CN109293761A - A kind of expression and purification method of the novel cell reprogramming factor - Google Patents

A kind of expression and purification method of the novel cell reprogramming factor Download PDF

Info

Publication number
CN109293761A
CN109293761A CN201811120709.XA CN201811120709A CN109293761A CN 109293761 A CN109293761 A CN 109293761A CN 201811120709 A CN201811120709 A CN 201811120709A CN 109293761 A CN109293761 A CN 109293761A
Authority
CN
China
Prior art keywords
oct4
expression
cell
protein
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201811120709.XA
Other languages
Chinese (zh)
Inventor
庞实锋
林灼锋
庞锦锋
曹定国
梁朋
丁银润
张国平
何滔
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangdong Medical University
Original Assignee
Guangdong Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangdong Medical University filed Critical Guangdong Medical University
Priority to CN201811120709.XA priority Critical patent/CN109293761A/en
Publication of CN109293761A publication Critical patent/CN109293761A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)

Abstract

A kind of expression and purification method of the novel cell reprogramming factor of present disclosure, the present invention introduce small molecule ubiquitin sample modification albumen (SUMO) and cell-penetrating peptide (TAT) in mouse Oct4 gene 5 ' end using technique for gene engineering.It is purified by external amalgamation and expression and digestion, acquisition largely has the TAT-Oct4 albumen for wearing film activity, to realize that using reprogramming factor protein inducing somatic reprogramming be iPS cell, and lays the foundation for final acquisition for generating the precursor of blood platelet；Albumen or nucleotide sequence of the invention, which can be used for inducing, generates iPS cell.

