CN109295227A - The optimization method and testing product of EGFR gene T790M mutation digital pcr detection architecture - Google Patents

The optimization method and testing product of EGFR gene T790M mutation digital pcr detection architecture Download PDF

Info

Publication number
CN109295227A
CN109295227A CN201811191489.XA CN201811191489A CN109295227A CN 109295227 A CN109295227 A CN 109295227A CN 201811191489 A CN201811191489 A CN 201811191489A CN 109295227 A CN109295227 A CN 109295227A
Authority
CN
China
Prior art keywords
wild
template
type
mutation
probe
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201811191489.XA
Other languages
Chinese (zh)
Inventor
赵新泰
王明
潘文健
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Saian Biological Pharmaceutical Polytron Technologies Inc
Original Assignee
Shanghai Saian Biological Pharmaceutical Polytron Technologies Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Saian Biological Pharmaceutical Polytron Technologies Inc filed Critical Shanghai Saian Biological Pharmaceutical Polytron Technologies Inc
Priority to CN201811191489.XA priority Critical patent/CN109295227A/en
Publication of CN109295227A publication Critical patent/CN109295227A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a kind of optimization methods of EGFR gene T790M mutation digital pcr detection architecture, and detection architecture includes upstream primer, downstream primer, wild-type probe, saltant type probe, wild-type template and saltant type template；Wild-type template is the normal human gDNA after digestion, and saltant type template is the mutant plasmid of the insertion EGFR gene T790M mutant fragments after digestion；Saltant type template and wild-type template are configured to standard items in certain copy number ratio, digital pcr is used to be reacted using middle frequency of mutation standard items as template, data statistics figure is made according to response data, selectes the fluorescence area of wild type and the fluorescence area of saltant type.It uses digital pcr to be reacted by template of wild-type template, determines background threshold.Testing product accuracy after the optimization method optimization of EGFR gene T790M mutation digital pcr detection architecture through the invention is higher.

