CN109306340B

CN109306340B - Artificial antigen presenting cell for efficiently amplifying whole T cells and application thereof

Info

Publication number: CN109306340B
Application number: CN201710623075.9A
Authority: CN
Inventors: 钱其军; 金华君; 游素梅; 江芏青; 叶真龙; 孙娟娟; 李林芳
Original assignee: Shanghai Cell Therapy Research Institute; Shanghai Cell Therapy Group Co Ltd
Current assignee: Shanghai Cell Therapy Research Institute; Shanghai Cell Therapy Group Co Ltd
Priority date: 2017-07-27
Filing date: 2017-07-27
Publication date: 2023-06-06
Anticipated expiration: 2037-07-27
Also published as: CN109306340A; WO2019020090A1

Abstract

The invention relates to an artificial antigen presenting cell for efficiently amplifying whole T cells and application thereof. Specifically, the transgenic artificial antigen presenting cells (1) of the present invention express a T cell first signal membrane-bound activating antibody, a T cell second signal membrane-bound activating antibody and a cytokine; and/or (2) stably integrating into the genome an expression cassette comprising a cytokine encoding a first signal membrane-bound activating antibody for a T cell and a second signal membrane-bound activating antibody for a T cell. The artificial antigen presenting cell of the invention can induce the proliferation and activation of T cells, generate central memory T cells, stimulate the T cells to secrete IFN-gamma, and improve the capability of specific T cells to kill tumors.

Description

Artificial antigen presenting cell for efficiently amplifying whole T cells and application thereof

Technical Field

The invention belongs to the fields of cell biology, tumor immunology and tumor immunotherapy, and relates to an artificial antigen presenting cell for efficiently amplifying specific T cells and application thereof.

Background

Immunotherapy against malignant tumors has been rapidly developed in recent years, and has achieved remarkable clinical effects. Compared with the application of tumor vaccine for immunotherapy, adoptive T cell therapy is an important way of immunotherapy, and theoretically has the following advantages: firstly, T cells with required functions and phenotypes can be specifically screened out in vitro; second, by in vitro expansion of the volume The tumor specific T cells are returned to the body of a patient, so that the immune tolerance and the immune suppression generated by the tumor microenvironment can be effectively avoided. Recent clinical studies have shown that treatment of patients with advanced cancer with adoptive T cells can produce positive clinically relevant anti-tumor responses. For example, adoptive transfer of in vitro activated tumor infiltrating lymphocytes from melanoma patients with lymphocyte depletion followed by high dose IL-2 therapy can elicit a significant clinical response. In addition, treatment of CD19 with anti-CD 19 chimeric antigen receptor (Chimeric Antigen Receptor, CAR) transduced T cells ⁺ B-cell lymphoma and leukemia patients can produce good clinical effects. These results all indicate that adoptive transfer of a large number of functional anti-tumor T cells can be an effective means of treating cancer.

The primary T cells rapidly fail during in vitro culture due to the lack of co-stimulation of the first signal and the second signal. Thus, how to expand a sufficient number of tumor-specific T cells in vitro is critical for effective adoptive T cell therapy. Activation of T cells requires dual signal stimulation of TCR-CD3 complex and costimulatory molecules. The CD3 antibody may provide a non-specific first signal that may cause cross-linking of the T cell TCR-CD3 complex, generating an activation signal that stimulates T cell proliferation. Among the molecules providing the second signal, CD28 antibodies have been well established as the most important costimulatory molecules for activating T cells via TCR/CD 3. In cells where the TCR is pre-activated by the CD3 antibody, after binding of the CD28 antibody to the ligand, intracellular tyrosine phosphorylation is induced, allowing the T cells to fully activate. The lack of a CD28/B7 co-stimulatory signal results in T cell disability, which plays an indispensable role in initiating the initial stages of the immune response. CD28 antibody can also stimulate T cell to secrete a series of cytokines, such as IL-2, IFN-gamma, TNF-alpha, IL-4, etc., to promote T cell differentiation and proliferation.

Professional antigen presenting cells (antigen presenting cell, APC) include Dendritic Cells (DCs), monocytes, activated B cells, etc., and in the process of presenting tumor antigens for T cell recognition, signal stimulation obtained by T cells affects its programming and therapeutic effects, and naturally occurring APC does not provide accurate signal stimulation, thereby regulating T cell differentiation into the optimal phenotype. Moreover, it is very cumbersome to separate homologous APCs (such as DCs) from the blood of tumor patients, the number of DCs is very small, and it is only 1% or less of peripheral blood mononuclear cells (Peripheral Blood Mononuclear Cell, PBMCs) to obtain mature DCs by in vitro culture, and it is difficult to expand them, and the number of induced specific T cells is small, so that it is difficult to meet the clinical treatment requirements.

Currently, there are two main methods for expanding T cells. Firstly, the T cells are activated by using a plate coated with anti-CD3 and anti-CD28 antibodies, the method is high in price, and has potential safety hazards such as easy pollution, excessive endotoxin and the like; secondly, by stimulating T cells with antibody-coated immunomagnetic beads (Dynabeads), for example, by combining anti-CD3 and anti-CD28 antibodies on the magnetic beads, primary and co-stimulatory signals required for modulating T cell activation and expansion can be provided, but, at the same time, a plurality of antibodies are loaded on the magnetic beads, the coating positions of the antibodies, the coating quantity of which is difficult to grasp, the uniformity cannot be ensured, and high-quality magnetic beads with moderate granularity and low dispersity are produced, which require very complex processes.

Recent studies have shown that artificial APCs (Artificial antigen presenting cell, aapcs) can effectively activate and expand antigen-specific T cells with high efficiency and good feasibility. Different aapcs can express different molecules to generate corresponding signal stimuli, causing the desired T cell migration and effector functions, while programming the cells to establish a durable T cell memory. The aAPC can express a plurality of antibodies and antigens simultaneously, is easy to control, and further meets the experimental requirements. In conclusion, the application of aapcs effectively improves the clinical efficacy of adoptive T cells in treating tumors.

The K562 cells belong to a human leukemia cell line and are derived from chronic myelogenous leukemia patients in the acute phase. The K562 cells have the following characteristics: firstly, HLA class I and class II molecules which are not endogenously expressed; secondly, the gene is easy to operate and can stably express the operated gene; thirdly, the use in human body is safe. These characteristics make K562 cells widely used as a framework cell line for constructing novel aAPC, and better research results are obtained. For example, aAPC/mkt 3 constructed from the K562 cell line transduced with CD3, CD80 and CD83 molecules, can promote the expansion of both peripheral blood and tumor infiltrating T lymphocytes (timors-infiltrating T lymphocytes, TILs) without the addition of heterologous feeder cells. Furthermore, researchers have prepared clinical grade aapcs that co-express CD64, CD86, 4-1BBL, truncated CD19, and mbIL-15/IRES-EGFP molecules using K562 cells, and were able to specifically stimulate proliferation and differentiation of CD19 CAR-T cells, with which CD19 CAR-T cells, adoptive therapy trials of stage i clinical were conducted in patients with lymphoid malignancies that are expressing CD 19.

Although there have been reports of introduction of foreign genes into K562 cells, it is currently difficult for the conventional gene transfection vector system to express the foreign genes at a high level in the cells thereof. Lentiviral vector systems and the like also present safety risks to humans and other primates. Thus, until now, there has been no report that aapcs constructed based on K562 cells can efficiently express various antibodies.

Disclosure of Invention

In a first aspect, the invention provides a transgenic artificial antigen presenting cell (aAPC), the aAPC: (1) Expressing the T cell first signal membrane bound activating antibody, the second signal membrane bound activating antibody and the cytokine; and/or (2) the genome has stably integrated therein an expression cassette comprising a first signal membrane-bound activating antibody encoding a T cell, a second signal membrane-bound activating antibody, and a cytokine.

In one or more embodiments, both ends of the expression cassette comprise an inverted terminal repeat of a transposon.

In one or more embodiments, the transposon is selected from the group consisting of: piggybac, sleep reliability, frog priority, tn5 and Ty.

In one or more embodiments, the transposon is piggybac.

In one or more embodiments, the aapcs are cells that do not express human MHC molecules; preferably, it is a K562 cell.

In one or more embodiments, the T cell first signal membrane bound activating antibody is an anti-CD 3 antibody.

In one or more embodiments, the anti-CD 3 antibody is an anti-CD 3 single chain antibody.

