccggatat agttcctcct ttcagcaaaa aacc 54

<210> 99

<211> 254

<212> PRT

<213>Klebsiella pneumoniae (Klebsiella pneumoniae)

<400> 99

Met Lys Lys Val Met Leu Ile Gly Tyr Gly Ala Met Ala Gln Ala Val

1 5 10 15

Ile Glu Arg Leu Pro Pro Gln Val Arg Val Glu Trp Ile Val Ala Arg

20 25 30

Glu Ser His His Ala Ala Ile Cys Leu Gln Phe Gly Gln Ala Val Thr

35 40 45

Pro Leu Thr Asp Pro Leu Gln Cys Gly Gly Thr Pro Asp Leu Val Leu

50 55 60

Glu Cys Ala Ser Gln Gln Ala Val Ala Gln Tyr Gly Glu Ala Val Leu

65 70 75 80

Ala Arg Gly Trp His Leu Ala Val Ile Ser Thr Gly Ala Leu Ala Asp

85 90 95

Ser Glu Leu Glu Gln Arg Leu Arg Gln Ala Gly Gly Lys Leu Thr Leu

100 105 110

Leu Ala Gly Ala Val Ala Gly Ile Asp Gly Leu Ala Ala Ala Lys Glu

115 120 125

Gly Gly Leu Glu Arg Val Thr Tyr Arg Ser Arg Lys Ser Pro Ala Ser

130 135 140

Trp Arg Gly Ser Tyr Ala Glu Gln Leu Ile Asp Leu Ser Ala Val Asn

145 150 155 160

Glu Ala Lys Ile Phe Phe Glu Gly Ser Ala Arg Glu Ala Ala Arg Leu

165 170 175

Phe Pro Ala Asn Ala Asn Val Ala Ala Thr Ile Ala Leu Gly Gly Ile

180 185 190

Gly Leu Asp Ala Thr Arg Val Gln Leu Met Val Asp Pro Ala Thr Gln

195 200 205

Arg Asn Thr His Thr Leu His Ala Glu Gly Leu Phe Gly Glu Phe His

210 215 220

Leu Glu Leu Ser Gly Leu Pro Leu Ala Ser Asn Pro Lys Thr Ser Thr

225 230 235 240

Leu Ala Ala Leu Ser Ala Val Arg Ala Cys Arg Glu Leu Ala

245 250

<210> 100

<211> 265

<212> PRT

<213>Dell's Ford bacterium Cs1-4(Delftia sp. Cs1-4)