Description

The optimization method and testing product of EGFR gene T790M mutation digital pcr detection architecture
Technical field
The present invention relates to the digital pcr testing products and its optimization method of detection human EGFR gene T790M mutation, belong to Field of biotechnology.
Background technique
Worldwide, lung cancer is that morbidity and mortality occupy the first malignant tumour.It is non-small in patients with lung cancer The incidence of cell lung cancer (NSCLC) is 85%, wherein being in middle and advanced stage more than 7 one-tenth.Wherein, epidermal growth factor receptor gene (EGFR) be China's adenocarcinoma of lung occur main driving gene.
EGF-R ELISA (EGFR) belongs to tyrosine kinases receptor, transmembrane, and intracellular part is it Kinase activity region.EGFR monomer after activation is converted into the dimer of state of activation, and the phosphorylation in bootable downstream, induction is carefully The increment of born of the same parents.EGFR gene tyrosine kinase activity region includes a series of activated mutant, wherein common are including No. 19 Point mutation (L858R) in exon in certain and 21 exons of base.EGFR tyrosine kinase inhibitor is (such as: E Luo For Buddhist nun and Gefitinib) there is more sensitive effect to the patient for carrying tyrosine kinase region to mutation living.But there is network The patient of histidine kinase inhibitor (TKI) sensitizing mutation can generate drug resistance in 2 years.The generation 60% of resistance be due to Caused by EGFR gene T790M is mutated.For EGFR-TKIs drug resistance, the drug of a variety of a new generations, these drugs have been generated It can inhibit the kinase activity with T790M mutation.Therefore, to achieve the purpose that accurate medication, the T790M of EGFR gene is mutated Detection necessitate.
There is materials hardly possible in the tissue biopsy that the method for traditional detection T790M mutation uses, this method, tool intrusion wound is asked Topic.In addition, there are the limitations of tumor tissues heterogeneity for traditional tissue biopsy.Circulating tumor DNA (ctDNA) refers to from swollen Tumor tissue discharges into the DNA of blood plasma, carries the real time information from tumor tissues.Therefore, ctDNA is detected, no It can only accomplish hurtless measure, and can accomplish to observe adjustment therapeutic scheme in time in real time.But due to being present in blood plasma CtDNA content is less than 1% and height fragmentation (180bp), and common ARMS-PCR sensitivity can reach 1 percent nothings Method reaches testing requirements.
The appearance of digital pcr (dPCR) promotes the development of normal PCR detection, greatly improves the sensitivity of detection. By counting a large amount of single copy reaction droplet, accuracy and precision are greatly improved.What it is due to dPCR statistics is single Molecule sum can theoretically accomplish each reacton for single copy template.Therefore, digital pcr can achieve absolute quantitation.
Summary of the invention
The accuracy that digital pcr reaction system can be made to detect the technical problem to be solved in the present invention is to provide one kind has The optimization method of higher EGFR gene T790M mutation digital pcr detection architecture, and pass through the inspection after optimization method optimization Survey product.
A kind of technical solution that the present invention proposes to solve above-mentioned technical problem is: a kind of EGFR gene T790M mutation count The optimization method of word PCR detection architecture, the detection architecture include upstream primer, downstream primer, wild-type probe, saltant type spy Needle, wild-type template and saltant type template；The nucleotide sequence of the upstream primer is as shown in SEQ ID No.1, the downstream The nucleotide sequence of primer is as shown in SEQ ID No.2, the nucleotide sequence of the wild-type probe such as SEQ ID No.3 institute Show, the nucleotide sequence of the saltant type probe is as shown in SEQ ID No.4；The wild-type template is the normal person after digestion Body gDNA, the saltant type template are the mutant plasmids of the insertion EGFR gene T790M mutant fragments after digestion；
Saltant type template and wild-type template are configured to middle frequency of mutation standard in the copy number ratio of 1:50 to 1:200 Product use digital pcr to be reacted using middle frequency of mutation standard items as template, make data statistics figure, choosing according to response data Determine the fluorescence area of wild type and the fluorescence area of saltant type, fluorescence in the fluorescence area of saltant type and the fluorescence area of wild type Saltant type template and the copy number ratio of wild-type template are identical in the ratio of signal copy number and middle frequency of mutation standard items；
Digital pcr is used to be reacted by template of wild-type template, the fluorescence letter occurred in the fluorescence area of saltant type Number copy number is the background threshold of the detection architecture.