In one or more embodiments, the second signal film-binding activating antibody is directed against one or more of the following antigens: CD28, CD137 (4-1 BB), CD134 (OX 40), CD27, CD32, GITR, CD40L, CD, CD80, CD83, CD86 and ICOSL (B7H 2, B7RP 1).

In one or more embodiments, the second signal film-binding activating antibody comprises at least an anti-CD 137 antibody.

In one or more embodiments, the second signal film-binding activating antibody further comprises an anti-CD 28 antibody.

In one or more embodiments, the second signal film-binding activating antibody is a single chain antibody.

In one or more embodiments, the cytokine is selected from the group consisting of: IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-34, IL-35, IL-36, IL-37 and IL-38, or extracellular domains thereof, or fusion proteins with their corresponding alpha receptors.

In one or more embodiments, the cytokine is a fusion protein of an extracellular domain of IL-15 and an alpha receptor of IL 15.

In one or more embodiments, the aapcs express: anti-CD 3 antibodies, anti-CD 28 antibodies, anti-CD 137 antibodies, and IL15 extracellular domains.

In one or more embodiments, the aapcs are shown to express the IL15 extracellular domain on a cell membrane.

In a second aspect the invention provides one or more of the following nucleic acid constructs:

(1) A nucleic acid construct comprising, in sequence, a transposon 5 'inverted terminal repeat (5' itr), a promoter for controlling expression of the coding sequence of the T cell first signal membrane-associated activating antibody, a polyA tailing signal sequence, a transposon 3 'inverted terminal repeat (3' itr), a transposase coding sequence, and a promoter for controlling expression of the transposase coding sequence;

(2) A nucleic acid construct comprising, in sequence, a transposon 5 'inverted terminal repeat (5' itr), a promoter for controlling expression of the coding sequence of the T cell second signal membrane-bound activating antibody, a coding sequence of the CD8 extracellular region and the transmembrane region, a polyA tailing signal sequence, a transposon 3 'inverted terminal repeat (3' itr), a transposase coding sequence, and a promoter for controlling expression of the transposase coding sequence; and

(3) A nucleic acid construct comprising, in sequence, a transposon 5 'inverted terminal repeat (5' itr), a promoter for controlling expression of a coding sequence for a cytokine, a coding sequence for a CD8 extracellular region and a transmembrane region, a polyA tailing signal sequence, a transposon 3 'inverted terminal repeat (3' itr), a transposase coding sequence, and a promoter for controlling expression of the transposase coding sequence.

In one or more embodiments, the recombinant vector is a eukaryotic expression vector.

In one or more embodiments, the eukaryotic expression vector is a eukaryotic expression vector comprising a piggyac transposable element.

In one or more embodiments, the transposase is a piggybac transposase.

In one or more embodiments, the coding sequence of the T cell first signal, second signal membrane bound activating antibody or the promoter controlling expression of the cytokine coding sequence is EF1 a.

In one or more embodiments, the promoter that controls expression of the transposase coding sequence is a CMV promoter.

In a third aspect the invention provides a method of constructing a transgenic aAPC as described herein, the method comprising the step of transferring into the aAPC three expression vectors:

(1) A nucleic acid construct comprising, in sequence, a transposon 5 'inverted terminal repeat (5' itr), a promoter for controlling expression of the coding sequence of the T cell first signal membrane-bound activating antibody, a coding sequence of the CD28 extracellular region and the transmembrane region, a polyA tailing signal sequence, a transposon 3 'inverted terminal repeat (3' itr), a transposase coding sequence, and a promoter for controlling expression of the transposase coding sequence;

In one or more embodiments, the three expression vectors are transferred into the cells using one or more of viral transduction, microinjection, particle bombardment, gene gun transformation, and electrotransformation, preferably electrotransformation.

In a fourth aspect the invention provides the use of a transgenic aAPC as described herein, for: inducing proliferation and activation of whole T cells, and/or generating central memory T cells, and/or stimulating secretion of IFN- γ by T cells, and/or enhancing the ability of specific T cells to kill tumors.

In one or more embodiments, the T cells include all types of T cells, such as: t lymphocytes derived from peripheral blood mononuclear cells, tumor-infiltrating T lymphocytes, CAR-T cells, and the like.

In one or more embodiments, the tumor is selected from the group consisting of: liver cancer, lung cancer, colon cancer, pancreatic cancer, gastric cancer, breast cancer, nasopharyngeal cancer, lymphoma, ovarian cancer, bladder cancer, prostate cancer, and head and neck tumors.

In a fifth aspect, the invention provides the use of (1) an anti-CD 137 single chain antibody and/or IL15 or a derivative thereof, (2) a coding sequence for an anti-CD 137 single chain antibody and/or a coding sequence for IL15 or a derivative thereof, and (3) an expression vector for an anti-CD 137 single chain antibody and/or an expression vector for IL15 or a derivative thereof, in the preparation of a transgenic aAPC.

Drawings

Fig. 1: expression cassette pattern diagram of recombinant plasmid. ITR is transposon terminal repeat, scFv is single chain antibody, hyPB is piggybac transposase.

Fig. 2: PCR identification of the gene of interest in the artificial antigen presenting sh3857 cells.

Fig. 3: flow detection of artificial antigen presenting sh3857 cell surface molecules. The control was non-transgenic K562 cells of the same origin.

Fig. 4: amplification of CTL cells derived from peripheral blood mononuclear cells by sh3857 cells. The control was CD3-CD28 beads.

Fig. 5: sh3857 cells were tested for their effect on the expansion of Tumor Infiltrating Lymphocytes (TIL). The control was CD3-CD28 beads.

Fig. 6A and 6B: flow assay of T cell activation and memory phenotype following sh3857 cell stimulation. The control was CD3-CD28 beads.

Fig. 7A and 7B: flow-through detection of T cell inhibitory phenotype following sh3857 cell stimulation. The control was CD3-CD28 beads.

Fig. 8: flow-through detection of IFN-gamma secretion in T cells after sh3857 cell stimulation. The control was CD3-CD28 beads.

Detailed Description

The following is a description of some of the terms involved in the present invention.

In the present invention, the term "expression cassette" refers to the complete elements required for expression of a gene, including promoters, gene coding sequences and PolyA tailing signal sequences.

The term "coding sequence" is defined herein as the portion of a nucleic acid sequence that directly determines the amino acid sequence of its protein product. The boundaries of the coding sequence are typically determined by a ribosome binding site (for prokaryotic cells) immediately upstream of the open reading frame at the 5 'end of the mRNA and a transcription termination sequence immediately downstream of the open reading frame at the 3' end of the mRNA. Coding sequences may include, but are not limited to, DNA, cDNA, and recombinant nucleic acid sequences.

The term "antigen-binding fragment" (Fab) refers to a peptide fragment located at the ends of the two arms of the "Y" structure of an antibody molecule, consisting of the amino acid sequence of the hypervariable region, which determines the specificity of the antibody for binding to an antigen.

The term "Fc", i.e., the crystallizable section of an antibody (fragment crystallizable, fc), refers to the peptide section comprising the CH2 and CH3 domains of the heavy chain of an antibody at the end of the stem of the "Y" structure of an antibody molecule, which is the site of interaction of the antibody with an effector molecule or cell.

The term "linker" or hinge is a polypeptide fragment that connects between different proteins or polypeptides in order to maintain the connected proteins or polypeptides in their respective spatial conformations in order to maintain the function or activity of the protein or polypeptide.

The term "specific binding" refers to a reaction between an antibody or antigen binding fragment and an antigen against which it is directed. In certain embodiments, an antibody that specifically binds to (or has specificity for) an antigen means that the antibody binds to or has specificity for an antigen in an amount of less than about 10 ^-5 M, e.g. less than about 10 ^-6 M、10 ^-7 M、10 ^-8 M、10 ^-9 M or 10 ^-10 M or less affinity (KD) binds the antigen. "specific recognition" has similar meaning.

The term "Tumor infiltrating lymphocyte" (Tumor-infiltrating lymphocytes, TIL) refers to an anti-Tumor immune cell which is isolated from Tumor tissues, cultured and amplified in vitro, reaches a certain amount, is reinjected into a patient, can kill corresponding Tumor cells more strongly, and has high specificity and strong killing effect.

