CN1092812A

CN1092812A - Vaccine

Info

Publication number: CN1092812A
Application number: CN93109561A
Authority: CN
Inventors: M·施劳伊; P·帕拉; M·库祖科斯
Original assignee: SmithKline Beecham Biologicals SA
Current assignee: GlaxoSmithKline Biologicals SA
Priority date: 1992-06-25
Filing date: 1993-06-24
Publication date: 1994-09-28
Also published as: CA2138996A1; JPH07508648A; AU4326493A; MX9303771A; WO1994000575A1; AU1785597A; TW269635B; NZ253138A; KR950702244A; EP0649470A1; AU676166B2; GB9213559D0

Abstract

Be early stage type HSV-2 virus protein ICP27, it is discerned by the cytolysis T lymphocyte (CTL) in human body, its preparation method and the application in vaccine thereof.

Description

Vaccine

The present invention relates to treat and vaccine, employed novel antigens, their preparation method and the use in human medicine thereof in these vaccines.Specifically, the present invention relates to from the herpes simplex (Herpes Simplex) of can the irritation cell toxic T lymphocyte replying (HSV) resulting antigen.

HSV can cause lifelong infection and recurrence disease in human body.Two kinds of closely-related HSV serotypes are arranged, and they are respectively known HSV-1 and HSV-2.In initial the infection, after skin or the repetition of mucous membrane place, this virus moves to dorsal root ganglion and enters a latent period usually., bring back to life again after suitable stimulation, mucous membrane and skin place that the result arranges at this neuroganglion produce blister and ulcer thereupon.When preventing initial stage infection and disease with neutralizing antibody, their existence is to the process or the not effect of recurrent number of recurrent herpes disease.The immunne response, particularly delayed type hypersensitivity (DTH) or cytolysis (CTL) the effector type that have the T cell to get involved also have been used in the protection of muroid animal sample to the initial stage disease.And that the impaired individuality of some T cell function experiences possibly is serious, be the bleb disease that is in peril of one's life sometimes.Has vital role aspect the infection of these observation explanation effector T cell function simplexviruss in the control human body.

People have proposed the main surface glycoprotein with hsv, and gD and gC are used for vaccine (EP 139417 Genentech).These materials mainly are to stimulate neutralizing antibody to reply.

Owing to the mechanism of carrying out antigen recognition by CTL relates to natural antigen is cracked into peptide, this proteolysis segment bonded on the MHC molecule and with this complex compound output to this cell surface, the polypeptide of any coding virus (be not only resemble glycoprotein complete membrane protein) all can be a potential target of t cell response.Yet because several nonstructural proteins of this HSV genome encoding and inner virion protein (except outside glycoprotein), this has just caused a large amount of potential CTL targets, and wherein maximally related protein is unknown.

HSV infects and is characterised in that the free virus that has only minute quantity exists.Hiding and the resurrection phase, virus mainly is in cell.Therefore, even a large amount of neutralizing antibodies can not prevent to recur disease, relies on cellular immunization to control virus.So in order to obtain protection by the vaccine effect, people's expectation not only will be induced a kind of antibody response, but also will induce CTL.It is a kind of that vaccine is effectively arranged be as the initial CTL that can work as early as possible the resurrection signal that latent virus occurs.

Early stage research has been discerned to the constituent of various herpes simplexes glycoprotein gd for example, and the human CTL of gB replys people 1986 such as () Zarling, but also unknown for the essence effect of these CTL of virus sweep.Yet this CTL is limited HLA II class, though the expression of class is an inductive in keratinocyte during HSV repeats, it may take place too late so that can not prevent the appearance of this focus.

In order to identify the CTL target antigen of wanting at last for the purpose of the vaccine that prevents or treat, the present invention has noticed the repeat cycle of HSV.After infecting in the early stage and from the latent state reconstruction processes neural impassivity joint, HSV mainly is in cell, and it has only the exposure of minimum for neutralizing antibody.Yet, will produce the virus protein segment when beginning virus protein is synthetic in comprising virus genomic cell, this segment is by existing at the MHC of cell surface molecule, thereby makes it become the target with suitable narrow spectrum CTL.This HSV continues about 18-20 hour recurrence period, and relates to a α or be early stage type (IE) β or the expression successively of type (E) and γ or delaying type (L) gene prod in early days.So the early stage type CTL before the delaying type expression of structural gene attacks and the dissolving of the cell that is infected subsequently can stop the new virion of formation, and therefore prevents the cell that this virus diffusion is adjacent mutually.For more effective, CTL should detect the initial virus protein that occurs in this cell after infecting and reappearing.

We by analysis human HSV specific CTL be the specificity of early stage C-type virus C protein ICP27.At first we have investigated from the CTL in the blood monocyte (PBMC) around the patient of the bleb sexual organ focus with different clinical severity and have replied.We use from the lymphoblast of the infection HSV-2 of body and induce HSV-2 to dye special-shaped HLA Restricted CTL and restriction dilution culture in a large number as stimulator.Found to reply by force in the PBMC sample that a couple of days or several weeks obtained after focus takes place.The range of frequency of HSV-2 Idiotype CTL is between 1/10000 to 1/36000.

Use vaccine virus recombinant chou ICP27.VV, this gene product expression can be used for cell toxicity test in the lymphoblast target cell that is transformed by EBV.The part of inductive HSV-2 Idiotype CTL identifies the target cell of this infection recombinant chou by carrying out hormesis by the lymphoblast that infects HSV-2 at external use again.So this IE protein has constituted a kind of candidate's composition of the HSV vaccine that is used for inducing the CTL immunity

So, the present invention relates to that a kind of that discern by CTL in the human body (CTL) is early stage type HSV-2-virus protein ICP27, specifically a kind ofly have in fact as at ID Sequence No.1(protein sequence) as shown in the ICT27 of sequence.The meaning of this term " in fact " is at least 85% for homologous, is preferably 90 to 95% homologies, is to be homology 95% or more better.