Description

A kind of expression and purification method of the novel cell reprogramming factor
Technical field
The invention belongs to biomedicine fields, and in particular to a kind of expression and purification side of the novel cell reprogramming factor Method.
Background of invention
The main reprogramming transcription factor for being used to induce multi-potent stem cell (iPS) at present is Oct4, Sox2, Klf4, c-Myc Four factors.These transcription factors can close the function of oneself tissue-specific cells, while the spy of successful activation multipotential cell Sign.Research OSKM and chromatinic interaction are carried out in embryonic stem cell (ESC), discovery Oct4, Sox2 and Klf4 is preferential In conjunction with enhancer, c-Myc is mainly in conjunction with promoter.
Transcription factor Oct4, also referred to as OCT3, OCT3/4, OTF3 and OTF4 are encoded by Pou5F1 gene and are generated, its conduct The versatility and self-renewal capacity that master selector maintains embryo dry.Oct4 albumen is positioned on No. 17 chromosome, coding 352 A amino acid, protein molecular weight are about 40kDa.The expression of Oct4 controlling gene is being divided with maintaining stem cell undifferentiated state Stem cell can be made to break up by the expression of RNA AF panel Oct4 during changing.When Oct4 is as activator, play induction and Maintain the function of versatility；When Oct4 is converted into strong activator, versatility is more effectively supported；When Oct4 is converted into repressor When, induction differentiation.Marikawa etc. has studied effect of the Oct4 in mouse P19 embryonal carcinoma (EC) cell, and Oct4 is supported by 2 kinds The effect that disappears maintains the versatility of P19EC cell: another one is the Wnt/ beta-catenin signal transduction for inhibiting mesoderm induction Kind is to provide the ability of Brachyury gene response Wnt/ beta-catenin white signal.Result of study confirms that Oct4 is in reprogramming The required factor, and single Oct4 is enough directly to reprogram neural stem cell for versatility.After neural stem cell, Wu It is enough the reprogramming of the cytotrophoblast stem cells in trophectoderm source Deng a transcription factor Oct4 is used only for being divided into The pluripotent stem cell of triploblastica ability.Past is thought always, once Oct4 protein level reduces, will make newborn stem cell Quantity decline therewith.The discovery of British scientist current research, Oct4 controls the gene expression of embry ogenesis early stage, in Qi Shui Embryonic stem cell can be induced when flat decline and carries out self-renewing, so that stem cell population be made to be maintained at an equilibrium state.
Small molecule ubiquitin sample modification albumen (small ubiquitin-like modifier, SUMO) is a kind of and ubiquitin The quite similar micromolecule polypeptide in structure is made of about 100 amino acid residues, is widely present in eucaryote. SUMO is highly conserved during spore, full length gene 318bp, molecular weight of albumen size about 12kDa.
SUMO mainly adjusts the structure and function of target protein by way of covalent modification.SUMO is not live at first Property precursor forms exist, under the hydrolysis of certain specific protease, several amino acid of the end C- are removed, exposure The Gly-Gly residue at the end C- out, thus become with modification, transhipment etc. functions mature SUMO, then on target protein rely The combination of propylhomoserin epsilon-amino forms isopeptide bond and plays a role, this process is SUMOization.SUMO is a kind of dynamic to the modification of protein Reversible process.SUMO can be cut off SUMO by cutting isopeptide bond, this process is to go with after protein binding from target protein SUMOization.In cell, the quantity of SUMO is often limited, therefore more SUMO are also provided while Go to SUMOization To modify other substrate proteins.