"CD3" consists of 6 peptide chains, often tightly bound to TCR to form a TCR-CD3 complex containing 8 peptide chains. The CD3 molecule herein refers to "CD3E", i.e. encodes a CD3 epsilon peptide chain with an ID number 916 in NCBI GeneBank, with only 1 isoform (cDNA sequence/protein sequence) nm_000733.3/np_000724.1.

"CD28" refers to human leukocyte differentiation antigen 28, also known as Tp44, which has an ID number 940 in NCBI GeneBank and 2 isoforms (cDNA sequence/protein sequence) NM_001243077.1/NP_001230006.1, NM_001243078.1/NP_001230007.1, NM_006139.3/NP_006130.1, respectively.

"CD137" refers to human leukocyte differentiation antigen 137, also known as 4-1BB, which has the official name TNFRSF9 (tumor necrosis factor receptor superfamily member 9) under NCBI GeneBank, ID No. 3604, and only 1 isoform (cDNA sequence/protein sequence) as NM-001561.5/NP-001552.2.

"IL15" refers to interleukin 15, which has ID No. 3600 in NCBI GeneBank and 2 isoforms (cDNA sequence/protein sequence) NM-000585.4/NP-000576.1, NM-172175.2/NP-751915.1, respectively.

Unless otherwise indicated, all other antigens referred to herein are those known in the art, the amino acid sequences of which are well known in the art and can be obtained from databases well known in the art.

The present disclosure relates to transferring nucleic acid constructs expressing a T cell first signal membrane-bound activating antibody, a T cell second signal membrane-bound activating antibody, and a cytokine described herein into antigen presenting cells to construct transgenic artificial antigen presenting cells expressing the antibodies and cytokines for inducing proliferation and activation of whole T cells, producing central memory T cells, stimulating secretion of IFN- γ by T cells, and enhancing the ability of specific T cells to kill tumors.

Suitable professional antigen presenting cells include dendritic cells, monocytes, activated B cells and the like. Preferably, the APC used herein is an APC that does not express human MHC molecules; more preferably human leukemia cells; most preferably K562 cells.

T cell primary signal membrane-bound activating antibodies and T cell secondary signal membrane-bound activating antibodies suitable for use in the present invention are preferably secreted antibodies. In certain embodiments, the antibody is a membrane anchored antibody. In certain embodiments, the antibodyIs a single chain antibody. Single chain antibody (scFv) refers to a polypeptide consisting of an antibody light chain variable region (V _L Region) amino acid sequence and heavy chain variable region (V) _H Region) amino acid sequences are joined by a hinge, and have the ability to bind antigen.

The T cell primary signal membrane-bound activating antibodies suitable for use herein are preferably anti-CD 3 antibodies, particularly antibodies against the CD3 epsilon peptide chain. In certain embodiments, the anti-CD 3 antibody is a single chain antibody. In certain embodiments, the anti-CD 3 single chain antibody has an amino acid sequence encoded by the base sequence at positions 61-780 of SEQ ID NO. 1.

The T cell second signal membrane-bound activating antibodies suitable for use herein may be antibodies directed against one or more of the following antigens: CD28, CD137 (4-1 BB), CD134 (OX 40), CD27, CD32, GITR, CD40L, CD, CD80, CD83, CD86 and ICOSL (B7H 2, B7RP 1). Preferably, the T cell second signal membrane bound activating antibody comprises at least an anti-CD 137 antibody, preferably also an anti-CD 28 antibody. Preferably, the T cell second signal membrane bound activating antibody is a single chain antibody. In certain embodiments, anti-CD 137 single chain antibodies and anti-CD 28 single chain antibodies are used. An exemplary anti-CD 28 single chain antibody may have an amino acid sequence encoded by bases 58-783 of SEQ ID NO. 2; an exemplary anti-CD 137 single chain antibody may have an amino acid sequence encoded by the base sequence of SEQ ID NO. 3 at positions 61-795.

Herein, suitable cytokines include, but are not limited to, interleukins. For example, suitable interleukins include one or more of the following: IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-34, IL-35, IL-36, IL-37 and IL-38. Generally, an interleukin as described herein includes an extracellular domain or derivative thereof, including in particular a fusion protein of the extracellular domain of an interleukin with an alpha receptor of the corresponding interleukin. For example, in certain embodiments, the interleukin is a fusion protein of the extracellular domain of IL-15 and the alpha receptor of IL 15. The extracellular domain of IL-15 and its alpha receptor may be linked by a commonly used linker sequence. The linker sequences may be linker sequences suitable for antibodies as known in the art, such as G and S containing linker sequences. The length of the linker may be 3 to 25 amino acid residues, for example 3 to 15, 5 to 15, 10 to 20 amino acid residues. In certain embodiments, the linker sequence is a glycine linker sequence. The number of glycine in the linker sequence is not particularly limited, and is usually 2 to 20, for example 2 to 15, 2 to 10, 2 to 8. In addition to glycine and serine, other known amino acid residues may be contained in the linker, such as alanine (A), leucine (L), threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), glutamine (Q), etc. In certain embodiments, the amino acid sequence of the fusion protein of IL-15 and its alpha receptor is the amino acid sequence encoded by the base sequence at positions 58-669 of SEQ ID NO. 4.

Nucleic acid constructs for transfer into antigen presenting cells of interest typically contain an expression cassette for a T cell first signal membrane-bound activating antibody, a T cell second signal membrane-bound activating antibody, or a cytokine. The two ends of the expression cassette preferably comprise inverted terminal repeats of the transposon.

Thus, in certain embodiments, the nucleic acid constructs herein comprise nucleic acid constructs A, B and C:

(A) A nucleic acid construct comprising, in sequence, a transposon 5 'inverted terminal repeat (5' itr), a promoter for controlling expression of the coding sequence of the T cell first signal membrane-bound activating antibody, a coding sequence of the CD28 extracellular region and the transmembrane region, a polyA tailing signal sequence, a transposon 3 'inverted terminal repeat (3' itr), a transposase coding sequence, and a promoter for controlling expression of the transposase coding sequence;

(B) A nucleic acid construct comprising, in sequence, a transposon 5 'inverted terminal repeat (5' itr), a promoter for controlling expression of the coding sequence of the T cell second signal membrane-bound activating antibody, a coding sequence of the CD8 extracellular region and the transmembrane region, a polyA tailing signal sequence, a transposon 3 'inverted terminal repeat (3' itr), a transposase coding sequence, and a promoter for controlling expression of the transposase coding sequence; and

(C) A nucleic acid construct comprising, in sequence, a transposon 5 'inverted terminal repeat (5' itr), a promoter for controlling expression of a coding sequence for a cytokine, a coding sequence for a CD8 extracellular region and a transmembrane region, a polyA tailing signal sequence, a transposon 3 'inverted terminal repeat (3' itr), a transposase coding sequence, and a promoter for controlling expression of the transposase coding sequence.

Preferably, these nucleic acid constructs are expression vectors capable of expressing the antibodies as well as cytokines in the antigen presenting cells of interest.

Herein, the transposase may be a transposase from a piggybac, sleep bearing, fr log priority, tn5 or Ty transposase system. When transposases from different transposition systems are used, the sequences of the 5'ITR and 3' ITR in the nucleic acid construct of the invention are also correspondingly changed to sequences that are compatible with the transposition system, as can be readily determined by one skilled in the art.

In certain embodiments, the transposase is a transposase from the piggybac transposable system. Thus, in these embodiments, the transposon 5 'inverted terminal repeat and 3' inverted terminal repeat are the transposon 5 'inverted terminal repeat and 3' inverted terminal repeat of piggybac, respectively. In certain embodiments, the transposon 5' inverted terminal repeat is as shown in CN 201510638974.7 (the contents of which are incorporated herein by reference) SEQ ID No. 1. In certain embodiments, the transposon 3' inverted terminal repeat is as shown in CN 201510638974.7SEQ ID NO:4. In certain embodiments, the piggybac transposase is a transposase comprising a c-myc nuclear localization signal coding sequence. In certain embodiments, the coding sequence of the piggybac transposase is as set forth in CN 201510638974.7SEQ ID NO:5.

The corresponding promoter sequence may be selected according to the selected nucleic acid sequence of interest (i.e., the antibody or cytokine to be expressed). Examples of such promoters include, but are not limited to, the EF1 alpha promoter. As described in CN201510021408.1 (the entire contents of which are incorporated herein by reference), the promoter may also include an enhancer upstream of the promoter, such as one, any two or all three of the mCMV enhancer, hCMV enhancer and CD3e enhancer.