Therefore, the invention provides a kind of vaccine composition, be used for the treatment of or preventive treatment HSV infects, comprising HSV-2, be early stage type protein ICP27 or its immunocompetence segment.This ICP27 protein can be used as fused protein and expresses, or on the carrier as on the hepatitis B surface antigen(HBsAg) or the form by a kind of live bacteria carrier such as Listeria monocytogenes, Shigellae, BCG or Salmonellas exist.In addition, this protein can exist with the form in a live vector such as vaccine, adenovirus or poliovirus.In addition, this protein can also be sent in a kind of HSV light granules, be disclosed in as U.S. Patent application No.91147140.0 and 9109763.4(: WO 92/13943 and PCT LB 92/00824) described in.

These expression-forms of ICP27 have formed a part of the present invention.A preferred embodiment of the present invention is a kind of vaccine recombinant, and it expresses a kind of HSV-2 ICP27 protein or its immunocompetence segment.

This is that this protein is used as medicine for the first time, so one aspect of the present invention provides the HSV-2 that is used for medicine ICP27.

ICP27 be a kind of be early stage type protein, but its effect in this virus is not understood by people as yet well, but people known it reappear for virus and be essential and relate to viral genome Transactivation effect (transactivation) [McCarthy, A..M., McMahan, L.Schaffer, P.A.(1989) .Herpes simplex virus type 1ICP27 del-etion mutants exhibit altered patterns of transcription and are DNA deficient.J.Virol.63:18-27.; Rice, S.A., Su, L, Knipe, D.M.(1989) .Herpes simplex virus alpha protein ICP27 possesses separable positive and negative regulatory actinities.J.Virol.83:3899-3407].

As the employed a kind of ICP27 immunity segment of this paper is this proteinic part, and this protein can elicit functional immunity and reply.

In animal model, we have seen and adopt the recombinant vaccine virus of expression ICP27 to inoculate after carrying out initial attack with the virus of severe toxicity, have reduced the frequency and the severity of this palindromia in fact.

The present invention provides the preparation method of ICP27 HSV-2 protein or its immune-derived thing on the other hand, wherein this method is included in and expresses the DNA of code for said proteins or derivatives thereof in the recombinant host cell and reclaim this product, and can randomly prepare its a kind of derivative thereupon.

A kind of comprise this coded sequence (as shown in the ID Sequence No.2) or its segmental dna molecular constituted of the present invention further aspect, and this molecular energy synthesizes by the DNA synthetic technology of standard, as use the enzyme combined techniques, it by people such as D.M.Roberts at Biochemistry 1985,24, describe among the 5090-5098, with chemical synthesis, with the vitro enzyme polymerization or with the combination of these technologies.About ID order 2, the coded sequence of mature protein ends at the 1536th base.

The enzymatic polymerization of DNA can carry out external, can use a kind of archaeal dna polymerase such as dna polymerase i (Klenow segment) this moment in a suitable damping fluid, described damping fluid requires to be under 10 ° of-37 ℃ of temperature, be generally 50ml volume or still less, wherein contain nucleoside triphosphate dATP, dCTP, dGTP and dTTP.The enzyme combined techniques of dna segment can use a kind of dna ligase such as T4 dna ligase to carry out, and this moment can be in the damping fluid that is fit to, for example 0.05M Tris(PH7.4), 0.01M MgCl ₂, the 0.01M dithiothreitol (DTT), the 1mM spermidine, 1mM ATP and 0.1mg/ml bovine serum albumin(BSA) are in 4 ℃ to room temperature condition, are generally 50ml volume or still less.The fused established law of DNA polymkeric substance or pulsatingization can be passed through common phosphotriester, phosphorous acid ester, or the phosphoramidate chemical method carries out, use therein solid phase technique is as ' Chemical and Enzy-matic Synthesis of Gene Fragments-A Laboratory Manual ' (H.G.Gassen and A.Lang work), Verlag Chemie, Weinheim(1982) described in, or described in other scientific publication thing, M.J.Gait for example, H.W.D.Matthes, M.Singh.B.S.Sproat, and R.C.Titmas, Nucleic Acids Research, 1982,10,6243; B.S.Sproat, and W.Bannwarth, Tetrahedron Letter, 1983,24,5771; M.D.Matteucci and M.H Caruthers, Tetrahedron Letter, 1980,20,719; M.D.Matteucci and M.H.Caruthers, Jaurnal of the American Chemical Society, 1981,103,3185; People such as S.P.Adams, Journal of the American Chemical Society, 1983,105,661; N.D.Sinha, J.Biernat, J.Mc Mannus, and Koester, Nucleic Acids Research, 1984,12,4539; And people such as H.W.D.Matthes, EMBO Journal, 1984,3,801.

In addition, this encoding sequence can derive out from HSV-2mRNA, and use known technology (as the mRNA reverse transcription being produced a kind of complementary cDNA chain) this moment, and obtain from commercially available available cDNA box.

The invention is not restricted to this special sequence of describing, it also comprises the molecule of all encode this protein or its immune-derived things as mentioned above.

The DNA polymkeric substance of protein mutant of the present invention of encoding can adopt ordinary method that this proteinic cDNA of coding is carried out site-guiding mutagenesis to prepare, this method for example is described in people such as G.Winter at Nature 1982,299, among the 756-758 or be described in Zoller and Smith 1982; Nucl.Acids Res., 10,6487-6500, or also can adopt the deletion mutagenesis method to prepare, for example by Chan and Smith at Nucl.Acids Res., 1984,12, describe among the 2407-2419, or by people such as G.Winter at Biochem.Soc.Trans., 1984,12, describe among the 224-225.

Method of the present invention can be finished by the recombinant technology of routine, and this technology for example is described in people such as Maniatis, Molecular Cloning-A Laboratory Manual; Cold Spring Harbor is among the 1982-1989.