SUMO has been found to can be used as label and molecular chaperones are applied in the amalgamation and expression of recombinant protein, and has and increase Strong protein expression reduces the degradation of target protein, increases protein folding and solubility and simplifies the advantage of purifying and detection. Therefore, it is beneficial to obtain the recombinant protein of high efficient expression present invention introduces SUMO.
Cell-penetrating peptide (cell-penetrating peptides, CPPs) is that one kind can carry multiple biological activities object Matter rapidly enters the small molecule small peptide of cell, and length is usually no more than 30 amino acid and rich in basic amino acid.Because it wears film Ability does not depend on classical encytosis and enters cell directly through cell membrane, so frequently as the good carrier of targeted drug. Can be divided mainly into two major classes according to its source, one kind be it is naturally occurring, such as from the anti-of human immunodeficiency virus HIV-1 Formula activating transcription factor TAT (trans-activator of transcription, TAT), drosophila homeotic ANTP and The VP22 of herpes simplex virus HSV-1；It is another kind of to be artificial synthesized, such as poly arginine and poly-D-lysine, or to day Made of right cell-penetrating peptide is modified, such as MPG, pep-1.
TAT is the cell-penetrating peptide for being found and being most widely used at present earliest.TAT protein is by 86~102 amino Acid composition, wherein it is kept to have, to wear the segment of film activity only include 11 amino acid, and the amino acid positioned at the 47th~57 is residual Base, sequence YGRKKRRQRRR, removing any one arginine all can make it wear film activity reduction.Studies have shown that utilizing The transduction rate of TAT mediating protein transduced mammalian cells is up to 100%, and the transcription effect is reversible, not unfavorable It influences.Therefore, present invention introduces cell-penetrating peptide TAT, and TAT and transcription factor are carried out amalgamation and expression, utilize cell-penetrating peptide Can carry that exogenous large biological molecule substance enters cell wears film activity, to efficiently bring transcription factor into intracellular hair It waves function and obtains iPS cell.
Its bioactivity is given full play in order to make to enter intracytoplasmic OCT4, NT4 signal peptide is inserted between OCT4 and TAT Sequence, so that thering is endopeptidase to crack point in signal peptide NT4 after TAT mediates OCT4 to enter into the cell, having dissection again, can make Destination protein can be cracked by endopeptidase and is separated to inside cytoplasm, so that OCT4 be made to release from fusion protein, be played Its original bioactivity.
Summary of the invention
Present invention aims at find protein of a kind of pair of cell with reprogramming ability.
The object of the invention is also to provide a kind of nucleotides sequences of amino acid sequence containing coding present protein The DNA of column or carrier or plasmid containing the DNA.
It is yet a further object of the present invention to provide the purposes of present protein, including pharmaceutical applications and treat disease Purposes.
Tetra- factor prokaryotic expression system of OSKM of the carrying cell-penetrating peptide of the proposed vertical energy high efficient expression SUMO fusion of the present invention System.Using Escherichia coli Rossate (DE3) high efficient expression Su-TN-Oct4 fusion protein, make it under the amalgamation and expression of SUMO To increase the expression quantity and solubility of destination protein, and to improve the bioactivity of transcription factor；Simultaneously by introducing TAT To promote the membrane efficiency of wearing of four factors, and it joined signal between TAT and OCT4 to give full play to the function of OCT4 Peptide NT4 sequence, so that fusion protein cuts off NT4 after entering cell, so that the OCT4 with natural amino acid end is generated, from And improve the effect of induction iPS cell.Intend taking a firm foundation using transcription factor protein progress reprogramming of somatic cells for the later period, Then by the precursor of iPS cell induced synthesis blood platelet, to meet the needs of clinic is to blood platelet.Its nucleotide coding Sequence is shown in the SEQ ID NO.:1 (hereinafter referred " sequence 1 ") in sequence table, and amino acid sequence is shown in the SEQ ID in sequence table NO.:2 (hereinafter referred " sequence 2 ").