Promoters of the transposase coding sequence may be any of the promoters known in the art for controlling the expression of the transposase coding sequence. In certain embodiments, the expression of the transposase coding sequence is controlled using a CMV promoter. The sequence of the CMV promoter may be as shown in SEQ ID NO. 6 of CN 201510638974.7.

The polyA tailing signal sequences known in the art may be used. In certain embodiments, the polyA is from SV40. In certain embodiments, the sequence shown in SEQ ID NO. 3 of CN 201510638974.7 may be used.

The extracellular and transmembrane regions of CD28 may be those commonly used in the art. Exemplary extracellular regions of CD28 may be encoded by the base sequences of SEQ ID NO. 1 at positions 781-897; exemplary CD28 transmembrane regions may be encoded by the base sequence of SEQ ID NO. 1 at positions 898-987.

The extracellular and transmembrane regions of CD8 may be those commonly used in the art. Exemplary extracellular regions of CD8 may be encoded by the base sequence of SEQ ID NO. 2, positions 784-948; exemplary CD8 transmembrane regions may be encoded by the base sequence of SEQ ID NO. 2 at positions 949-1020.

Thus, in certain embodiments, nucleic acid construct a for expressing a T cell primary signal membrane-bound activating antibody in an antigen presenting cell of interest comprises, in sequence, a transposon 5 'inverted terminal repeat (5' itr), an EF1 a promoter, a coding sequence for a T cell primary signal membrane-bound activating antibody, a coding sequence for a CD28 extracellular region and a transmembrane region, a polyA tailing signal sequence and a transposon 3 'inverted terminal repeat (3' itr), a coding sequence for a transposase from the piggybac transposase system, and a CMV promoter to control expression of the transposase coding sequence; nucleic acid construct B for expressing a T cell second signal membrane-bound activating antibody in an antigen presenting cell of interest contains, in sequence, a transposon 5 'inverted terminal repeat (5' itr), an EF1 a promoter, a coding sequence for a T cell second signal membrane-bound activating antibody, coding sequences for the extracellular and transmembrane regions of CD8, a polyA tailing signal sequence and a transposon 3 'inverted terminal repeat (3' itr), a coding sequence for a transposase from the piggybac transposition system, and a CMV promoter to control expression of the transposase coding sequence; nucleic acid construct C for expressing a cytokine in an antigen presenting cell of interest contains, in sequence, a transposon 5 'inverted terminal repeat (5' ITR), an EF 1. Alpha. Promoter, a coding sequence for the cytokine, a coding sequence for the extracellular and transmembrane regions of CD8, a polyA tailing signal sequence and a transposon 3 'inverted terminal repeat (3' ITR), a coding sequence for a transposase from the piggybac transposase system, and a CMV promoter to control expression of the transposase coding sequence.

In certain embodiments, the recombinant expression vector employs pUC18, pUC19, pMD18-T, pMD19-T, pGM-T, pUC57, pMAX or pDC315 series vectors as the backbone. In other embodiments, the recombinant expression vector employs a pCDNA3 series vector, a pCDNA4 series vector, a pCDNA5 series vector, a pCDNA6 series vector, a pRL series vector, a pUC57 vector, a pMAX vector, or a pDC315 series vector as a backbone. In certain embodiments, the present invention uses a pSN vector constructed from CN 201510638974.7, the vector structure of which is shown in fig. 1 of this application.

In certain embodiments, the antigen presenting cells herein are transgenic K562 cells having stably integrated into their genome an expression cassette comprising the nucleic acid sequence of interest. Still further, the genome of the K562 cell stably integrates a transposon 5 'inverted terminal repeat (5' ITR), a promoter controlling expression of a nucleic acid sequence of interest, a polyA tailing signal sequence, and a transposon 3 'inverted terminal repeat (3' ITR) which are sequentially linked. Specifically, the K562 cells: expressing the T cell first signal membrane bound activating antibody, the second signal membrane bound activating antibody and the cytokine; and/or the genome stably integrates an expression cassette encoding a T cell first signal membrane-bound activating antibody, an expression cassette encoding a second signal membrane-bound activating antibody, and an expression cassette encoding a cytokine, particularly as described in the various embodiments herein. On the other hand, the K562 cells were transformed with the nucleic acid constructs A, B and C described in the embodiments herein. More preferably, the nucleic acid construct B transferred into the K562 comprises at least a nucleic acid construct capable of expressing an anti-CD 137 single-chain antibody, and preferably further comprises a nucleic acid construct capable of expressing an anti-CD 28 single-chain antibody. In certain embodiments, the transgenic K562 cells herein stably express the full length sequence of the Fc segment of the antibody, or a functional fragment thereof. In certain embodiments, the transgenic K562 cells herein stably express the heavy chain constant segment (e.g., fc) and the light chain of the antibody.

The transgenic K562 cells herein have the function of efficiently inducing proliferation and activation of whole T cells and generating central memory T cells according to the biological functions of the expressed antibodies and cytokines. In one or more embodiments, the T cells include all types of T cells, such as: t lymphocytes derived from peripheral blood mononuclear cells, tumor-infiltrating T lymphocytes, CAR-T cells, and the like.

The aapcs of the present application can be prepared by transferring the nucleic acid constructs A, B and C herein into antigen presenting cells of interest using methods conventional in the art. These methods include, but are not limited to: viral transduction, microinjection, particle bombardment, gene gun transformation, electrotransformation, and the like. In certain embodiments, electrotransformation is used to transfer the nucleic acid construct into a cell of interest. During transfection, the dosage of the expression vector can be adjusted according to actual conditions.

Accordingly, the present invention also provides a kit comprising the nucleic acid constructs A, B and C described in any of the embodiments herein. Preferably, the nucleic acid construct B comprises at least a nucleic acid construct expressing an anti-CD 137 single chain antibody, preferably further comprises a nucleic acid construct expressing an anti-CD 28 single chain antibody. In certain embodiments, the kit contains: nucleic acid construct a described herein that expresses an anti-CD 3 single chain antibody, nucleic acid construct B described herein that expresses an anti-CD 28 single chain antibody, nucleic acid construct B described herein that expresses an anti-CD 137 single chain antibody, and nucleic acid construct C described herein that expresses a fusion protein of the extracellular domain of IL15 with its alpha receptor. The kit may also contain various reagents suitable for transfection of the recombinant expression vector into a cell, and optionally instructions for those skilled in the art to transfect the recombinant expression vector into a cell. In the kit, the various recombinant expression vectors can be packaged independently or in the form of a mixture in the same container.

Thus, in certain embodiments, the invention also relates to a composition comprising at least one, any two or all three of the nucleic acid construct a, the nucleic acid construct B and the nucleic acid construct C described in any of the embodiments herein. In one or more embodiments, the composition contains any one, any two, or all three of nucleic acid construct a described herein that expresses an anti-CD 3 single chain antibody, nucleic acid construct B described herein that expresses an anti-CD 28 single chain antibody, nucleic acid construct B described herein that expresses an anti-CD 137 single chain antibody, and nucleic acid construct C described herein that expresses a fusion protein of the extracellular domain of IL15 with its alpha receptor. The composition may also contain a corresponding solvent or carrier.

The invention overcomes the defects of low transfection rate and low mediated antibody expression level of the antigen presenting cells, especially K562 cells, of the conventional gene transfection carrier system, and ensures that the antigen presenting cells, especially the K562 cells, can stably express various T cell first signal film combined type activating antibodies, second signal film combined type activating antibodies and cytokines on cell membranes. Therefore, the obtained transgenic aAPC cell and T cell are cultured together, the proliferation and activation of the T cell can be efficiently induced, the central memory T cell is produced, and the method has the advantages of simplicity in operation, low cost, high stability, high repeatability, high safety and the like, and has wide clinical application prospect.

Embodiments of the present invention will be described in detail below with reference to examples. Those skilled in the art will appreciate that the following examples are illustrative of the present invention and should not be construed as limiting the scope of the invention. The specific techniques or conditions are not noted in the examples, and are carried out according to the techniques or conditions described in the literature in the art (for example, refer to J. Sam Brookfield et al, J. Sam. Brookfield et al., huang Peitang et al. Ind. Molecular cloning Experimental guidelines, third edition, scientific Press) or according to the specifications of the product. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

Example 1: recombinant plasmid pNB328-anti-CD3TM, pNB328-anti-CD28TM, pNB328-anti- - Construction of CD137TM and pNB328-IL15 TM.