Saltant type template and wild-type template are configured to high frequency of mutation standard in the copy number ratio of 1:1 to 1:10 Product use real-time fluorescence quantitative PCR to be reacted using low frequency of mutation standard items as template, according to reaction end fluorescent value and just Beginning fluorescent value and probe use the relationship of concentration, optimize the use concentration of wild-type probe and saltant type probe.
The reaction end fluorescent value and initial fluorescence value and probe using the relationship of concentration be reaction end fluorescent value with The ratio of initial fluorescence value is bigger, and reaction end fluorescent value and the difference of initial fluorescence value are bigger, then wild-type probe and prominent The use concentration of modification probe is better.
Saltant type template and wild-type template are configured to the low frequency of mutation in the copy number ratio of 1:1000 to 1:10000 Standard items use digital pcr to be reacted using low frequency of mutation standard items as template, if occur in the fluorescence area of saltant type Fluorescence signal copy number is greater than 2.5 times of the background threshold, then the sensitivity of the detection architecture reaches low frequency of mutation standard The identical value of copy number ratio of product.
The wild-type probe and saltant type probe are MGB probe, 3 ' ends of the wild-type probe and saltant type probe It is NFQ group.
5 ' ends of the wild-type probe are VIC group, and 5 ' ends of the saltant type probe are FAM group.
A kind of technical solution that the present invention proposes to solve above-mentioned technical problem is: after above-mentioned optimization method optimization EGFR gene T790M be mutated digital pcr testing product.
The final concentration of 900nM of the upstream primer and downstream primer in the reaction system, the wild-type probe and prominent The final concentration of 200nM of modification probe in the reaction system.
The wild-type probe and saltant type probe are MGB probe, 3 ' ends of the wild-type probe and saltant type probe It is NFQ group；5 ' ends of the wild-type probe are VIC group, and 5 ' ends of the saltant type probe are FAM group.
The present invention has the effect of positive:
(1) EGFR gene T790M abrupt climatic change system of the invention, accepted standard product are with the normal human after digestion The mutant plasmid of insertion EGFR gene T790M mutant fragments after gDNA and digestion is formulated in copy number ratio, and difference is prominent Frequency standard items play different effects.Standard items can restore the spy of detection sample using gDNA and plasmid to the greatest extent Sign, provides many bases to the optimization of system, plays the role of in system optimization conclusive.
(2) EGFR gene T790M abrupt climatic change system of the invention is detected by the digital pcr of middle frequency of mutation standard items As a result the fluorescence area of wild type and the fluorescence area of saltant type are determined, so that the result of data statistics is more accurate.The present invention EGFR gene T790M abrupt climatic change system the background of detection architecture is determined by the digital pcr testing result of wild-type template Threshold value, when detecting the mutant copies number of sample, mutant copies number is equal to testing result and subtracts background threshold, can make result more It is accurate to add.
(3) EGFR gene T790M abrupt climatic change system of the invention is detected by the digital pcr of low frequency of mutation standard items As a result, the sensitivity of detection architecture can be determined.
(4) EGFR gene T790M abrupt climatic change system of the invention is glimmering in real time by the tradition of high frequency of mutation standard items Light PCR testing result carry out concentration and probe concentration optimization, according to react before fluorescence intensity (F0) with react after fluorescence intensity (Fn) difference It is standard with the biggish reaction system of ratio, selects suitable concentration and probe concentration, this method result is accurate, and cost is relatively low.
(5) primed probe of EGFR gene T790M abrupt climatic change system of the invention is designed, designed, and probe is MGB spy Needle, probe sequence is shorter, and specificity is good.Primed probe is selected by Multiple Combination optimization, and amplification efficiency is high, high sensitivity.
(6) the EGFR gene T790M abrupt climatic change system after optimization of the invention is quick, and efficiently, cost is relatively low, accuracy The T790M that height can fast and accurately detect tumor patient EGFR gene according to T790M mutation ctDNA micro in sample is prominent Become, therefore digital pcr platform can be used for the detection of ctDNA, the generation of the new gene mutation of patient can be monitored in time, for clinic The formulation and adjustment of therapeutic scheme provide foundation.
Detailed description of the invention