Specifically, this method can comprise the following steps:

I) a kind of reproducible or integrating expression vector of preparation, this carrier can be expressed a kind of DNA polymkeric substance in a host cell, and this polymkeric substance comprises a kind of nucleotide sequence, this sequence encoding described HSV-2 ICP27 protein or its immune-derived thing;

II) with described carrier transformed host cell;

III) under the condition that described DNA polymkeric substance is expressed, cultivates the described host cell that has transformed, thereby obtain described protein; And

IV) reclaims described protein.

" conversion " speech meaning here is by carrying out transformation with the plasmid that is fit to or with virus vector, and transfection effect or infect imports to different DNA in one host cell, and the method that use this moment for example resembles the Engineering at Genetic; Eds.S.M.Kingsman and A.J.Kingsman; Blackwell Scientific Publication; Oxford, England, such routine techniques described in 1988." conversion " that hereinafter will use or " transformant " speech are meant containing of being produced and express required heterogeneic host cell.

This expression vector is novel, and also constitutes a part of the present invention.

Described reproducible expression vector can prepare according to the present invention, be about to the carrier division compatible with host cell, to produce a kind of linear DNA segment with complete copy, and under condition of contact, link described linear segment with one or more dna moleculars, this molecule is encoded into desired product with described linear segment, for example encode 16kDa protein DNA polymkeric substance or its segment.

Therefore, as desired, in this carrier structure process, can finish or form this DNA polymkeric substance.

The selection of carrier depends in part on host cell, this host cell can be protokaryon or eucaryon.Suitable carriers comprises plasmid, phage, Cosmid and recombinant virus.

Reproducible preparation of expression vectors can adopt the enzyme of the restriction, polymerization and the binding effect that are suitable for this DNA to carry out by the method described in the document that has drawn people such as exhausted Maniatis above for example usually.

According to the present invention, prepare this recombinant host cell by under conversion condition, adopting a kind of reproducible expression vector of the present invention to transform a kind of host cell.Suitable conversion condition be conventional and for example be described in above the people's such as Maniatis that quoted document, or " DNA Cloning " Vol. II .D.M.Glover ed., IRL Press Ltd is in 1985.

This host cell is depended in the selection of conversion condition.Therefore, can use CaCl for host bacterium (as intestinal bacteria) ₂Solution is handled (people such as Cohen, Proc.Nat.Acad.Scl., 1973,69,2110) or with containing RbCl, MnCl ₂, potassium acetate and glycerol mixture solution, use the 3-[N-morpholino then]-propane-sulfonic acid, RbCl and glycerol handle.Mammalian cell can be by transforming coprecipitated the analysing on this cell of this carrier DNA calcium in nutrient solution.The present invention also expands to a kind of reproducible expression vector transformed host cells of the present invention.

Cultivating the host cell that has transformed under the condition that the DNA polymkeric substance is expressed adopts the above-mentioned described ordinary method of document of having drawn people such as exhausted such as Maniatis and " DNA Cloning " to carry out usually.Therefore, preferably under the temperature below 45 ℃, provide nutrient, and cultivate to this cell.Adopt common methods that this product is reclaimed according to host cell.Therefore, when host cell is bacterium (as intestinal bacteria), can carry out physics, chemistry, or the dissolving of enzyme to it; And from the lysate of gained, isolate this proteinaceous product.When host cell when being mammiferous, this product can be separated from the nutrition base or from acellular extract usually.Conventional protein separation process comprises the selective precipitation effect, absorbs chromatography and affinity chromatography, comprising the monoclonal antibody affinity column.

On the other hand, its expression can be carried out in insect cell, wherein uses a kind of suitable carriers such as baculovirus.In a special aspects of the present invention, this protein is expressed in the lepidopteran cell, thereby obtains immune peptide.In order in the lepidopteran cell, to express this protein, should preferably use a kind of baculovirus expression system.In this system, place a shuttle vector usually comprising the expression cassette (this box is connected on a kind of bacilliform virus promoter effectively) of this protein coding sequence.These carriers include the DNA of bacteria of sufficient kind amount to propagate this shuttle vector in intestinal bacteria or some other suitable prokaryotic hosts.This shuttle vector also contains the baculovirus DNA on the desired protein coding sequence next door of being positioned at of capacity, so that can reconfigure between wild-type baculovirus and this heterogenous gene.Then, with this recombinant vectors with the DNA in wild-type baculovirus with transfection in the lepidopteran cell.Thereupon, therefrom select the recombinant baculovirus that from homologous recombination, obtains, and it is carried out the spot purifying by standard technology.Referring to people such as Summers, TAES Bull(Texas Agricultural Experimental Station Bulletin) NR 1555, May, 1987.

Be described in detail in Smithkline RIT(WO/US 89/05550 at this CS method of protein of expressed in insect cells) VSSN 287,934.

Production in insect cell can be finished by the infected insect young.For example, this protein can be by feeding micro-wild-type baculovirus and recombinant baculovirus of the present invention and extracting its protein from its hemolymph and be prepared in cigarette bud liquid moth caterpillar after about two days together.Referring to, for example, people PCT/WO 88/02030 such as Miller.

Novel protein of the present invention also can be expressed in the yeast cell, as EP-A-0 278941 for CS protein described.

Vaccine constitutes thing can be made with methods known in the art, referring to, as European patent application EP-083,286 Health Research Inc, contriver Paoletti and Panicali.This vaccine constitutes the structure of thing and will introduce in more detail in example.

The present invention has shown that ICP27 can adopt the special CTL of human HSV by inducing with HSV-2 cells infected stimulated in vitro PBMC to discern.By usability transfect cell stimulated in vitro cell, the virus epitopes of synthetic preferably exists with the class form in cytoplasm.Therefore, will comprise I class and the restricted T cell of II class with this approach at the spectrum of the effector cell of stimulated in vitro.

This be used for the activatory free virus and stimulate the process of ready PBMC to form contrast, this free virus is the known II class restrictive effect thing CTL that preferentially induces, this virus enters in the cell of antigen existence by endocytosis, and is undertaken by this II class.path.Antigenic new Synthesis does not take place, and the less generation of the limited demonstration of I class.