The anti-CD3TM coding sequence (light chain signal peptide-anti CD3scFv-CD28 Range-TM) shown in SEQ ID NO. 1 is commissioned to be synthesized by Shanghai JieRui biosystems, ecoRI and SalI restriction sites are respectively introduced into the upstream and downstream of the coding sequence, and the coding sequence is loaded into a pNB328 vector, and the coding sequence is named as pNB328-anti-CD3TM.

anti-CD3TM coding sequence:

wherein the single underline indicates the signal peptide, the dashed line indicates the CD3scFv, the double underlined CD28 extracellular hinge region and the transmembrane region.

The anti-CD28TM coding sequence (heavy chain signal peptide-anti CD28scFv-CD8 Range-TM) shown in SEQ ID NO. 2 is synthesized by Shanghai JieRui biosystems, ecoRI and SalI restriction sites are respectively introduced into the upstream and downstream of the coding sequence, and the coding sequence is loaded into a pNB328 vector, and is named as pNB328-anti-CD28TM.

anti-CD28TM coding sequence:

wherein the single underline indicates the signal peptide, the dashed line indicates the CD28scFv, the double underlined CD8 extracellular hinge region and the transmembrane region.

The coding sequence of anti-CD137 (TM) (light chain signal peptide-anti CD137scFv-CD8 Range-TM) shown in SEQ ID NO. 3 is commissioned to be synthesized by Shanghai JieRui biosystems, ecoRI and SalI restriction sites are respectively introduced into the upstream and downstream of the coding sequence, and the coding sequence is loaded into a pNB328 vector, and the coding sequence is named as pNB328-anti-CD137 (TM).

anti-CD137TM coding sequence:

wherein the single underline indicates the signal peptide, the dashed line indicates the CD137scFv, the double underline CD8 extracellular hinge region and the transmembrane region.

The IL15TM coding sequence (heavy chain signal peptide-IL 15-linker-IL15R-CD8 Range-TM) shown in SEQ ID NO. 4 was synthesized by Shanghai JieRui biosystems, and EcoRI and SalI cleavage sites were introduced upstream and downstream respectively, and the vector was loaded into pNB328, and designated pNB328-IL15TM.

IL15TM coding sequence:

wherein the single dash line represents signal peptide and the dotted line represents IL 15LR, double underlined CD8 extracellular hinge region and transmembrane region.

The vector patterns of pNB328-anti-CD3TM, pNB328-anti-CD28TM, pNB328-anti-CD137TM and pNB328-IL15TM are shown in FIG. 1.

Example 2: preparation of artificial antigen presenting K562 cells

Centrifugation to collect well-grown K562 cells about 6X 10 ⁵ And washing with physiological saline once. According to the step of the electrotransfer kit, 100 μl (82 μl+18 μl) of the electrotransfer reagent is added, and then plasmids pNB328-anti-CD3TM, pNB328-anti-CD28TM, pNB328-anti-CD137TM and pNB328-IL15TM are added simultaneously, each 1.5ug, and the cells are resuspended. Adding cell suspension into electrode cup, placing into Lonza 2b-Nucleofector electrotransformation instrument, selecting procedure to perform electric shock, transferring to six-hole plate, placing into 37 deg.C, and placing into 5% CO ₂ Culturing in an incubator. After healthy growth of the cells, the electrotransformed K562 cells were counted by centrifugation, diluted to 100/10 ml, and the cell suspension was added to a 96-well plate at 100. Mu.l/well so that there was only one cell per well. Observing every few days, removing the holes of the non-single cell group, and after the cells grow to a certain number, performing amplification culture on the single-clone hole cells to obtain the artificial K562 cells which express the anti-CD3 single-chain antibody, the anti-CD28 single-chain antibody, the CD137 single-chain antibody and the IL-15 extracellular functional region, and are named as sh3857 cells.

Example 3: PCR identification of sh3857 cell target gene.

Four monoclonal cell lines of example 2 were selected for expansion culture, cell DNA was extracted, primers W337 and W336 were designed for the anti-CD3TM coding sequence (as shown in SEQ ID NO:5 and SEQ ID NO: 6), primers CD28RTR and CD28RTL were designed for the anti-CD28TM coding sequence (as shown in SEQ ID NO:7 and SEQ ID NO: 8), primers RT-CD137Scfv-R and RT-CD137Scfv-L were designed for the anti-CD137TM coding sequence (as shown in SEQ ID NO:9 and SEQ ID NO: 10), primers RT-IL-15R and RT-IL-15L were designed for the IL15TM coding sequence (as shown in SEQ ID NO:11 and SEQ ID NO: 12), and PCR amplification was identified. The reaction procedure is 94 ℃ for 5min;94℃for 30s,56℃for 30s,72℃for 30s,35 cycles; extending at 72℃for 10min. As a result, it was found that the cells after the four monoclonal cell lines were expanded to form fragments corresponding to the sizes of anti-CD3TM, anti-CD28TM, anti-CD137TM and IL15TM, and the specific results are shown in FIG. 2.

The sequences of the primers are shown below:

W337：ACGCGTCGACTTATCAGCCGCTGCCCTTACTCCTCA(SEQ ID NO:5)；

W336：CCGGAATTCGCCACCATGGAAGCCCCAGCT(SEQ ID NO:6)；

CD28RTR：GCTTTCCCTGGTTTCTGCT(SEQ ID NO:7)；

CD28RTL：GTCTCCATCCTCCCTGTCTG(SEQ ID NO:8)；

RT-CD137Scfv-R：GCTGCTGATGGTGAGAGTGA(SEQ ID NO:9)；

RT-CD137Scfv-L：TTACTGTGCGAGGGACTATGG(SEQ ID NO:10)；

RT-IL-15R：GCAGGGCTTCCTAAAACAGA(SEQ ID NO:11)；

RT-IL-15L：GCAACTGGGGTGAACATCA(SEQ ID NO:12)。

example 4: flow assay for sh3857 cell surface molecules

Sh3857 cells prepared in example 2 and control K562 cells were selected, counted and then cultured at 1X 10 ⁶ The individual cells/tubes were added to 4 EP tubes of 1.5ml, divided into two groups, washed twice with PBS, centrifuged at 1200rpm for 5min, and the supernatant discarded; one group was added with 2. Mu.l of CD3-FITC anti-human antibody (purchased from Jackson ImmunoResearch company), the other group was added with 2. Mu.l of CD28-FITC anti-human antibody (purchased from Jackson ImmunoResearch company), the mixture was homogenized by flick precipitation, incubated at room temperature in the dark for 30min, washed once with PBS, centrifuged at 1200rpm for 5min, and the supernatant was discarded and 400. Mu.l of physiological saline was added to transfer the cells into a flow tube and the tube was subjected to detection on the machine. The experimental results show that sh3857 cell surface has CD3 and CD28 antibody molecules relative to control cells, and the specific results are shown in fig. 3.

Monoclonal sh3857 cells that were successfully validated were retained and expanded for later use.

Example 5: detection of the proliferation of sh3857 cells on peripheral blood mononuclear cell-derived CTL cells

Separating patients with clinical blood cell separatorThe human being enriches peripheral blood PBMC. Cell suspensions were diluted twice with RPMI 1640 medium, and density gradient centrifuged with lymphocyte isolates was added for primary purification of PBMCs. PBMC were placed in six well plates at 37℃with 5% CO ₂ The incubator is attached to the wall for incubation for 2-4 hours. Non-adherent cells were collected and frozen for initial T cells. Adherent cells were left in the wells, and culture was continued with the addition of 2% FBS AIM-V medium containing rhGM-CSF (100 ng/ml) and rhIL-4 (100 ng/ml), and was recorded as day 0. On day 4, the cytokines were supplemented; adding Ad5 adenovirus carrying multiple antigen genes on the 6 th day, and loading DC; on day 7, maturation-promoting factor poly1: C1. Mu.l/ml, IFN-. Gamma.2. Mu.l/ml was added to stimulate DC maturation. Mature DCs were harvested on day 8, and primary T cells were resuscitated, cell counted, DCs were co-cultured with primary T cells at a ratio of 1:10, and cytokine IL-2 (50 IU/ml) was added to induce specific T cells.

sh3857 cell induction T cell proliferation assay: DC-induced specific T cells were collected on day 12, stained with CFSE, and then washed as per sh3857: t cells=1:40 were co-cultured with IL-2 (50 IU/ml) added, and the control group was irradiated with CD3-CD28 beads (sh 3857 cells were previously irradiated with 40Gy gamma rays), denoted d0. Passaging was performed on d2, d4, and d6, respectively, and CFSE fluorescence intensities were flow-detected from a portion of the cells of the experimental group and the control group. The cells were passaged with either sh3857 or CD3-CD28 beads and IL-2. And starting from d0, the cells of the experimental and control groups were counted every two days.