Fig. 1 is that the kit of embodiment 1 detects the response data result figure of full wild-type template；
Fig. 2 is the wild response data result figure than the template for being 0.01 of kit detection mutation of embodiment 1；
Fig. 3 is the wild response data result figure than the template for being 0.0001 of kit detection mutation of embodiment 1.
Specific embodiment
The present invention is specifically described below by embodiment, it is necessary to which indicated herein is that following embodiment is only used In invention is further explained, it should not be understood as limiting the scope of the invention, person skilled in art can To make some nonessential modifications and adaptations to the present invention according to aforementioned present invention content.In following embodiments, if not specially Show that reagent used is that analysis is pure, and agents useful for same can be obtained from commercial channel.The experiment of actual conditions is not specified in text Method, " the molecular cloning reality that the Science Press that such as J. Pehanorm Brooker is write usually according to normal condition publishes for 2002 Test guide " condition described in a book, or according to condition proposed by manufacturer.Unless otherwise defined, institute as used herein There are professional and scientific terms to have the same meanings as commonly understood by one of ordinary skill in the art.In addition, it is any similar to described content or Impartial method and material all can be applied in the present invention.
Main agents:
For all reagent purchases from regular producer, main agents include: TaqMan GenotypingMaster Mix (2 ×) (Applied Biosystems), 25 × Droplet stabilizer (RainDance), AfaI restriction endonuclease (TAKARA, 1116A), 10 × T Buffer (TAKARA, 1116A) and 0.1%BSA (TAKARA, 1116A), small amount plasmid extraction kit (D1100, Beijing Suo Laibao Science and Technology Ltd), AxyPrep Multisource Genomic DNA Miniprep Kit (AP-MN-MS-GDNA-50G, healthy and free from worry life science Co., Ltd) etc..
Key instrument:
PCR instrument (producer: EXcell Bio),3.0 fluorescent quantitation instruments, supercentrifuge, whirlpool concussion instrument, ice Case, autoclave, liquid-transfering gun, RainDropSource (RainDance Technologies), RainDropSense (RainDance Technologies) etc..
Embodiment 1
It includes upstream primer (EGFR-T790M- that the EGFR gene T790M of the present embodiment, which is mutated digital PCR detection kit, F), downstream primer (EGFR-T790M-R), wild-type probe (EGFR-T790M-wt) and saltant type probe (EGFR-T790M- Mt), the normal human gDNA after digestion and the mutant plasmid after digestion.
Primer and probe is designed, designed, is optimized by Multiple Combination, includes being inserted into primed probe in mutant plasmid Mutant fragments homology region.Primed probe is synthesized by hundred Li Ge Bioisystech Co., Ltd of Shanghai, primer and probe Nucleotide sequence is as shown in table 1.
1 primer probe sequence table of table
Title Sequence(5’—3’) Seq No.
EGFR-T790M-F CCTCACCTCCACCGTGCA 1
EGFR-T790M-R GTCTTTGTGTTCCCGGACATAGT 2
EGFR-T790M-wt ATGAGCTGCGTGATGAG 3
EGFR-T790M-mt ATGAGCTGCATGATGAG 4
5 ' ends of wild-type probe (EGFR-T790M-wt) are VIC fluorophor, wild-type probe (EGFR-T790M- Wt 3 ' ends) are NFQ group.5 ' ends of saltant type probe (EGFR-T790M-mt) are FAM fluorophor, wild-type probe (EGFR-T790M-wt) 3 ' ends are NFQ group.
The present embodiment uses the normal human gDNA after digestion as wild-type template, being mutated after digestion containing T790M The plasmid of Insert Fragment is as mutagenesis template, and institute's Insert Fragment is the EGFR gene of source of people in mutant plasmid, and clip size is 200bp。
Wild-type template and saltant type template are configured to theoretical mutations frequency in different copy number ratios by the present embodiment Template, the preparation method is as follows:
1. sample extracts.
One nothing is extracted using kit (AxyPrep Multisource Genomic DNA Miniprep Kit) The haemocyte DNA of the Healthy People of EGFR mutation, specific operation is referring to reagent kit product specification.
It is prominent that artificial constructed successful importing tool EGFR mutation T 790M is extracted using kit (small amount plasmid extraction kit) Become the plasmid engineering bacterium with wild-type nucleic acid segment, specific operation is referring to reagent kit product specification.
The concentration mensuration of 2.gDNA and mutant plasmid.
UsingDNA concentration measurement after 3.0 pairs of extractings, the specific steps are as follows:
1) 1 μ l Qubit dsDNA HS Reagent and 199 μ l Qubit dsDNA HS is added to sample tube Buffer, whirlpool mix 4s；
2) 1 μ l working solution to be drawn into the sample cell for added working solution, and the DNA sample of 1 μ l is added, whirlpool mixes 4s, The final volume of every pipe is 200 μ l；
3) all pipes are protected from light incubation 2 minutes in room temperature；
4) exist" DNA " key is clicked in 3.0 main screens, then dsDNA High Sensitivity is selected to analyze mould Formula；
5) sample tube is put intoIt in 3.0, closes the lid, clicks read；