The present invention also provides the derivatives of the OCT4 protein, and reprogramming effect can be carried out to cell by having including those Albumen, amino acid sequence are conservative substitution form, increase or the missing of the mutant of amino acid sequence shown in sequence 2, sequence 2 Some or all of the form of one or several amino acid, the form of aminoterminal truncation, the form of c-terminus truncation, sequence 2 string Connection repeats form and the fusion protein form with other protein and cell factor.
Amino acid trigram or single-letter expression way used in the application text, using amino acid as defined in IUPAC Code (Eur.J.Biochem., 138:9-37,1984).
Specifically, designing primer OCT-F and OCT- corresponding with its both ends according to the cDNA coded sequence of OCT4 first R, and suitable restriction enzyme site is added in primer respectively.Using human body total DNA as template, expands and isolate 1059bp's CDNA is named as OCT4, encodes 352 amino acid.Insert Fragment is subjected to nucleotide sequencing, then amino acid encoding point Analysis, as a result respectively as shown in sequence 1 and 2.Then, Sumo gene, TAT sequence, NT4 are cloned into pET- with bridging round pcr In 3C, pET-HisSu-TN is obtained, by OCT4 gene by KpnI and BglII double digestion rear clone into bis- through KpnI and BamHI PET-HisSu-TN-Oct4 is obtained in the carrier pET-HisSu-TN of digestion, and this expression vector is converted into Escherichia coli Rossate (DE3) obtains the E. coli transformant containing the plasmid vector, after inducing expression, the fusion protein His- of expression The N-terminal fusion of Su-TN-Oct4 has 6 continuous histidines.Utilize the Co for having affinity interaction with histidine2+Affinity chromatogra Column purifies HisSu-TN-Oct4.Then by the fusion protein HisSu-TN-Oct4 of purifying Sumo protease (invitrogen Company) digestion is carried out, digestion products go up Co again2+Affinity chromatogra column, because with histidine tail Sumo albumen and Sumo protease all with Co2+Ligand is affine to be adsorbed on affinity column, collects loading peak and N-terminal can be obtained without group in washing peak The Oct4 albumen with cell-penetrating peptide sequence TAT and NT4 sequence of histidine tail, i.e. TN-Oct4 albumen, TN-Oct4 after purification Purity of protein reaches 95% or more.
Of the invention can easily prepare containing TN-Oct4 fusion protein.It can be using in pharmaceutical field Protein of the invention is configured to pharmaceutical composition by routine techniques and equipment.For example, can be by proteolytic of the invention In sterile saline, phosphate buffer, albumin solution, it is configured to the solution of 1 μ g-100 μ g/ml.
Heretofore described carrier, host strain etc. can be obtained by commercial sources, as pET-3C and Rossate (DE3) are purchased from Novagen company, Co needed for purifying HisSu-TN-Oct42+Affinity chromatogra column TALON Metal Affinity Resin is purchased from Clontech company of the U.S..
Below by way of drawings and examples, the invention will be further described.The present invention is not by following specific texts and picture The limitation of description, the present invention can do various changes in the range of claim is summarized, these change in model of the invention Within enclosing.
Detailed description of the invention
Fig. 1 shows expression vector pET-3C map.
The building signal of the pET-HisSu-TN-Oct4 expression vector of HisSu-TN-Oct4 of the present invention is expressed in Fig. 2 display Figure.
The inducing expression figure of Fig. 3 HisSu-TN-Oct4 recombinant protein shows fusion protein HisSu-TN-Oct4SDS- PAGE electrophoresis detection figure.Protein sample is shown through 10%SDS-PAGE electrophoresis, gel coomassie brilliant blue staining, arrow HisSu-TN-Oct4, about 60kDa.1 Protein Marker of swimming lane；The pET-HisSu-TN- that swimming lane 2 is induced without IPTG Oct4 Bacillus coli cells lysate；The Bacillus coli cells lysate that swimming lane 3-5 is induced through IPTG.