The results are shown in FIG. 4. The specific T cells of the experimental group (added sh3857 cells) proliferate from day 2, the fluorescence intensity of the cells is obviously weakened, the specific T cells have obvious proliferation peaks, the proliferation trend of the specific T cells on day 4 is more obvious, and the specific T cells enter a rapid proliferation period on day 6 and can be amplified by 48 times at most; whereas the control group (with CD3-CD28 beads) had slower proliferation of specific T cells, at most 12-fold expansion, and cells began to gradually apoptosis after the twelfth day, indicating that sh3857 cells were more effective in stimulating specific T cell expansion than with CD3-CD28 beads.

Example 6: detection of proliferation of sh3857 cells on TIL cells

sh3857 cell induction TIL cell proliferation assay: TIL was isolated from samples retrieved after surgical excision of liver cancer patients, stained with CFSE, and washed as SH3857: TIL cells=1:40 were co-cultured with IL-2 (50 IU/ml) added, and the control group was irradiated with CD3-CD28 beads (sh 3857 was previously irradiated with 40Gy gamma rays), designated d0. The experimental and control TIL cells were collected after day 5 and CFSE fluorescence intensity was flow-detected.

The results are shown in FIG. 5. The fluorescence intensity of T cells stimulated by adding sh3857 cells is continuously weakened, different proliferation peaks are presented, the rapid growth phase is entered on the 8 th day, and the maximum expansion can be achieved by 54 times; whereas the control group (with CD3-CD28 beads) had a slower proliferation of specific T cells, at most 13-fold expansion, and cells began to gradually apoptosis after the twelfth day, indicating that sh3857 cells were more effective in stimulating TIL cell expansion than with CD3-CD28 beads.

Example 7: flow assay for T cell activation, memory and suppressive phenotypes following sh3857 cell stimulation.

The experimental group T cells described in example 5 were collected and counted at 1X 10 ⁶ The individual cells/tubes were added to 9 EP tubes of 1.5ml, washed twice with PBS, centrifuged at 1200rpm for 5min, and the supernatant discarded; wherein two tubes are respectively added with a streaming antibody anti-CD137-PE and an anti-CD28-PE for detecting the phenotype of activated T cells, 1 tube is added with a streaming antibody anti-CD45RO-PECy5+anti-CCR 7-anti-CD 62L-PE for detecting the phenotype of memory T cells, 3 tubes are respectively added with a streaming antibody anti-PD1-PE, an anti-LAG3-Alexa Fluor 647 and an anti-TIM3-PE for detecting the phenotype of inhibitory T cells, and the other 3 tubes are respectively added with isotype control streaming antibodies IgG1-PE, igG1-PE+IgG2a-PECy5+IgG2a-PE and IgG1Alexa Fluor 647, each antibody 2 μl (all purchased from Jackson ImmunoResearch company) and are subjected to light spring precipitation to be uniformly mixed; after incubation for 30min at room temperature in the absence of light, PBS was washed once, centrifuged at 1200rpm for 5min, 400. Mu.l of physiological saline was added to the supernatant, and the cells were transferred to a flow tube and detected on-machine.

The experimental result shows that the positive rate of CD137 reaches 81.7% and the positive rate of CD28 reaches 93.5% for the T cells stimulated by sh3857 cells, but the positive rate of CD137 is only 24.2% for the T cells stimulated by CD3-CD28 beads, and the positive rate of CD28 is only 62.7% (FIG. 6A), which shows that the specific T cells stimulated by sh3857 cells can be better amplified, and the activated T cells occupy a larger proportion; meanwhile, the flow detection of the T cells stimulated by the sh3857 cells has extremely high expression of CD45RO (91.1%), and the flow detection of the T cells stimulated by the control group has the expression level of CD45RO of 79.9%, which indicates that the experimental group generates more memory T cells and can generate stronger re-immune response rapidly. CCR7 and CD62L (L-selectin) are markers of central memory T cells, the expression level of CCR7 and CD62L in the experimental group is 11.5% in this experiment, and the expression level of CD62L in the control group is only 7.2% (FIG. 6B), which indicates that a certain amount of central memory T cells exist, and when the cells meet tumor cells again, a strong immune response can be rapidly exerted.

In addition, the positive rates of the specific T cell flow assay suppressor T cell phenotypes PD1 and TIM3 after sh3857 cell stimulation were only 9.7% and 34.3%, respectively (fig. 7A), while the positive rates of the specific T cell flow assay suppressor T cell phenotypes PD1 and TIM3 after control group stimulation with CD3-CD28 beads were 18.1% and 47.9%, respectively (fig. 7B), indicating that the status of the specific T cells after sh3857 cell stimulation was better and not prone to aging.

Example 8: t cell IFN-cells stimulated with sh3857 cells and CD3-CD28 beads, respectivelyγStreaming of secretion situation Detection of

Taking one well of each of the d 12T cell 6 well plates of the experimental and control groups described in example 4, adding 5. Mu.l of the cell stimulating mixture, and placing at 37℃in 5% CO ₂ The incubator is filled for 4-6 hours. Fixing according to the specification of the cytokine detection kit, rupture of membranes, subpackaging in 2 EP tubes of 1.5ml, washing twice with PBS, centrifuging at 1200rpm for 5min, and discarding the supernatant; mu.l of the flow antibody IFN-. Gamma. -PE and IgG1-PE (isotype control) were added respectively, and mixed homogeneously by flick precipitation. After incubation for 30min at room temperature in the absence of light, PBS was washed once, centrifuged at 1200rpm for 5min, the supernatant was discarded, 400. Mu.l of physiological saline was added to transfer the cells into the flow tube and the cells were checked on-machine.

The results are shown in FIG. 8. Specific T cells secreting IFN-gamma in T cells stimulated by sh3857 account for a certain proportion (35.3%), while specific T cells secreting IFN-gamma in T cells stimulated by CD3-CD28 beads account for a smaller proportion (18.8%), which indicates that specific T cells after expansion of sh3857 cells have a stronger tumor killing capacity.

Although specific embodiments of the invention have been described in detail, those skilled in the art will appreciate. Numerous modifications and substitutions of details are possible in light of all the teachings disclosed, and such modifications are contemplated as falling within the scope of the present invention. The full scope of the invention is given by the appended claims and any equivalents thereof.

Sequence listing

<110> Shanghai cell therapy institute

SHANGHAI ENGINEERING RESEARCH CENTER FOR CELL THERAPY GROUP Co.,Ltd.

<120> an artificial antigen presenting cell for efficiently expanding whole T cells and use thereof