Human CTL replys the antigenic specificity of HSV for being quite effective as effective subunit vaccine, is characterised in that it can set up latent period and regularly bring back to life because HSV infects.Hide and the resurrection process in because virus mainly is when remaining in the cell, so have only indivisible free virus to be exposed to antibody.

According to the present invention in order farthest to increase the protective capacities of vaccine, this vaccine can also preferably contain one or more other HSV protein, other be early stage type, early stage type or delaying type protein (these protein can be replied at human body internal stimulus-CTL), as gD or gC Vmw65, RR ₂, ICP0 or ICP ₄Specifically, this vaccine can advantageously contain a kind of gD derivative that blocks of deriving out from HSV-2, in being described in EP-139417B.This vaccine also can contain HSV-1 protein or at the afterbody (Cocktails) of the same proteinic varient of their existence place.

This vaccine also can contain HSV-1 protein or at the afterbody (Cocktails) of the same proteinic varient of their existence place.

Vaccine of the present invention preferably also can be assisted thing.Known auxilliary thing comprises alum (aluminium hydroxide) mycobacterium deutero-antigen, as the complete or non-complete assistant agent of Fu Luoyinde and the two peptides (MDP) of muramyl and derivative, saponin(e type assistant agent such as QS21(U.S. Pat 5057,540) or the like.A particularly preferred auxiliary agent is single phosphoryl lipid A(3D-MPL that 3-0-sloughs acyl group), it has been bought from Rili Immunochem, and can be prepared according to the method for GB 2220211, or QS21 has bought from Cambzidge Biotech.

In the case, the existing scope of 3D-MPL and/or QS21 is per unit dosage 10 μ g-100 μ g, and per unit dosage 25-50 μ g preferably.The vaccine that contains 3D-MPL or QS21 is present on the alum or in oil-in-water emulsion usually

The preparation of vaccine is described in the New Trends and Developments in Vaccines. that is edited by people such as Voller, University Park Press, Baltimore, Maryland, U.S.A.1978 usually.Encapsulation in liposome for example has been described in the U.S. Pat 4235877 of Fullerton.Protein for example is connected by Likhite U.S. Pat 4372,945 with by the special US4 of people's such as Armor the U.S. with macromolecular, and 474,757 describe.

Proteinic amount will be chosen to induce immune protection response in typical vaccine in each vaccine dose does not have tangible, disadvantageous side effect simultaneously.This amount will change along with the existence form of the specific immunogen of being used and it.Generally, each desired dosage will comprise the protein of 1-1000 μ g, be preferably 2-100 μ g, preferably 4-40 μ g.Its optimal consumption can be determined by Study on standards for a concrete vaccine, and this research relates to be carried out suitable immunne response and observe in being tried body.After initial inoculation, tried the immunostimulant that body can accept once or several times to have appropriate intervals.

Except the people who is subject to the HSV infection was inoculated, medicinal compositions of the present invention can be used for the patient who infected by HSV is carried out the treatment of immunotherapeutical, so that prevent or reduce significantly recurrence, frequency, severity and the duration of bleb disease.

The ultimate principle that immunotherapy of the present invention is used be the special CTL(of HSV it virus is produced a kind of immunosurveillance) frequency can expand at last antigen stimulation and on physiology, reduce in time after stretching.In addition, virus infection can not excite an enough strong CTL to reply.

When this CTL was present in the health with low quantity, the HSV of resurrection infects will be before special T cell detection arrives by HSV, had more opportunity to carry out repeatedly virus replication, and the result causes a large amount of tangible bleb focuses clinically.Yet if the CTL level is maintained a level of determining by suitable treatment vaccination regimen, the time that the viral detection of resurrection is duplicated will remain on the shortest.Like this to the HSV infected individuals, eliminating or reducing the effect that will have benefit aspect the severity of clinical detectable recurrent focus.This effect also have aforesaid by CTL to being the advantage that the specificity of early antigen provides.

The suitable scheme that treatment is inoculated can be defined as the vaccine preparation for acceptable quantity on the at interval interior at the appointed time administering therapeutic of HSV infected individuals, thereby reaches the result who eliminates or reduce the severity of the recurrence bleb disease that took place in the past.

Example 1

The expression of HSV2 ICP27 in vaccine virus

1, in vaccine expression vector, inserts the synthetic polylinker

By with the synthetic polylinker:

SC1115′GGGAAAACCATGGATCCATGGCAGGTACTAGTGTCGACTAACTAACTAA3′

SC1123′CCCTTTTGGTACCTAGGTACCGTCCATGATCACAGCTGATTGATTGATT5′

Be inserted in the Sma I site exclusive in the PSC11 vaccine virus expression vector and obtain people such as pRit 13389(Mackett M., 1985.DNA Cloning Vol II, chap 7, apractical approach, Ed.DM Glover, ISBN 0-947946-19-5).Referring to Fig. 1.

2, be used for the construction that HSV2 gene ICP27 expresses.

With the major part clone of the open deciphering password (1481 bp) of ICP27, as a segment of treated 1666bps Xhol/M ︱ u ︱ T4 polysaccharase.This segment contains 185bp in this gene downstream.

3 ' not petiolareas of disappearance are by the synthetic oligonucleotide.

UL5415′CATGGCTACCGACATTGATATGCTAATCGACCTAGGATTGGACCTGTCCGACAGCGAGC3′

UL5423′CGATGGCTGTAACTATACGATTAGCTGGATCCTAACCTGGACAGGCTGTCGCTCGAGCT5′

And constitute

(between the site through Ncol and the processing of Spel T4 polysaccharase) links together these two segments in pRit 13389.This construction is called pRit 13395, referring to Fig. 2.

3, the expression in the virus in vaccine

Scheme (except the plasmid DNA with 20 μ g experimentizes) according to people such as M.MACKETT transforms vaccine virus with this expression cassette, (people 1985.ibid such as Mackett M.).Carry out transfection with CV1 cell (ATCC CCL70) and the strain of WR vaccine virus.