SDS-PAGE analysis chart of Fig. 4 HisSu-TN-Oct4 fusion protein after SUMO protease digestion before purification, figure HisSu-TN-Oct4 is about 60kDa before middle display is cut, TN-Oct4 molecular weight about 40kDa after cutting, 1 molecular weight of albumen of swimming lane Standard；Swimming lane 2 is through Co2+The HisSu-TN-Oct4 of affinity chromatogra column purification；The TN-Oct4, about 40kDa that swimming lane 3 purifies.
Fig. 5 Western blot identifies the immunogenicity of Oct4, and 1 is HisSu-TN-Oct4 fusion protein, and 2 be HisSu- TN-Oct4 cuts TN-Oct4 albumen after purification through SUMO protease.
Specific embodiment
The following example is merely to illustrate and should not be taken as limiting the scope of the invention, and actual conditions are not specified in embodiment Person, routinely or the condition of manufacturer's suggestion carries out.
The building of 1 pET-HisSu-TN-Oct4 fusion protein expression vector of embodiment
It is of the invention using expression vector pET-3c (being purchased from U.S. Novagen company) clonal expression as shown in Figure 1 HisSu-TN-Oct4 fusion protein.
PET-3c carrier has multiple cloning sites.According to the restriction enzyme site of pET-3c carrier, Oct4 Protein cDNA Sequence, design Following primer:
OctF:GCGGTACCGCTGGACACCTGGCTTCAG(SEQ ID NO.3)；(lower stroke of the restriction enzyme site of I containing Kpn Line).
OctR:GAAGATCTTCAGTTTGAATGCATGGGAGAGCCC (SEQ ID NO.4), the restriction enzyme site of II containing Bgl (underscore).
Using TetO-FUW-OSKM plasmid as template amplification Oct4cDNA.PCR reaction condition are as follows: 1 × PCR reaction buffer, 0.5 μM of Oct-F, 0.5 μM of Oct-R, 1 μ g TetO-FUW-OSKM plasmid, 2U archaeal dna polymerase (Fermentas company), 50 μ M dATP, 50 μM of dTTP, 50 μM of dCTP, 50 μM of dGTP, 1.5mM MgCl2, with sterile water tune reaction volume to 50 μ l.PCR Amplified reaction program are as follows:
The pcr amplification product of 1% agarose electrophoresis separation and purifying molecule amount about 1Kb, product are named as Oct4.
After the amplified production Oct4 of above-mentioned purifying Kpn I and Bgl II digestion double digestion, connected with T4DNA ligase To also through obtaining recombinant dna plasmid pET-HisSu-TN- on the pET-HisSu-TN carrier through Kpn I and BamH I digestion Oct4 expression vector, building process are shown in Fig. 2.
Nucleotides sequence is classified as SEQ ID NO.1, and amino acid sequence is SEQ ID NO.2.
The expression and purification of 2 pET-HisSu-TN-Oct4 expression vector of embodiment
As above the recombinant dna plasmid pET-HisSu-TN-Oct4 obtained conversion Escherichia coli Rossate (DE3) (is purchased from Novagen company of the U.S.).The transformant of Escherichia coli Rossate (DE3) containing pET-HisSu-TN-Oct4 is inoculated in and is contained In LB culture solution of the 50 μ g/ml containing ampicillin and chloramphenicol, 37 DEG C of overnight incubations.With 1% inoculum concentration, it is seeded to LB liquid Culture medium (containing containing ampicillin and chloramphenicol), 37 DEG C of shaking table cultures to OD600It is 0.5~0.6.Add people in culture solution Isopropyl-β-D-thiogalactoside (abbreviation IPTG) is to final concentration of 0.5mM, and 30 DEG C induce 4 hours, and thalline were collected by centrifugation. Thallus is resuspended with 50mM sodium phosphate buffer (NaCl containing 300mM, 1mM phenylmethylsulfonyl fluoride (abbreviation PMSF), pH 7.4).It is super Sonication cell wall, 10,000g centrifugations 30 minutes, discards cell fragment, obtains HisSu-TN-Oct4 crude extract, use TALON Metal affinity Column (Clontech company) purifies HisSu-TN-Oct4, operation by producer specification into Row, obtains solvable HisSu-TN-Oct4 fusion protein (about 60kDa is shown in Fig. 3)；Then by the fusion protein HisSu-TN- of purifying Oct4 carries out digestion with Sumo protease (invitrogen company), and digestion products go up Co again2+Affinity chromatogra column, because of tool Have histidine tail Sumo albumen and Sumo protease all with Co2+Ligand is affine to be adsorbed on affinity column, and loading is collected N-terminal can be obtained without Oct4 albumen histidine tail and with TAT sequence and NT4 sequence, i.e. TN-Oct4 in peak and washing peak Albumen, through 10%SDS-PAGE electrophoresis detection, TN-Oct4 purity is shown in Fig. 4 up to 95% or more；It detects, obtains through Western blot The TN-Oct4 albumen obtained has epidemic focus, sees Fig. 5.