<130> 174393

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 987

<212> DNA

<213> artificial sequence

<220>

<223> anti-CD3TM coding sequence

<400> 1

atggaagccc cagctcagct tctcttcctc ctgctactct ggctcccaga taccaccgga 60

caggtccagc tgcagcagtc tggggctgaa ctggcaagac ctggggcctc agtgaagatg 120

tcctgcaagg cttctggcta cacctttact aggtacacga tgcactgggt aaaacagagg 180

cctggacagg gtctggaatg gattggatac attaatccta gccgtggtta tactaattac 240

aatcagaagt tcaaggacaa ggccacattg actacagaca aatcctccag cacagcctac 300

atgcaactga gcagcctgac atctgaggac tctgcagtct attactgtgc aagatattat 360

gatgatcatt actgccttga ctactggggc caaggcacca ctgtgacagt ctcctcaggt 420

ggaggcggtt caggcggagg tggcagcggc ggtggcgggt cgcaaattgt tctcacccag 480

tctccagcaa tcatgtctgc atctccaggg gagaaggtca ccatgacctg cagtgccagc 540

tcaagtgtaa gttacatgaa ctggtaccag cagaagtcag gcacctcccc caaaagatgg 600

atttatgaca catccaaact ggcttctgga gtccctgctc acttcagggg cagtgggtct 660

gggacctctt actctctcac aatcagcggc atggaggctg aagatgctgc cacttattac 720

tgccagcagt ggagtagtaa cccattcacg ttcggctcgg ggacaaagtt ggaaataaac 780

attgaagtta tgtatcctcc tccttaccta gacaatgaga agagcaatgg aaccattatc 840

catgtgaaag ggaaacacct ttgtccaagt cccctatttc ccggaccttc taagcccttt 900

tgggtgctgg tggtggttgg tggagtcctg gcttgctata gcttgctagt aacagtggcc 960

tttattattt tctgggtgag gagtaag 987

<210> 2

<211> 1020

<212> DNA

<213> artificial sequence

<220>

<223> anti-CD28TM coding sequence

<400> 2

atggagtttt ggctgagctg ggttttcctt gttgctattt taaaaggtgt ccagtgtcag 60

gtgcagctgg tgcagtctgg ggctgaggtg aagaagcctg gggcctcagt gaaggtctcc 120

tgcaaggctt ctggatacac cttcaccagc tactatatac actgggtgcg acaggcccct 180

ggacaagggc ttgagtggat tggatgtatt tatcctggaa atgtcaatac taactataat 240

gagaagttca aggacagggc caccctgacc gtagacacgt ccatcagcac agcctacatg 300

gagctgagca ggctgagatc tgacgacacg gccgtgtatt tctgtacaag atcacactac 360

ggcctcgact ggaacttcga tgtctggggc caagggacca cggtcaccgt ctcctcaggt 420

ggaggcggtt caggcggagg tggcagcggc ggtggcgggt cggacatcca gatgacccag 480

tctccatcct ccctgtctgc atctgtagga gacagagtca ccatcacttg ccatgccagt 540

caaaacattt atgtttggtt aaactggtat cagcagaaac cagggaaagc ccctaagctc 600

ctgatctata aggcttccaa cctgcacaca ggggtcccat caaggttcag tggcagtgga 660

tctgggacag atttcactct caccatcagc agtctgcaac ctgaagattt tgcaacttac 720

tactgtcaac agggtcaaac ttatccgtac acgttcggcg gagggaccaa ggtggagatc 780

aaattcgtgc cggtcttcct gccagcgaag cccaccacga cgccagcgcc gcgaccacca 840

acaccggcgc ccaccatcgc gtcgcagccc ctgtccctgc gcccagaggc gtgccggcca 900

gcggcggggg gcgcagtgca cacgaggggg ctggacttcg cctgtgatat ctacatctgg 960

gcgcccttgg ccgggacttg tggggtcctt ctcctgtcac tggttatcac cctttactgc 1020

<210> 3

<211> 1032

<212> DNA

<213> artificial sequence

<220>

<223> anti-CD137TM coding sequence

<400> 3

atggaagccc cagctcagct tctcttcctc ctgctactct ggctcccaga taccaccgga 60

caggtgcaac tacagcagtg gggcgcagga ctgttgaagc cttcggagac cctgtccctc 120

acctgcgctg tctatggtgg gtccttcagt ggttactact ggagctggat acgccagtcc 180

ccagagaagg ggctggagtg gattggggaa atcaatcatg gtggatacgt cacctacaat 240

ccgtccctcg agagtcgagt caccatatca gtagacacgt ccaagaacca gttctccctg 300

aagctgagct ctgtgaccgc cgcggacacg gctgtatatt actgtgcgag ggactatggt 360

ccggggaatt atgactggta cttcgatctc tggggccgtg gcaccctggt cactgtctcc 420

tcaggtggag gcggttcagg cggaggtggc agcggcggtg gcgggtcgga aattgtgttg 480

acacagtctc cagccaccct gtctttgtct ccaggggaaa gagccaccct ctcctgcagg 540

gccagtcaga gtgttagcag ctacttagcc tggtaccaac agaaacctgg ccaggctccc 600

aggctcctca tctatgatgc atccaacagg gccactggca tcccagccag gttcagtggc 660

agtgggtctg ggacagactt cactctcacc atcagcagcc tagagcctga agattttgca 720

gtttattact gtcagcagcg tagcaactgg cctccggcgc tcactttcgg cggagggacc 780

aaggtggaga tcaaattcgt gccggtcttc ctgccagcga agcccaccac gacgccagcg 840

ccgcgaccac caacaccggc gcccaccatc gcgtcgcagc ccctgtccct gcgcccagag 900

gcgtgccggc cagcggcggg gggcgcagtg cacacgaggg ggctggactt cgcctgtgat 960

atctacatct gggcgccctt ggccgggact tgtggggtcc ttctcctgtc actggttatc 1020

accctttact gc 1032

<210> 4

<211> 906

<212> DNA

<213> artificial sequence

<220>

<223> IL15TM coding sequence

<400> 4

atggagtttt ggctgagctg ggttttcctt gttgctattt taaaaggtgt ccagtgtaac 60

tgggtgaatg taataagtga tttgaaaaaa attgaagatc ttattcaatc tatgcatatt 120

gatgctactt tatatacgga aagtgatgtt caccccagtt gcaaagtaac agcaatgaag 180

tgctttctct tggagttaca agttatttca cttgagtccg gagatgcaag tattcatgat 240

acagtagaaa atctgatcat cctagcaaac gacagtttgt cttctaatgg gaatgtaaca 300

gaatctggat gcaaagaatg tgaggaactg gaggaaaaaa atattaaaga atttttgcag 360

agttttgtac atattgtcca aatgttcatc aacacttctg gtggaggcgg ttcaggcgga 420

ggtggcagcg gcggtggcgg gtcgatcacg tgccctcccc ccatgtccgt ggaacacgca 480

gacatctggg tcaagagcta cagcttgtac tccagggagc ggtacatttg taactctggt 540

ttcaagcgta aagccggcac gtccagcctg acggagtgcg tgttgaacaa ggccacgaat 600

gtcgcccact ggacaacccc cagtctcaaa tgcattagag acggtggagg tggaggtgga 660

ggtggaggtt tcgtgccggt cttcctgcca gcgaagccca ccacgacgcc agcgccgcga 720

ccaccaacac cggcgcccac catcgcgtcg cagcccctgt ccctgcgccc agaggcgtgc 780

cggccagcgg cggggggcgc agtgcacacg agggggctgg acttcgcctg tgatatctac 840

atctgggcgc ccttggccgg gacttgtggg gtccttctcc tgtcactggt tatcaccctt 900

tactgc 906

<210> 5

<211> 36

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 5

acgcgtcgac ttatcagccg ctgcccttac tcctca 36

<210> 6

<211> 30

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 6

ccggaattcg ccaccatgga agccccagct 30

<210> 7

<211> 19

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 7

gctttccctg gtttctgct 19

<210> 8

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 8

gtctccatcc tccctgtctg 20

<210> 9

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 9

gctgctgatg gtgagagtga 20

<210> 10

<211> 21

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 10

ttactgtgcg agggactatg g 21

<210> 11

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 11

gcagggcttc ctaaaacaga 20

<210> 12

<211> 19

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 12

gcaactgggg tgaacatca 19

Claims

1. A transgenic artificial antigen presenting cell, wherein the transgenic artificial antigen presenting cell:

(1) Expressing the T cell first signal membrane bound activating antibody, the T cell second signal membrane bound activating antibody and the cytokine; and/or

(2) The genome is stably integrated with an expression frame containing a first signal membrane-binding type activating antibody of the coded T cells, a second signal membrane-binding type activating antibody of the T cells and cytokines;

wherein the T cell first signal membrane-bound activating antibody is an anti-CD 3 antibody; the T cell second signal membrane bound activating antibodies are anti-CD 28 antibodies and anti-CD 137 antibodies; the cytokine is a fusion protein of the extracellular domain of IL-15 and the alpha receptor of IL-15.

2. The transgenic artificial antigen presenting cell of claim 1, wherein both ends of the expression cassette comprise inverted terminal repeats of a transposon.

3. The transgenic artificial antigen presenting cell of claim 2,

The transposon is selected from the group consisting of: piggybac, sleep reliability, frog priority, tn5 and Ty;

the transgenic artificial antigen presenting cells are selected from the group consisting of dendritic cells, monocytes and activated B cells.