According to people's such as Mackett method, in mouse 2 cells (ATCC CRL1764), realize the selection of recombinant chou.People such as the detection of betagalactosidase activity such as Chakrabarti S., Mol.Cell.Biol.1985 5: described in the 3403-3409.

4, recombinant vaccine virus

The expression of recombination product is tested by the Western blotting in vaccine virus.Antibody used in the protein detection obtains (this synthetic peptide is JCP27 aa2-12 ATDIDMLIDLG, is coupled on the BSA carrier) by with the artificial synthesis peptide rabbit being carried out immunity.

Rabbit anteserum is diluted to 1/1000, to carry out the Western engram analysis.

Example 2

At expression in escherichia coli ICP27(II SV2)

Illustrate: used escherichia expression system is plasmid pMG81, and it is a kind of derivative (referring to following reference 1) that effectively produces proteinic pMG27N in intestinal bacteria by cultivation.Plasmid pMG27N is a kind of derivative of carrier pAS1, and people have been used for it synthetic a large amount of multiple foreign protein matter (referring to reference 2-9).The heterogenous gene that this pMG27N plasmid (as pAS1) has utilized the signal from 1 phage DNA to drive insertion is transcribed and is translated.This plasmid contains 1 promotor PL; Operon OL; Two are utilized site (Nutl and NutR) to alleviate the transcription polarity effect when N albumen is provided; C II ribosome engages the site comprising the C II translation initiation codon of introducing (reference 1) in Nde I restriction site.Plasmid pMG1 is by constituting among the pMG27N of 81 the highest in NS1 coding region aminoacid insertion by BamHI and sacI digestion, this NS1 coding region is from influenza strains A/PR/8/34, this bacterial strain by BamHI such as NcoI from plasmid pAS1 EH/801(reference 4) cracking come.Will be by connecting two kinds of synthetic oligonucleotides

(5 ' ATCCCGGGATAAAAACAACCAAGGTAATGGACA3 ' and the resulting synthetic DNA joint of 5 ' GCCCTATTTTTGTTGGTTCCATTACCTGTT3 ' between NcoI and SacI site, insert.PMG81 is a kind of derivative of pMG1.PMG1 digests to remove this ampicillin resistance gene with Bg1 II-PstI.From transposon Tn903(13-15) kalamycin resistance gene by from plasmid pOTS207(16) separate, it is realized by the EcoRI-PstI digestion, the DNA joint of itself and synthetic linked together enter among the pMG1, thus with two kinds of synthetic oligonucleotides ( ⁵' AATTCGTACCTA ³' and ⁵' GCATGGATCTAG ³') link together.

Being used to prepare the proteinic AR58 bacterial cell of NSI-ICP27 lysogen is standard N IH large intestine ferment bacillus K12 bacterial strain N99(Fsu-ga τ K2 LacZ-thr-) a kind of derivative.It contains a kind of defective phage λ lysogen (gal E:Tn10,1Kil-cI857HI), it is that Kil(prevents promptly that host's macromole is synthetic and stops), has a cI857 sudden change (a temperature sensitive focus in this cI arrestin), and have this H1 disappearance, this disappearance has been removed the right operon of this lambda particles phage and its host bio.uvr3. and chlAloci(reference 17).The AR58 bacterial strain is by with being grown in SA500(galE::Tn10 before this, 1Kil-cI857 H1) P1 phage original seed transduction N99 on the derivative produces.The importing of this disappearance λ lysogen in N99 can be selected with tsiklomitsin by means of a kind of Tn10 transposon of the coding tetracyclin resistance that exists in adjacent galE gene.N99 and SA500 are e. coli k12 strains, and it is to produce from the Dr.Martin Rosenberg ' s laboratory of National Institute of Health.

A key property of native system is that the plasmid that will contain the PL promotor imports among the molten sourcesink master of a kind of intestinal bacteria, to stablize this plasmid DNA (reference 3).Being cloned into can stop in the lysogen to make this cytotoxic (10) proteinic synthetic.For these purposes have been used disappearance lambda particles phage lysogen, do not take place so that do not have the phage preparation.Integration in this host gene lambda bacteriophage dna guiding cI arrestin matter synthetic, this protein combines with 01 operon on this plasmid and stops RNA polymerase to combine with the PL promotor.So the gene of this insertion is to transcribe immobilized and the synthetic of this recombinant protein do not taken place, and for this reason, in the clone and process of growth of cell, does not express.Yet,, just can be clocklike by transcribing of PL guiding if disappearance property λ gene carries a kind of temperature-sensitive mutation (reference 11) in the cI gene.Bacterium is grown in lacking the condition of expression (30 ℃ of transposons activate), become 42 ℃ then and make the transposon outage, and begin synthetic desired gene product.The construction of plasmid pMG81/ICP27 plasmid pMG81/ICP27 (express NS1-ICP27) as following described (Fig. 3) be built into.The 1.7kb segment that contains the ICP27 gene is made by filling outstanding end and finally digest this linearity segment with NcoI with EcoRI digested plasmid pMG81/ICP27, with the T4 archaeal dna polymerase.Separate with sepharose and electroelution (electroelution) afterwards, this segment and front link together with the plasmid pMG81 that Xba I digested, and handle with the T4 archaeal dna polymerase, digest with NcoI then.Should link mixture is transformed among the coli strain AR58.This transformant is selected containing on the solid medium of kantlex.

The expression of NS1/ICP27 is with strains A R58(pMG81/ICP27) in containing the 20ml LB substratum of kantlex, to cultivate, the irradiation that is subjected to an optical density(OD) (620nm) under 30 ℃ of conditions is 0.6.Then this nutritive medium was cultivated 3 hours under 42 ℃ of conditions.After cultivating, be 0,30 minute, 1 hour, 2 hours and 3 hours these nutrient solutions of taking-up 5ml in the time.These samples are carried out the SDS-polyacrylamide gel electrophoresis.Then this protein is splashed on the nitrocellulose membrane by electromigration (electrotranfer).This ICP27-specific protein is detected with rabbit X-ICP27 antibody.The Western engram analysis shows and has a sharp-pointed band, and the NS1-ICP27's of its size and expectation is big or small consistent.Littler ICP27-specific polypeptides also detects with rabbit anti-serum: they may represent NS1-ICP27 gene product that degrade or incomplete.