The present invention is not specifically limited text, and the present invention can be done in the range of claims are summarized Various changes.These changes are all within the scope of the present invention.
SEQUENCE LISTING
<110>Guangdong medical university
<120>a kind of expression and purification method of the novel cell reprogramming factor
<130>
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 1059
<212> DNA
<213>artificial sequence
<400> 1
atggctggac acctggcttc agacttcgcc ttctcacccc caccaggtgg gggtgatggg 60
tcagcagggc tggagccggg ctgggtggat cctcgaacct ggctaagctt ccaagggcct 120
ccaggtgggc ctggaatcgg accaggctca gaggtattgg ggatctcccc atgtccgccc 180
gcatacgagt tctgcggagg gatggcatac tgtggacctc aggttggact gggcctagtc 240
ccccaagttg gcgtggagac tttgcagcct gagggccagg caggagcacg agtggaaagc 300
aactcagagg gaacctcctc tgagccctgt gccgaccgcc ccaatgccgt gaagttggag 360
aaggtggaac caactcccga ggagtcccag gacatgaaag ccctgcagaa ggagctagaa 420
cagtttgcca agctgctgaa gcagaagagg atcaccttgg ggtacaccca ggccgacgtg 480
gggctcaccc tgggcgttct ctttggaaag gtgttcagcc agaccaccat ctgtcgcttc 540
gaggccttgc agctcagcct taagaacatg tgtaagctgc ggcccctgct ggagaagtgg 600
gtggaggaag ccgacaacaa tgagaacctt caggagatat gcaaatcgga gaccctggtg 660
caggcccgga agagaaagcg aactagcatt gagaaccgtg tgaggtggag tctggagacc 720
atgtttctga agtgcccgaa gccctcccta cagcagatca ctcacatcgc caatcagctt 780
gggctagaga aggatgtggt tcgagtatgg ttctgtaacc ggcgccagaa gggcaaaaga 840
tcaagtattg agtattccca acgagaagag tatgaggcta cagggacacc tttcccaggg 900
ggggctgtat cctttcctct gcccccaggt ccccactttg gcaccccagg ctatggaagc 960
ccccacttca ccacactcta ctcagtccct tttcctgagg gcgaggcctt tccctctgtt 1020
cccgtcactg ctctgggctc tcccatgcat tcaaactga 1059
<210> 2
<211> 352
<212> PRT
<213>artificial sequence
<400> 2
Met Ala Gly His Leu Ala Ser Asp Phe Ala Phe Ser Pro Pro Pro Gly
1 5 10 15
Gly Gly Asp Gly Ser Ala Gly Leu Glu Pro Gly Trp Val Asp Pro Arg
20 25 30
Thr Trp Leu Ser Phe Gln Gly Pro Pro Gly Gly Pro Gly Ile Gly Pro
35 40 45
Gly Ser Glu Val Leu Gly Ile Ser Pro Cys Pro Pro Ala Tyr Glu Phe
50 55 60
Cys Gly Gly Met Ala Tyr Cys Gly Pro Gln Val Gly Leu Gly Leu Val
65 70 75 80
Pro Gln Val Gly Val Glu Thr Leu Gln Pro Glu Gly Gln Ala Gly Ala
85 90 95
Arg Val Glu Ser Asn Ser Glu Gly Thr Ser Ser Glu Pro Cys Ala Asp
100 105 110
Arg Pro Asn Ala Val Lys Leu Glu Lys Val Glu Pro Thr Pro Glu Glu
115 120 125
Ser Gln Asp Met Lys Ala Leu Gln Lys Glu Leu Glu Gln Phe Ala Lys
130 135 140
Leu Leu Lys Gln Lys Arg Ile Thr Leu Gly Tyr Thr Gln Ala Asp Val
145 150 155 160
Gly Leu Thr Leu Gly Val Leu Phe Gly Lys Val Phe Ser Gln Thr Thr
165 170 175
Ile Cys Arg Phe Glu Ala Leu Gln Leu Ser Leu Lys Asn Met Cys Lys
180 185 190
Leu Arg Pro Leu Leu Glu Lys Trp Val Glu Glu Ala Asp Asn Asn Glu
195 200 205
Asn Leu Gln Glu Ile Cys Lys Ser Glu Thr Leu Val Gln Ala Arg Lys
210 215 220
Arg Lys Arg Thr Ser Ile Glu Asn Arg Val Arg Trp Ser Leu Glu Thr
225 230 235 240
Met Phe Leu Lys Cys Pro Lys Pro Ser Leu Gln Gln Ile Thr His Ile
245 250 255
Ala Asn Gln Leu Gly Leu Glu Lys Asp Val Val Arg Val Trp Phe Cys
260 265 270
Asn Arg Arg Gln Lys Gly Lys Arg Ser Ser Ile Glu Tyr Ser Gln Arg
275 280 285
Glu Glu Tyr Glu Ala Thr Gly Thr Pro Phe Pro Gly Gly Ala Val Ser
290 295 300
Phe Pro Leu Pro Pro Gly Pro His Phe Gly Thr Pro Gly Tyr Gly Ser
305 310 315 320
Pro His Phe Thr Thr Leu Tyr Ser Val Pro Phe Pro Glu Gly Glu Ala
325 330 335
Phe Pro Ser Val Pro Val Thr Ala Leu Gly Ser Pro Met His Ser Asn
340 345 350
<210> 3
<211> 27
<212> DNA
<213>artificial primer
<400> 3
gcggtaccgc tggacacctg gcttcag 27
<210> 4
<211> 33
<212> DNA
<213>artificial primer
<400> 4
gaagatcttc agtttgaatg catgggagag ccc 33