4. The transgenic artificial antigen presenting cell of claim 3, wherein the transposon is piggybac.

5. The transgenic artificial antigen presenting cell of claim 3, wherein the transgenic artificial antigen presenting cell is a cell that does not express a human MHC molecule.

6. The transgenic artificial antigen presenting cell of claim 3, wherein the transgenic artificial antigen presenting cell is a K562 cell.

7. The transgenic artificial antigen presenting cell of claim 1, wherein the anti-CD 3 antibody is an anti-CD 3 single chain antibody.

8. The transgenic artificial antigen presenting cell of claim 1,

the anti-CD 3 antibody is a single chain antibody against the CD3 epsilon peptide chain; and/or

The anti-CD 28 antibody is an anti-CD 28 single-chain antibody, and the anti-CD 137 antibody is an anti-CD 137 single-chain antibody.

9. The transgenic artificial antigen presenting cell of claim 8,

The amino acid sequence of the anti-CD 3 antibody is the amino acid sequence encoded by the 61 st to 780 th base sequence of SEQ ID NO. 1;

the amino acid sequence of the anti-CD 28 single-chain antibody is the amino acid sequence encoded by the 58 th-783 th base sequence of SEQ ID NO. 2;

the amino acid sequence of the anti-CD 137 single-chain antibody is the amino acid sequence encoded by the base sequence of the 61 st to 795 th positions of SEQ ID NO. 3; and

the amino acid sequence of the fusion protein of the extracellular domain of IL-15 and the alpha receptor thereof is the amino acid sequence encoded by the 58 th to 669 th base sequence of SEQ ID NO. 4.

10. The transgenic artificial antigen presenting cell of claim 1, wherein the cell is transformed with the following expression vector:

(1) A nucleic acid construct comprising a transposon 5 'inverted terminal repeat sequence, a promoter controlling expression of the coding sequence of the T cell first signal membrane-associated activating antibody, a coding sequence of the CD28 extracellular region and the transmembrane region, a polyA tailing signal sequence, a transposon 3' inverted terminal repeat sequence, a transposase coding sequence, and a promoter controlling expression of the transposase coding sequence, which are sequentially linked;

(2) A nucleic acid construct comprising a transposon 5 'inverted terminal repeat sequence, a promoter controlling expression of the coding sequence of the T cell second signal membrane-bound activating antibody, a coding sequence of the CD8 extracellular region and the transmembrane region, a polyA tailing signal sequence, a transposon 3' inverted terminal repeat sequence, a transposase coding sequence, and a promoter controlling expression of the transposase coding sequence, which are sequentially linked; and

(3) A nucleic acid construct comprising, in sequence, a transposon 5 'inverted terminal repeat, a promoter controlling expression of the coding sequence of the cytokine, a coding sequence of the CD8 extracellular region and the transmembrane region, a polyA tailing signal sequence, a transposon 3' inverted terminal repeat, a transposase coding sequence, and a promoter controlling expression of the transposase coding sequence.

11. The transgenic artificial antigen presenting cell of claim 10, wherein (2) the expression vector comprises two expression vectors that express an anti-CD 28 antibody and an anti-CD 137 antibody, respectively.

12. A composition comprising the following nucleic acid constructs A, B and C:

Nucleic acid construct a for a T cell primary signal membrane-bound activating antibody comprising, in sequence, a transposon 5 'inverted terminal repeat sequence, a promoter controlling expression of the coding sequence of the T cell primary signal membrane-bound activating antibody, the coding sequences of the CD28 extracellular region and the transmembrane region, a polyA tailing signal sequence, a transposon 3' inverted terminal repeat sequence, a transposase coding sequence, and a promoter controlling expression of the transposase coding sequence;

a nucleic acid construct B for expressing a T cell second signal membrane-bound activating antibody, comprising, in sequence, a transposon 5 'inverted terminal repeat sequence, a promoter for controlling expression of the coding sequence of the T cell second signal membrane-bound activating antibody, a coding sequence of the T cell second signal membrane-bound activating antibody, coding sequences of the CD8 extracellular region and the transmembrane region, a polyA tailing signal sequence, a transposon 3' inverted terminal repeat sequence, a transposase coding sequence, and a promoter for controlling expression of the transposase coding sequence; and

a nucleic acid construct C for expressing a cytokine, comprising, in order, a transposon 5 'inverted terminal repeat, a promoter for controlling expression of the coding sequence of the cytokine, a coding sequence for the CD8 extracellular region and the transmembrane region, a polyA tailing signal sequence, a transposon 3' inverted terminal repeat, a transposase coding sequence, and a promoter for controlling expression of the transposase coding sequence;

Wherein the T cell first signal membrane-bound activating antibody is an anti-CD 3 antibody; the T cell second signal membrane bound activating antibodies are anti-CD 28 antibodies and anti-CD 137 antibodies; the cytokine is a fusion protein of the extracellular domain of IL-15 and the alpha receptor of IL 15;

wherein the nucleic acid construct B comprises 2 nucleic acid constructs, one of which expresses an anti-CD 28 antibody and the other of which expresses an anti-CD 137 antibody.

13. The composition of claim 12, wherein the composition comprises,

the nucleic acid construct is a eukaryotic expression vector;

the transposase is a transposase from piggybac, sleep reliability, frog priority, tn5 or Ty.

14. The composition of claim 12, wherein the composition comprises,

the nucleic acid construct A comprises a transposon 5 'inverted terminal repeat sequence, an EF1 alpha promoter, a coding sequence of an anti-CD 3 single-chain antibody, a coding sequence of a CD28 extracellular region and a transmembrane region, a polyA tailing signal sequence, a transposon 3' inverted terminal repeat sequence, a coding sequence of a transposase from a piggybac transposition system and a CMV promoter for controlling the expression of the transposase coding sequence which are connected in sequence;

the nucleic acid construct B contains a transposon 5' inverted terminal repeat sequence, an EF1 alpha promoter, a coding sequence of an anti-CD 28 single chain antibody, a coding sequence of an extracellular region and a transmembrane region of CD8, a polyA tailing signal sequence and a transposon 3' inverted terminal repeat sequence, a coding sequence of a transposase from a piggybac transposition system and a CMV promoter for controlling the expression of the transposase coding sequence which are sequentially connected, and the nucleic acid construct B contains a transposon 5' inverted terminal repeat sequence, an EF1 alpha promoter, a coding sequence of an anti-CD 137 single chain antibody, a coding sequence of an extracellular region and a transmembrane region of CD8, a polyA tailing signal sequence and a coding sequence of a transposase from a piggybac transposition system and a CMV promoter for controlling the expression of the transposase coding sequence which are sequentially connected; and

The nucleic acid construct C contains a transposon 5 'inverted terminal repeat, an EF1 alpha promoter, a fusion protein coding sequence of an IL15 extracellular domain and an IL15 alpha receptor, a coding sequence of an extracellular region and a transmembrane region of CD8, a polyA tailing signal sequence, a transposon 3' inverted terminal repeat, a coding sequence of a transposase from a piggybac transposable system, and a CMV promoter for controlling expression of the transposase coding sequence, which are sequentially connected.

15. The composition of claim 14, wherein the composition comprises,

the amino acid sequence of the anti-CD 3 single-chain antibody is the amino acid sequence encoded by the 61 st-780 th base sequence of SEQ ID NO. 1;

16. The composition of claim 14, wherein the nucleic acid construct a comprises the nucleotide sequence set forth in SEQ ID No. 1; the nucleic acid construct B comprises a nucleotide sequence shown as SEQ ID NO. 2 and a nucleotide sequence shown as SEQ ID NO. 3; the nucleic acid construct C contains a nucleotide sequence shown in SEQ ID NO. 4.

17. A kit comprising the composition of any one of claims 12-16.

18. Use of the transgenic artificial antigen presenting cell of any one of claims 1-11, the use being: inducing T cell proliferation and activation, and/or generating central memory T cells, and/or stimulating T cells to secrete IFN- γ, and/or increasing the ability of specific T cells to kill tumors; wherein the use is for non-therapeutic purposes.

19. The use of claim 18, wherein the T cells comprise peripheral blood mononuclear cell-derived T lymphocytes, tumor-infiltrating T lymphocytes, and CAR-T cells; the tumor is selected from: liver cancer, lung cancer, colon cancer, pancreatic cancer, gastric cancer, breast cancer, nasopharyngeal cancer, lymphoma, ovarian cancer, bladder cancer, prostate cancer, and head and neck tumors.