6) Calculate Initial initial concentration is selected, Volume of Sample Used:1 μ l is then selected, this When the result that shows be sample initial concentration, unit ng/ μ l；
7) it reads next sample: taking out sample in Qubit3.0 fluophotometer；
8) with the concentration of same method measurement mutant plasmid.
3. the preparation of standard items.
1) DNA profiling endonuclease bamhi.
GDNA and mutant plasmid carry out endonuclease reaction respectively.The endonuclease reaction system of gDNA is as shown in table 2.
2 gDNA endonuclease reaction system table of table
Ingredient Dosage
10 × T of reagent name Buffer 5μl
AfaI 0.5μl
0.1%BSA 5μl
Haemocyte gDNA 39.5μl
The endonuclease reaction system of mutant plasmid is as shown in table 3.
The endonuclease reaction system table of 3 mutant plasmid of table
Ingredient Dosage
10x SEBuffer 5μl
BSA 5μl
EcoRⅠ 0.5μl
Plasmid DNA 39.5μl
Paramagnetic particle method recycles after digestion:
A. the digestion products of 50 μ l are transferred in the EP pipe of 1.5ml, the AmPure XP of 90 μ l is added into EP pipe Reagent magnetic bead, piping and druming mix, and stand 5min.
B. by EP pipe as on magnetic frame, until Beads enrichment, abandons solution.
C.200 the ethanol water that the concentration of μ l is 80% cleans 2 times, dries.
D.52 the dH of μ l2O elutes magnetic bead, as magnetic frame, to Beads enrichment.
E. the DNA solution for shifting 50 μ l is managed as a new EP, and 50 μ l magnetic beads are added, stand 5min.
F. it is placed in magnetic frame, to Beads enrichment, is washed 2 times, is dried in the air with the ethanol water that 80% concentration of 200 μ l is 80% It is dry.
G. magnetic bead is eluted with the dH2O of 12 μ l, the solution of 9.4 μ l of transfer is placed in a new PCR pipe, for next Experiment.1 μ l is taken to carry out3.0 quantitative.
2) preparation of standard items.
1. the gDNA after digestion is calculated according to every nanogram 300 copy, it is diluted to 2.0 × 10 step by step6copies/μl。
2. the mutant plasmid copy Particle density after digestion is as follows: 9.12 × 108× plasmid concentration (ng/ μ l) ÷ matter Grain length；It is diluted to 2.0 × 10 step by step6copies/μl、2.0×104copies/μl、2.0×102copies/μl。
3. preparing system optimization standard items: the concentration for taking equivalent respectively is 2.0 × 104After the digestion of copies/ μ l GDNA is mixed with the mutant plasmid after digestion, obtains being mutated the wild high frequency of mutation standard items template than for 1:1.Take 10 μ l's Concentration is 2.0 × 106GDNA after the digestion of copies/ μ l, it is 2.0 × 10 that 10 μ l concentration, which are added,4After the digestion of copies/ μ l Mutant plasmid obtain being mutated the wild middle frequency of mutation standard items template than for 0.01.Take 10 μ l concentration be 2.0 × 106GDNA after the digestion of copies/ μ l, it is 2.0 × 10 that 10 μ l concentration, which are added,2Mutant plasmid after the digestion of copies/ μ l obtains To the wild low frequency of mutation standard items template than for 0.0001 of mutation.
The present embodiment carries out the optimization of concentration and probe concentration using real time fluorescent quantitative (qPCR) reaction.
According to the final concentration of 900nM of experimental condition fixed upstream primer and downstream primer in the reaction system, probe is dense Degree optimizes experiment by following scheme:
The final concentration of wild-type probe (EGFR-T790M-wt) and saltant type probe (EGFR-T790M-mt) is first pressed into table 4 Shown in concentration, be divided into 9 test groups.
4 concentration and probe concentration grouping sheet of table
According to qPCR reaction system component table shown in table 5, prepare qPCR reaction system, template use mutation it is wild compare for The high frequency of mutation standard items template of 1:1.
5 qPCR reaction system component table of table
QPCR reaction is carried out according to qPCR response procedures shown in table 6.
6 qPCR response procedures table of table
Data analysis is carried out to qPCR reaction result, qPCR reaction result is as shown in table 7.It is bigger according to Fn/Fn0 value and Fn-Fn0 difference is bigger, and the signal-to-noise ratio of detection architecture is higher, accuracy is higher, selects 2-3 group namely wild-type probe and mutation When the final concentration of 200nM of type probe reaction, reaction system is most suitable for subsequent digital pcr reaction.
7 qPCR reaction result of table
The EGFR gene T790M of the present embodiment is mutated digital PCR detection kit, and detection sample is generally blood, can also Think any form of sample that can extract nucleic acid, including but not limited to: whole blood, serum, blood plasma and tissue sample；Tissue sample Including but not limited to: paraffin-embedded tissue, flesh tissue and frozen section.
The EGFR gene T790M of the present embodiment is mutated digital PCR detection kit, when in use, according to shown in table 8 DPCR reaction system component table, prepares dPCR reaction system, and template uses the wild middle frequency of mutation standard than for 0.01 of mutation Product template.