Claims (7)

1. a kind of isolated source of people protein, which is characterized in that have 352 amino acid, amino acid sequence such as sequence table SEQ Shown in ID NO.2.
2. isolated source of people protein according to claim 1, it is characterised in that before its aminoterminal have TAT sequence and NT4 sequence.
3. isolated source of people protein according to claim 1, which is characterized in that the amino acid sequence is by following core Nucleotide sequence coding:
ATGGCTGGACACCTGGCTTCAGACTTCGCCTTCTCACCCCCACCAGGTGGGGGTGATGGGTCAGCAGGGCTG GAGCCGGGCTGGGTGGATCCTCGAACCTGGCTAAGCTTCCAAGGGCCTCCAGGTGGGCCTGGAATCGGACCAGGCT CAGAGGTATTGGGGATCTCCCCATGTCCGCCCGCATACGAGTTCTGCGGAGGGATGGCATACTGTGGACCTCAGGT TGGACTGGGCCTAGTCCCCCAAGTTGGCGTGGAGACTTTGCAGCCTGAGGGCCAGGCAGGAGCACGAGTGGAAAGC AACTCAGAGGGAACCTCCTCTGAGCCCTGTGCCGACCGCCCCAATGCCGTGAAGTTGGAGAAGGTGGAACCAACTC CCGAGGAGTCCCAGGACATGAAAGCCCTGCAGAAGGAGCTAGAACAGTTTGCCAAGCTGCTGAAGCAGAAGAGGAT CACCTTGGGGTACACCCAGGCCGACGTGGGGCTCACCCTGGGCGTTCTCTTTGGAAAGGTGTTCAGCCAGACCACC ATCTGTCGCTTCGAGGCCTTGCAGCTCAGCCTTAAGAACATGTGTAAGCTGCGGCCCCTGCTGGAGAAGTGGGTGG AGGAAGCCGACAACAATGAGAACCTTCAGGAGATATGCAAATCGGAGACCCTGGTGCAGGCCCGGAAGAGAAAGCG AACTAGCATTGAGAACCGTGTGAGGTGGAGTCTGGAGACCATGTTTCTGAAGTGCCCGAAGCCCTCCCTACAGCAG ATCACTCACATCGCCAATCAGCTTGGGCTAGAGAAGGATGTGGTTCGAGTATGGTTCTGTAACCGGCGCCAGAAGG GCAAAAGATCAAGTATTGAGTATTCCCAACGAGAAGAGTATGAGGCTACAGGGACACCTTTCCCAGGGGGGGCTGT ATCCTTTCCTCTGCCCCCAGGTCCCCACTTTGGCACCCCAGGCTATGGAAGCCCCCACTTCACCACACTCTACTCA GTCCCTTTTCCTGAGGGCGAGGCCTTTCCCTCTGTTCCCGTCACTGCTCTGGGCTCTCCCATGCATTCAAACTGA (SEQ ID NO.1)。
4. a kind of plasmid, it is characterised in that the nucleosides comprising any one of the coding claim 1-3 protein amino acid sequence The DNA of acid sequence.
5. plasmid according to claim 4, which is characterized in that the expression vector pET-HisSu-TN-Otc4 of plasmid.
6. plasmid according to claim 4, which is characterized in that the albumen of plasmid expression can be solution, dry powder, emulsion etc..
7. a kind of pharmaceutical composition, contains: the described in any item protein of claim 1-3 or its have cell is rearranged The derivative of Cheng Gongneng.
CN201811120709.XA 2018-09-26 2018-09-26 A kind of expression and purification method of the novel cell reprogramming factor Pending CN109293761A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811120709.XA CN109293761A (en) 2018-09-26 2018-09-26 A kind of expression and purification method of the novel cell reprogramming factor