Reference

1, people's such as Gross 1985, Mol.﹠amp; Cell.Biol.5: 1015

2, people's such as Rosenberg 1983, Methods Enzymol.101: 123

3, people's such as Shatzman 1983 in Experimental manipulation of gene expression(Inouya, M.Ed), pp 1-14.Academic New york

4, people's such as young 1983.Proc.Natl Acad.sci.USA is 80: 6105

5, people's such as yamada 1985.J.Exp.Med.162: 663

6, people's such as Ferguson 1984.Science224: 1343

7, people's such as Watt 1985.Mol.﹠amp; Cell.Biol.5: 448

8, people's such as devara 1984, Cell is 36: 43

9, people's such as Ferguson 1985, J.Biol.Chem.260: 3652

10, Shimataka, H. and Rosenberg, M.1981 Nature(London) 292: 128

11, Sussman, R. and Jacob, F.1962.C.R.Hebd.Seances Acad.Sci.Ser.A is 254: 1517

12, people's such as Wallich 1989, Nucleic Acids Res.17: 8864

13, Oka, people's such as A. 1981.J.Mol.Biol.147: 217

14, Berg, people such as D.E 1978. at Microbiology(Sclessinger, D. is ed) among the pp.13-15.American Society for Microbiology，Washington，D.C.

15, people's such as Nomura 1978. people such as The sc ' ngle-stranded DNA phages(Denhardt, eds.) among the pp.467-472.Cold Spring Harbor Laboratory，New York.

16, Shatzman, A. and Rozenberg, M.1987.Methods Enzymol.152:661.

17, people's such as Castellazzi 1982.Molec.Gen.Genet.117: 211

Example 3 recombinant vaccine virus immunizations

By in the Ball/c mouse with the recombinant vaccine virus of the ICP27 that expresses HSV-1 carry out immunization induce to the technology of the CTL of ICP27 known by people such as Banks at (1991) J.Virol.65: be described among the 3185-3191.

Equally, with the vaccine recombinant of the ICP27 that expresses HSV-2 inoculate also can in the Balb/c mouse, induce in a kind of special CTL reply and prevent that they are towards wild-type HSVn or HSV ₂Zoster direction expansion.

Table 1 is with VVICP27(HSV1 or HSV2) inoculate to prevent of the zoster direction expansion of BALB/C mouse towards wild-type HSV1 or HSV2

Inoculation	Challenge virus	Dosage	Focus % *	Dead % *	CTL ＊＊
						VVICP27 (HSV1)	HSV1?17+ HSV2?MS	10 ⁵10 ⁴10 ⁵10 ⁴	0 0 0 0	0 0 0 0	+
VVICP27 (HSV1)	MSV1?17+ HSV2?MS	10 ⁵10 ⁴10 ³10 ⁵10 ⁴10 ³	0 0 0 0 0 0	0 0 0 0 0 0	+
						Contrast VV tk-	HSV1?17+ HSV2?MS	10 ⁵10 ⁴10 ³10 ⁵10 ⁴10 ³	100 100 100 100 100 100	100 100 100 100 100 100	-

Balb/c mouse group (15 mouse/group) is with 10 ⁷The ICP27.VV of pfu carries out immunity in toe, and uses wild-type HSV-1(17+) or HSV-2(MS) after two weeks, attack.Write down banded herpesvirus type focus and death condition then.

The Balb/c mouse is with 10 ⁷The ICP27.VV of pfu carries out immunity in toe.In order to estimate initial replying, after 5 days, remove drainage leg bending part lymphatic node knot and need not external hormesis again to carry out the CTL test.

Example 3 is by the identification of human CTL to ICP27

Material and method: patient

Will be by venipuncture from Topical Medicine Inetitute(Antwerp) participate in blood sample collection that the patient of sexually transmitted disease clinical treatment obtains on one's body to the heparinization pipe.The mode that patient has the genital herpes infringement focus of various clinical severity and recurrence disease is also different.Asymptomatic sexual with patient of recurrence disease is also included within this research.The virus hsv.Employed herpes simplex virus type 2(HSV-2 in these experiments) HG52 bacterial strain is by Prof.Subak-Sharpe(MRC, and Glasgow U.K.) provides with open arms.These viruses are grown in the BHK21 cell, and this cell is subjected to the infection under repeatedly infection (m.o.i) condition that 0.003 bacterial plaque forms unit (p.f.u)/every cell.With this cell 5-7 days results after infecting, carry out sonication with its division and to it by freeze/thaw.Virus titer is measured on the BHK21 cell by the bacterial plaque test.

The ICP27 vaccine recombinant is prepared by mode as herein described.

Substratum PBMC nutrient solution is at ROMI 1640(Gibco, Ghent, Belgium) in growth, and preparation is with 10%(V/V) the tire calf serum (FCS) of heated and inactivated (Flow laboratories, Irwine, Scotland), 2x10 ^-3ML-glutamine, 100IU/ml penicillin, 100 μ g/ml Streptomycin sulphates, 5x10 ^-5M mercaptoethanol, the nonessential amino acid of 1%MEM (Gibco), 1x10 ^-3M Sodium.alpha.-ketopropionate MEM(Gibco).Cell peripheral blood monocyte (PBMC) passes through at a Lymphoprep(Nycomed, Oslo, and Norway) density gradient (Boyum, A.(1968) Scand.J.Clin.Lab.Invest.21, Suppl.97,77) goes up separation and obtains from blood.PBMC is at 10%DMSO 90% FCS(V/V) in freezing and before using, it is thawed as responsive cell at once.

The aliquot sample of the PBMC that obtains on one's body from each patient is used for producing by transforming with Epstein-Barr virus (EBV obtains the nutrient solution supernatant liquor of the suede clone B-95.8 that infects from continuing) lymphoblast clone (LCL).For example (Walls.E.V. and Crawford, D.H(1987)) is described in the Generaf:on of human Blymphoblastoid Cell lines using Epstein-Barr virus.In: Iymphocytes, a practical approach, Klaus, G.G.B.(edits) pp.149-162, this LCL is used as target cell in cell toxicity test.