8 dPCR reaction system component table of table
DPCR reaction is carried out, dPCR response procedures are as shown in table 9.
9 dPCR response procedures table of table
Cyclic amplification is arranged to anneal from 95 DEG C of denaturation to 58 DEG C, falling temperature gradient is 0.4 DEG C per second.
3) reading data and analysis
Raindance sense carries out the reading of data, uses RainDropAnalyst II to the analysis of initial data (V1.0.0) software is analyzed, and steps are as follows:
A. RainDropAnalyst II is opened, " Add sample " is clicked by original fcs data file and imports software；
B. the wild initial data than being 0.01 sample of mutation selected first is analyzed；
C. negative point set, wild point set and mutation point set, point solution " Apply spectral are selected respectively Ordinate is arranged to Fam fluorescence signal value, abscissa is arranged to Vic and is arranged to signal value by compensation " button. Software can adjust three kinds of set automatically according to by negative point set, wildness point set and mutability point set fluorescence intensity The band of position；
D. it selects using " Elliptical Gate " frame and adjusts the region of accumulation point, make Positive mutants points ratio as far as possible Feminine gender points are 0.01；
E. other sample datas are selected, the wild sample data analysis method than for 0.01 will be mutated and parameter is applied to institute There is sample, obtains other sample analysis results.
When data are analyzed, data statistics figure is made according to response data, as shown in Fig. 2, the fluorescence area of selected wild type The fluorescence area (circle on right side in figure) of (two circles in left side in figure) and saltant type, the fluorescence area of wild type and mutation The ratio of fluorescence signal copy number is 1:100 in the fluorescence area of type.Using the present embodiment kit when, need first with prominent Become wild than being template into 0.01 middle frequency of mutation standard items, determines the fluorescence area of wild type and the fluorescence area of saltant type Position, the position be suitable for subsequent reactions.
Using above-mentioned the same reaction system and response procedures, template uses full wild-type template, obtains data, divided Analysis makes data statistics figure according to response data, as shown in Figure 1, the fluorescence area of wild type and the fluorescence area of saltant type with Position consistency in Fig. 2.Theoretically, the fluorescence area of saltant type should not have fluorescence signal, but in actual use, kit Even if template uses full wild-type template, certain background threshold is also had, background threshold herein is 6 copy numbers.
Using above-mentioned the same reaction system and response procedures, template uses low frequency of mutation standard items, obtains data, into Row analysis makes data statistics figure according to response data, as shown in figure 3, the phosphor region of the fluorescence area of wild type and saltant type Position consistency in domain and Fig. 2.There is the fluorescence signal of 47 copy numbers in the fluorescence area of saltant type, is greater than the background threshold 2.5 times of 6 copy numbers of value, so the sensitivity of the kit can reach a ten thousandth, specificity is preferable, signal-to-noise ratio is high.
Using above-mentioned the same reaction system and response procedures, template uses the blood of patient, obtains data, divided Analysis makes data statistics figure according to response data, the position in the fluorescence area of wild type and the fluorescence area and Fig. 2 of saltant type Unanimously, the fluorescence signal copy number in the fluorescence area of saltant type, which subtracts 6 copy numbers of background threshold and obtains final mutation, copies Shellfish number.
The above embodiment is merely an example for clearly illustrating the present invention, and is not to embodiment party of the invention The restriction of formula.For those of ordinary skill in the art, other differences can also be made on the basis of the above description The variation or variation of form.There is no necessity and possibility to exhaust all the enbodiments.And these belong to essence of the invention The obvious changes or variations that mind is extended out are still in the protection scope of this invention.
Sequence table
<110>peaceful object medical sci-tech limited liability company is matched in Shanghai
<120>EGFR gene T790M is mutated the optimization method and testing product of digital pcr detection architecture
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213>artificial sequence (nothing)
<400> 1
cctcacctcc accgtgca 18
<210> 2
<211> 23
<212> DNA
<213>artificial sequence (nothing)
<400> 2
gtctttgtgt tcccggacat agt 23
<210> 3
<211> 17
<212> DNA
<213>artificial sequence (nothing)
<400> 3
atgagctgcg tgatgag 17
<210> 4
<211> 17
<212> DNA
<213>artificial sequence (nothing)
<400> 4
atgagctgca tgatgag 17