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811120709.XA CN109293761A (en) 2018-09-26 2018-09-26 A kind of expression and purification method of the novel cell reprogramming factor

Publications (1)

Publication Number Publication Date
CN109293761A true CN109293761A (en) 2019-02-01

Family

ID=65164098

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811120709.XA Pending CN109293761A (en) 2018-09-26 2018-09-26 A kind of expression and purification method of the novel cell reprogramming factor

Country Status (1)

Country Link
CN (1) CN109293761A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114206946A (en) * 2020-06-10 2022-03-18 四川三叶草生物制药有限公司 Coronavirus vaccine compositions, methods and uses thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101993495A (en) * 2009-08-12 2011-03-30 上海近岸科技有限公司 Protein mixture and preparation method thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101993495A (en) * 2009-08-12 2011-03-30 上海近岸科技有限公司 Protein mixture and preparation method thereof

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BERNARDO AS等: "POU domain, class 5, transcription factor 1 isoform 1 [Mus musculus]", 《NCBI》 *
GUO-DAN等: "Soluble expression of recombinant cMyc, Klf4, Oct4, and Sox2 proteins in bacteria and transduction into living cells", 《INTERNATIONAL JOURNAL OF OPHTHALMOLOGY》 *
LI X等: "Generation of pluripotent stem cells via protein transduction", 《INTERNATIONAL JOURNAL OF DEVELOPMENTAL BIOLOGY》 *
MA, JIE等: "Expression, purification and characterization of a recombinant Tat47-57-Oct4 fusion protein in Pichia pastoris", 《MOLECULAR MEDICINE REPORTS》 *
王俊红等: "神经营养素4前导序列介导 Exendin-4 表达质粒的构建及鉴定", 《神经药理学报》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114206946A (en) * 2020-06-10 2022-03-18 四川三叶草生物制药有限公司 Coronavirus vaccine compositions, methods and uses thereof
CN114206946B (en) * 2020-06-10 2024-04-19 四川三叶草生物制药有限公司 Coronavirus vaccine compositions, methods and uses thereof

Similar Documents

Publication Publication Date Title
Li et al. Cloning, expression, isotope labeling, and purification of human antimicrobial peptide LL-37 in Escherichia coli for NMR studies
EP3431497B1 (en) Split inteins, conjugates and uses thereof
JP4478714B2 (en) Mussel adhesion protein
US8481492B2 (en) Fusion protein and use thereof
CN103476928B (en) For obtaining the method based on MGMT of high yield expression of recombinant proteins
EP2132225A1 (en) Combined use of cell permeable nanog and oct4 for increasing self-renewal and suppressing differentiation of stem cells
EP1302544B1 (en) Medium additives and media for culturing animal cells
RU2401307C1 (en) RECOMBINANT PLASMID DNA pFK2 PROVIDING SYNTHESIS OF RECOMBINANT PEPTIDE BEING HUMAN KAPPA CASEIN FRAGMENT ANALOGUE, METHOD FOR PREPARING RECOMBINANT PEPTIDE, AND RECOMBINANT PEPTIDE, HUMAN KAPPA CASEIN FRAGMENT ANALOGUE EXHIBITING APOPTOTIC ACTIVITY IN RELATION TO MALIGNANT CELLS
CN109293761A (en) A kind of expression and purification method of the novel cell reprogramming factor
TW201433572A (en) Method for manufacturing human epidermal cell growth factor
WO2018235958A1 (en) Method for purifying protein, method for producing protein solution, and method for producing protein moulded body
KR20090039239A (en) Method for over-expressing human epidermal growth factor as bioactive form in escherichia. coli
KR100843634B1 (en) Transmembrane Delivery Peptide and Bio-material Comprising the Same
JP6667432B2 (en) Gene transfer promoting factor Protransduzin B
JP7269605B2 (en) Hemagglutinin complex protein and use thereof
US20220226485A1 (en) De novo design of phosphorylation inducible protein switches (phospho-switches)
KR20130141001A (en) A novel vector system for isolation and purification of target proteins
JP4870574B2 (en) Peptide and protein processing
Xin et al. Improving the bioactivity of rHirudin with boronophenylalanine site-specific modification
RU2802488C1 (en) Protein construct based on a receptor-specific mutant variant of the antitumor cytokine trail as a hybrid protein with a peptide specific for integrin αvβ3 for the treatment of solid tumors
KR100844497B1 (en) Cell penetrating-polypeptide fusion protein its coding sequences and the recombinant vector expressing this fusion protein
Krzyzaniak et al. Specific induction of Z-DNA conformation by a nuclear localization signal peptide of lupin glutaminyl tRNA synthetase
Zhang et al. Prokaryotic expression and characterization of human AC3-33 protein
Lee et al. Efficient cellular uptake of recombinant murine Hoxc8 homeoprotein in COS-7 cells
KR101582655B1 (en) Methionyl tRNA synthase mutants for photoactive methionine mimetics labelled protein biosynthesis

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20190201