Activate lymphoblast with 4 μ g/ml PHA-9(Sigma as the PHA-of stimulon cell) 37 ℃ of cultivations 5 * 10 down ⁶It is 72 little and use 5U.mL rIL2(Bo-ehringer that PBMC reaches) cultivate 5 * 10 down at 37 ℃ ⁶PBMC reaches 7 days more and prepares.Then with this lymphoblast HSV-2(m.o.i=10) infected 16 hours down at 37 ℃, and in PBS, handled 20 minutes down at 4 ℃ with 1% formaldehyde.

A large amount of cultures thaw PBMC and stimulate in 24 well plate cultures, and this culture contains 2 * 10 ⁶Responsive cell and 5 * 10 ⁵Wherein there is 1 μ/mL human recombinant IL-2(rIL-2 in the stimulon cell, Boehringer Mannheim) and the supernatant liquor that 5%(V/V) from PHA activates lymphoblast, obtains.Every 3-4 days with replenishing with in 5 μ/mL rIL2 and the 5% PHA-parent cell supernatant liquor developing medium adding nutrient solution.Nutrient solution stimulated and carried out at the 20th day the toxicity activity test again at the 10th day.

Restriction dilution nutrient solution thaws PBMC and is distributed in the plate at the bottom of the 96 well garden shapes.The quantitative range of the responsive cell of each well is 10 ³To 4 * 10 ⁴Between, and to 24 to 32 The Small Wells determine each the input cell concn.With autostimulation daughter cell (5 * 10 ⁴The Small Well) adds all The Small Wells.Comprising the contrast well of not replying daughter cell.Layer nutrient solution reclaims 1U/ml rIL-2 and 5%(V/V thereon) PHA-parent cell supernatant liquor, and every 4-6 days with 5U/ml rIL-2 and 5%(V/V) PHA-parent cell supernatant liquor adds this nutrient solution.In chromium-release test, at 14-21 days 3 kinds of different target cell types are tested independently obtaining the equivalent aliquots containig the nutrient solution from each; Use HSV-2, psC11.VV and ICP27.VV infect the LCL from body.

Cell toxicity test is used HSV-2 with the LCL target cell under 37 ℃ of conditions, psC11.VV or ICP27.VV(m.o.i=10) infected 1 hour, washing and under 37 ℃ of conditions with 500 μ Ci's ⁵¹Cr(Medgenix, Fleurus, Belgium) 1 hour-symbols.The washed twice target cell was cultivated it 30 minutes on ice then, wash once, and with 2 * 10 in each well ³Cell is distributed to the well neutralization that contains responsive cell and contains culture medium or Triton X-100 3%(in water) the contrast well in (spontaneous release and maximum release respectively).Is that 200 μ l cultivated 4 hours under 37 ℃ of conditions with effect and target cell mixture with total amount, gathers in the crops 100 μ l supernatant liquors then, and discharges ⁵¹The Cr(count value).Its result represents with the special dissolving of % according to following formula:

The special dissolving of %=((experiment-spontaneous release))/((total amount-spontaneous release)) * 100

CTL frequency measurement and scatter diagram are replied with frequency and passed through Fazekas de St.Groth(Fazekas de St.Groth, S.(1982) The evaluotion of limiting dilution assags.J.Imm.Meth.49: R11-R23) method of described maximum possible is calculated.For each target cell type, if the special dissolving of % is greater than cutoff, then the call of this well be on the occasion of, this cutoff is defined as mean value+3 standard errors that do not have the contrast of responsive cell well.The frequency predication value of HSV-2 and ICP27 Idiotype CTL got rid of contrast target (psC11.VV is infected) go up any well be recorded as on the occasion of well after and obtain.

Scatter diagram is used for estimating the specificity of cultivating cell lysis activity in the restriction dilution.Test with each well div in par aeq volume and to the lysis of the target cell that infects with HSV-2, psC11.VV or ICP27.VV.Therefore, each well produces the special dissolved multiple value of %.With a pair of value of selected target cell type as representing each well from coordinate at 2 dimension Cartesian diagrams.By its cutoff that each target cell type is drawn, this figure is divided into 4 parts: on two targets, be the well of negative value, on two targets be on the occasion of well and at a target for being the well of negative value on the occasion of another.

HSV-2 a large amount of nutrient solutions of dying different in nature CTL are induced as a result.From 10 patients that have the various clinical symptom of genital herpes, obtain PBMC and by in a large amount of the cultivation, it is being stimulated like that described in material and the method.Then to this nutrient solution test its ⁵¹HSV-2 specific cell lytic activity in the Cr release test.Wherein use and suppress contrast with xenogeneic LCL target cell as HLA from body.

Representational the results are shown in the table 2.Resemble six patients of 102 and have the special HLA-restriction effect of HSV-2, and in resembling 4 patients of 109, do not have active the demonstration.Can not induce all patients of CTL when its blood sample takes out, all to have active focus.Only there is a patient who is falling ill to detect HSV-2 is had specific CTL(table 2).

The frequency of HSV-2 specific CTL, in order to estimate the frequency of HSV-2 specific CTL, with the patient P BMC of various quantity cultivation in the presence of the autostimulation daughter cell of constant number (the PHA-parent cell that infected by HSV-2, its preparation as described in material and the method).Each is advanced test does negative contrast with HSV-2 or psC11.VV() infect from body LCL cytolysis situation.In 14 patients with this method test, there are 3 (108,114 and K01) to have high effector frequency, this effector has dissolved the target cell that infected by psC11.VV, so they are not considered.In 7 patients the range of frequency of (107,109,111,114,116,118,120) HSV-2 specific CTL between 1/10000 to 1/36000 (for example referring to patient 111, and remaining 3 patient (101,110,112) has the frequency (table 3) less than 1/89000 table 3).The mutual relationship of being seen when a large amount of cultivation the between detectable CTL activity and the focus time of occurrence is no longer obvious: CTL is that the patient table of negative value reveals that CTL can survey in the restriction dilution is cultivated in a large amount of the cultivation.Do not have significantly relation appear between annual recurrent number and the CTL frequency, demonstrate its more responsive than in a large amount of cultivations in the active detection of restriction dilution cultivation CTL.For example patient 109 demonstrates negative value in a large amount of the cultivation, but has found the HSV-2 specific CTL (table 2 and table 3 are relatively) in the restriction dilution is cultivated.