<400> 100

Met Asn Ile Ala Val Ile Gly Cys Gly Ala Ile Gly Ala Ser Val Leu

1 5 10 15

Glu Leu Leu Lys Gly His Ala Ala Val Gln Val Gly Trp Val Leu Val

20 25 30

Pro Glu Val Thr Asp Ala Val Arg Ala Thr Leu Ala Arg His Ala Pro

35 40 45

Gln Ala Arg Ala Leu Pro Ala Leu Thr Thr Glu Asp Arg Pro Asp Leu

50 55 60

Ile Val Glu Cys Ala Gly His Thr Ala Ile Glu Glu His Val Leu Pro

65 70 75 80

Ala Leu Arg Arg Gly Ile Pro Ala Val Val Ala Ser Ile Gly Ala Leu

85 90 95

Ser Ala Pro Gly Met Ala Glu Ala Val Gln Ala Ala Ala Glu Ala Gly

100 105 110

Gly Thr Gln Val Gln Leu Leu Ser Gly Ala Ile Gly Gly Val Asp Ala

115 120 125

Leu Ala Ala Ala Arg Ile Gly Gly Leu Asp Glu Val Val Tyr Thr Gly

130 135 140

Arg Lys Pro Pro Leu Ala Trp Thr Gly Thr Pro Ala Glu Gln Arg Cys

145 150 155 160

Asp Leu Ala Ser Leu Lys Glu Ala Phe Cys Ile Phe Glu Gly Ser Ala

165 170 175

Arg Glu Ala Ala Gln Leu Tyr Pro Lys Asn Ala Asn Val Ala Ala Thr

180 185 190

Leu Ser Leu Ala Gly Met Gly Leu Asp Arg Thr Thr Val Arg Leu Tyr

195 200 205

Ala Asp Pro Ala Val Asp Glu Asn Val His His Val Ala Ala Arg Gly

210 215 220

Ala Phe Gly Ser Met Glu Leu Thr Met Arg Gly Lys Pro Leu Glu Ala

225 230 235 240

Asn Pro Lys Thr Ser Ala Leu Thr Val Tyr Ser Val Val Arg Ala Val

245 250 255

Leu Asn Gln Ala Thr Ala Ile Ala Ile

260 265

<210> 101

<211> 264

<212> PRT

<213>spot Serratieae (Serratia proteamaculans) is deformed

<400> 101

Met Lys Lys Ile Met Met Ile Gly Tyr Gly Ala Met Ala Arg Glu Val

1 5 10 15

Leu Ser Arg Leu Pro Asp Gly Val Ser Val Gly Trp Ile Leu Ala Arg

20 25 30

Ala Ala His His Ala Ala Ile Asp Ser Ala Phe Gly Gly Gln Val Gln

35 40 45

Ala Leu Thr His Pro Asp Gln Cys Thr Glu Gln Pro Asp Leu Val Leu

50 55 60

Glu Cys Ala Ser Gln Gln Ala Val Ala Glu Phe Gly Glu Ala Val Val

65 70 75 80

Thr Arg Gly Trp Pro Leu Ala Val Ile Ser Thr Gly Ala Leu Ala Asp

85 90 95

Ala Ala Leu Gln Gln Arg Leu Gln Gln Ala Cys Arg Gln His Gln Gly

100 105 110

Gln Leu Ile Val Leu Ser Gly Ala Val Ala Gly Met Asp Gly Leu Ala

115 120 125

Ser Ala Arg Glu Gly Gly Leu Asp Ser Val Thr Tyr Gln Ala Cys Lys

130 135 140

Ser Pro Ala Ser Trp Arg Gly Ser Met Ala Glu Gln Leu Ile Asp Leu

145 150 155 160

Asp Ala Val Ser Glu Ala Gln Val Phe Phe Glu Gly Ser Ala Arg Glu

165 170 175

Ala Ala Arg Leu Phe Pro Ala Asn Ala Asn Val Ala Ala Thr Ile Ala

180 185 190

Leu Asn Gly Leu Gly Met Asp Ala Thr Arg Val Arg Leu Leu Val Asp

195 200 205

Pro Ala Thr Arg Arg Asn Thr His Arg Leu Gln Val Cys Gly Asn Phe

210 215 220

Gly Glu Phe Gln Ile Glu Leu Ser Gly Asn Pro Leu Ala Ser Asn Pro

225 230 235 240

Lys Thr Ser Thr Leu Ala Ala Leu Ser Ala Val Gln Ala Cys Arg Arg

245 250 255

Leu Val Asp Gly Gly Phe Ile Ala

260

<210> 102

<211> 268

<212> PRT

<213>human pallid bacillus (Ochrobactrum anthropi)

<400> 102

Met Ser Val Ser Glu Thr Ile Val Leu Val Gly Trp Gly Ala Ile Gly

1 5 10 15

Lys Arg Val Ala Asp Leu Leu Ala Glu Arg Lys Ser Ser Val Arg Ile

20 25 30

Gly Ala Val Ala Val Arg Asp Arg Ser Ala Ser Arg Asp Arg Leu Pro

35 40 45

Ala Gly Ala Val Leu Ile Glu Asn Pro Ala Glu Leu Ala Ala Ser Gly

50 55 60

Ala Ser Leu Val Val Glu Ala Ala Gly Arg Pro Ser Val Leu Pro Trp

65 70 75 80

Gly Glu Ala Ala Leu Ser Thr Gly Met Asp Phe Ala Val Ser Ser Thr

85 90 95

Ser Ala Phe Val Asp Asp Ala Leu Phe Gln Arg Leu Lys Asp Ala Ala

100 105 110

Ala Ala Ser Gly Ala Lys Leu Ile Ile Pro Pro Gly Ala Leu Gly Gly

115 120 125

Ile Asp Ala Leu Ser Ala Ala Ser Arg Leu Ser Ile Glu Ser Val Glu

130 135 140

His Arg Ile Ile Lys Pro Ala Lys Ala Trp Ala Gly Thr Gln Ala Ala

145 150 155 160

Gln Leu Val Pro Leu Asp Glu Ile Ser Glu Ala Thr Val Phe Phe Thr

165 170 175

Asp Thr Ala Arg Lys Ala Ala Asp Ala Phe Pro Gln Asn Ala Asn Val

180 185 190

Ala Val Ile Thr Ser Leu Ala Gly Ile Gly Leu Asp Arg Thr Arg Val

195 200 205

Thr Leu Val Ala Asp Pro Ala Ala Arg Leu Asn Thr His Glu Ile Ile

210 215 220

Ala Glu Gly Asp Phe Gly Arg Met His Leu Arg Phe Glu Asn Gly Pro

225 230 235 240

Leu Ala Thr Asn Pro Lys Ser Ser Glu Met Thr Ala Leu Asn Leu Val

245 250 255

Arg Ala Ile Glu Asn Arg Val Ala Thr Thr Val Ile

260 265

Claims

1. aspartic dehydrogenase, it is characterised in that amino acid sequence such as SEQ ID NO:99, shown in 100,101 or 102.

2. aspartic dehydrogenase described in claim 1, which is characterized in that the amino acid sequence of the aspartic dehydrogenase With SEQ ID NO:99, amino acid sequence shown in 100,101 or 102 has at least 80%, at least 85%, at least 90%, until Few 95%, at least 96%, at least 97%, at least 98%, at least 99% homology, and it is respectively derived from citric acid pneumonia Bacterium (Klebsiella pneumoniae), Dell Ford bacterium Cs1-4 (Delftia sp.Cs1-4) deform spot Serratieae (Serratia proteamaculans) or human pallid bacillus (Ochrobactrum anthropi).

3. encoding the nucleotide sequence of the aspartic dehydrogenase of claims 1 or 2.

4. nucleotide sequence as claimed in claim 3, it is characterised in that selected from by SEQ ID NO:2,3,6 or 7 nucleotides sequence Arrange the group of composition.

5. the expression vector comprising aspartic dehydrogenase described in claim 3 or 4.

6. stating the host cell of expression vector comprising claim 5.

7. host cell as claimed in claim 6, it is characterised in that SEQ ID NO:2, nucleotide sequence needle shown in 3,6 or 7 Codon optimization has been carried out to host cell.

8. host cell as claimed in claim 6, it is characterised in that the host cell is bacterium, photosynthetic bacteria, yeast or mould The cell of bacterium.

9. host cell as claimed in claim 6, it is characterised in that the host cell is Escherichia coli.

10. the described in any item aspartic dehydrogenases of claim 1-2 or the described in any item nucleotide of claim 3 or 4 Sequence is used to produce the purposes of aspartic acid race amino acid, wherein aspartic acid race amino acid is selected from aspartic acid, ammonia of reviving Acid, lysine, isoleucine, methionine and Beta-alanine, or combinations thereof.