Claims (10)

1. a kind of optimization method of EGFR gene T790M mutation digital pcr detection architecture, it is characterised in that: the detection architecture Including upstream primer, downstream primer, wild-type probe, saltant type probe, wild-type template and saltant type template；Draw the upstream The nucleotide sequence of object is as shown in SEQ ID No.1, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No.2, institute The nucleotide sequence of wild-type probe is stated as shown in SEQ ID No.3, the nucleotide sequence of the saltant type probe such as SEQ ID Shown in No.4；The wild-type template is the normal human gDNA after digestion, and the saltant type template is the insertion after digestion The mutant plasmid of EGFR gene T790M mutant fragments；
Saltant type template and wild-type template are configured to middle frequency of mutation standard items in the copy number ratio of 1:50 to 1:200, It uses digital pcr to be reacted using middle frequency of mutation standard items as template, data statistics figure is made according to response data, selectes open country The fluorescence area of raw type and the fluorescence area of saltant type, fluorescence signal in the fluorescence area of saltant type and the fluorescence area of wild type Saltant type template and the copy number ratio of wild-type template are identical in the ratio of copy number and middle frequency of mutation standard items；
Digital pcr is used to be reacted by template of wild-type template, the fluorescence signal occurred in the fluorescence area of saltant type is copied Shellfish number is the background threshold of the detection architecture.
2. the optimization method of EGFR gene T790M mutation digital pcr detection architecture according to claim 1, feature exist In: saltant type template and wild-type template are configured to high frequency of mutation standard items in the copy number ratio of 1:1 to 1:10, used Real-time fluorescence quantitative PCR is reacted using low frequency of mutation standard items as template, according to reaction end fluorescent value and initial fluorescence Value uses the relationship of concentration with probe, optimizes the use concentration of wild-type probe and saltant type probe.
3. the optimization method of EGFR gene T790M mutation digital pcr detection architecture according to claim 2, feature exist In: the reaction end fluorescent value and initial fluorescence value and probe using the relationship of concentration be reaction end fluorescent value with it is initial glimmering The ratio of light value is bigger, and reaction end fluorescent value and the difference of initial fluorescence value are bigger, then wild-type probe and saltant type are visited The use concentration of needle is better.
4. the optimization method of EGFR gene T790M mutation digital pcr detection architecture according to claim 1, feature exist In: saltant type template and wild-type template are configured to low frequency of mutation standard in the copy number ratio of 1:1000 to 1:10000 Product use digital pcr to be reacted using low frequency of mutation standard items as template, if the fluorescence occurred in the fluorescence area of saltant type Signal copy number is greater than 2.5 times of the background threshold, then the sensitivity of the detection architecture reaches low frequency of mutation standard items The identical value of copy number ratio.
5. the optimization method of EGFR gene T790M mutation digital pcr detection architecture according to claim 1, feature exist It is MGB probe in: the wild-type probe and saltant type probe, 3 ' ends of the wild-type probe and saltant type probe are NFQ group.
6. the optimization method of EGFR gene T790M mutation digital pcr detection architecture according to claim 1, feature exist In: 5 ' ends of the wild-type probe are VIC group, and 5 ' ends of the saltant type probe are FAM group.
7. the EGFR gene T790M mutation digital pcr detection after a kind of optimization using optimization method as described in claim 1 produces Product.
8. EGFR gene T790M according to claim 7 is mutated digital pcr testing product, it is characterised in that: the upstream The final concentration of 900nM of primer and downstream primer in the reaction system, the wild-type probe and saltant type probe are in reactant Final concentration of 200nM in system.
9. EGFR gene T790M according to claim 8 is mutated digital pcr testing product, it is characterised in that: described wild Type probe and saltant type probe are MGB probes, and 3 ' ends of the wild-type probe and saltant type probe are NFQ group.
10. EGFR gene T790M according to claim 8 is mutated digital pcr testing product, it is characterised in that: the open country 5 ' ends of raw type probe are VIC group, and 5 ' ends of the saltant type probe are FAM group.
CN201811191489.XA 2018-10-12 2018-10-12 The optimization method and testing product of EGFR gene T790M mutation digital pcr detection architecture Pending CN109295227A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811191489.XA CN109295227A (en) 2018-10-12 2018-10-12 The optimization method and testing product of EGFR gene T790M mutation digital pcr detection architecture

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811191489.XA CN109295227A (en) 2018-10-12 2018-10-12 The optimization method and testing product of EGFR gene T790M mutation digital pcr detection architecture

Publications (1)

Publication Number Publication Date
CN109295227A true CN109295227A (en) 2019-02-01

Family

ID=65162492

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811191489.XA Pending CN109295227A (en) 2018-10-12 2018-10-12 The optimization method and testing product of EGFR gene T790M mutation digital pcr detection architecture

Country Status (1)

Country Link
CN (1) CN109295227A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114277142A (en) * 2021-12-28 2022-04-05 普瑞斯新(上海)生物医疗科技有限公司 EGFR gene mutation multiplex detection primer probe and kit thereof

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114277142A (en) * 2021-12-28 2022-04-05 普瑞斯新(上海)生物医疗科技有限公司 EGFR gene mutation multiplex detection primer probe and kit thereof
CN114277142B (en) * 2021-12-28 2024-03-29 普瑞斯新(上海)生物医疗科技有限公司 EGFR gene mutation multiplex detection primer probe and kit thereof

Similar Documents

Publication Publication Date Title
Avissar et al. MicroRNA expression ratio is predictive of head and neck squamous cell carcinoma
Schoppmann et al. Novel clinically relevant genes in gastrointestinal stromal tumors identified by exome sequencing
KR101504817B1 (en) Novel system for predicting prognosis of locally advanced gastric cancer
Koi et al. Predicting the presence of breast cancer using circulating small RNAs, including those in the extracellular vesicles
CN108949990A (en) A kind of kit and method detecting EGFR genetic mutation
CN105463111B (en) For detecting probe, primer and the kit of 5 kinds of mankind PIK3CA gene mutation
Elfving et al. Evaluation of NTRK immunohistochemistry as a screening method for NTRK gene fusion detection in non-small cell lung cancer
CN109295226A (en) The optimization method and testing product of BRAF gene V600E mutation digital pcr detection architecture
CN105671187B (en) Group of genes for molecular typing of head and neck squamous cell carcinoma and application thereof
CN105441577B (en) For detecting probe, primer and the kit of 7 kinds of mankind CKIT gene mutation
Li et al. Evaluation of a fully automated Idylla test system for microsatellite instability in colorectal cancer
CN109295224A (en) The optimization method and testing product of PIK3CA gene H1047R mutation digital pcr detection architecture
Stewart et al. Standardising RNA profiling based biomarker application in cancer—the need for robust control of technical variables
Hesterberg et al. A distinct repertoire of cancer‐associated fibroblasts is enriched in cribriform prostate cancer
Dwivedi et al. Application of single-cell omics in breast cancer
CN109295225A (en) The optimization method and testing product of EGFR gene L858R mutation digital pcr detection architecture
CN109295223A (en) The optimization method and testing product of EGFR gene E19del mutation digital pcr detection architecture
CN109971832A (en) It is a kind of to detect the kit of gene mutation, method and application thereof
CN110004229A (en) Application of the polygenes as EGFR monoclonal antibody class Drug-resistant marker
CN109295227A (en) The optimization method and testing product of EGFR gene T790M mutation digital pcr detection architecture
CN109321569B (en) Primer probe composition and application thereof
CN102453765B (en) Probe, primer and kit for detecting drive mutation of PIK3CA (Phosphatidylinositol-3-kinases) gene
CN109266741B (en) Kit for identifying bladder cancer stem cells and application thereof
Piccaluga et al. IFI16 reduced expression is correlated with unfavorable outcome in chronic lymphocytic leukemia
CN109385476A (en) A kind of PCR kit and its detection method of detection EGFR gene T790M mutation

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20190201