In order to estimate the effect of ICP27 in CTL identification, the restriction dilution nutrient solution of the patient P BMC that will stimulate with the stimulon that infected by HSV-2 is divided into 4 kinds of states and will using the HSV-2.psC11 vaccine virus from 3 parts of aliquots containigs of each well by HSV-2 specific CTL identification virus antigen.VV or ICP27.VV(table 4) infect on body LCL, test (table 4), in having 7 patients of high frequency HSV-2 specific CTL, have two (116 and 118) to have ICP27 specific CTL (frequency is 1/22000 and 1/50000).In patient 118, the main HSV-2 antigen that ICP27 seemingly discerns by CTL.The intermediate frequency that has specific CTL for ICP27 antigen takes place on one's body patient (as 107).The frequency that 109 couples of ICP27 of patient have specific CTL is very low.

Table 2

In a large amount of the cultivation detected result of HSV-2 specific CTL with

Timing relationship after focus occurs

Patient P BMC is stimulating in a large amount of nutrient solutions with the stimulon cell that infected by HSV-2, and do not infect or be subjected to that HSV-2 infects from body or xenogenesis LCL target on its cell lysis activity is tested.

* medical history is by patient report.Annual recurrent number is to carry out normalized for the basis to 1 year according to the recurrent number in the various timed intervals of patient report.

This patient of * is the silent partner person with patient of recurrent focus.

These patients of * * have detectable CTL in the restriction dilution is cultivated.

Table 3

The frequency of HSV-2 specific CTL

PBMC uses the lymphoblast that infected by HSV-2 from body to stimulate in the restriction dilution is cultivated.

Each well separates, and tests on the target cell that infects with HSV-2 or psC11.VV..

* medical history is reported by patient.Annual recurrent number is to carry out normalized for the basis to 1 year according to the recurrent number in the various timed intervals of patient report.

Table 4

The frequency of the ICP27 specific CTL of comparing with the frequency of the CTL that discerns HSV-2

To from HSV-2 being had PBMC(CTL frequency that the good patient who replys obtains between 1/10000 and 1/36000) carry out the ICP27 identification and evaluation.After having got rid of the well that on the contrast target cell that infects with psC11.VV, has lytic activity, carry out frequency computation part.

* medical history is by patient report.Annual recurrent number is to work as one for the basis to 1 year according to the recurrent number in the various timed intervals of patient report to change.

Here show for the first time that ICP27 HSV-2 can discern by human HSV specific CTL, this CTL be by with the cell that infected by HSV-2 at stimulated in vitro PBMC and inductive.ICP27 is a kind of 63 kilodalton polypeptide by a coding in 5 X genes, and this α gene is at first expressed after infection, and ICP27 reached peak value in the time of 2-4 hour synthetic.ICP27 has regulatory function and may be the delaying type necessary for gene expression.In 7 (having the HSV-2 specific CTL of range of frequency between 1/10000 and 1/36000) patient groups, wherein there are two patients to have the ICP27 specific CTL of frequency between 1/22000 and 1/5000.These frequencies be got rid of contrast be recorded as on the target cell on the occasion of all calculate after cultivating, so it comprises the evaluation of estimate of minimum.

These results show the human polypeptide that can be directed to non-virion to the critical part of replying of hsv.Really can discern this antigenic patient for each, the low expression may may take place though we can not get rid of delaying type antigen in this major ingredient of always replying that has constituted HSV-2 of replying in the employed condition of HSV-2 target cell infection.

Claims

1, is early stage type HSV-2 virus protein ICP27, it is to discern by the cytolysis T lymphocyte (CTL) in human body, it has the sequence of listing in fact in Sequence ID1, or derivative of equal value or its segment on its immunology or that antigen is learned.

2, according to the protein of claim 1, wherein this protein is as a kind of fused protein or on a carrier and express.

3, according to the protein of claim 1 or 2, wherein this protein exists by a kind of bacteria carrier or a kind of virus vector of work, or is imported in a kind of HSV light granules.

4, according to the protein of claim 3, wherein this virus vector is a vaccine.

5, a kind of dna sequence dna, it has in the sequence described in Sequence ID2 or its fragment, or hybridizes to a kind of dna sequence dna on the described sequence, and this dna sequence encoding has bioactive a kind of protein of HSV-2 ICP27.

6, a kind of expression vector is comprising the DNA defined in the claim 5.

7, HSV-2 ICP27 is used for medicine.

8, preparation is according to any one described method of protein in the claim 1 to 4, and it comprises:

I) a kind of reproducible or integrating expression vector of preparation, this carrier can be expressed a kind of DNA polymkeric substance in a host cell, and this polymkeric substance comprises-nucleotide sequence, this sequence encoding described HSV-2 ICP27 protein or its immune-derived thing;

II) with described carrier transformed host cell;

III) under the condition that can express described DNA polymkeric substance, cultivates the described host cell that has transformed, thereby make described protein; With

IV) reclaims described protein.

9, a kind of being used for the treatment of or vaccine composition that prophylactic treatment HSV infects is comprising the protein defined in any one of claim 1 to 4 and a kind of mixture of suitable carriers.

10, according to the vaccine composition of claim 9, it comprises 3D-MPL or QS21.

11, a kind ofly treat the method that human or animal's easy infection HSV infects, comprising use effective dose as the vaccine defined in claim 9 or 10.

Sequence 1

Sequence 2

Sequence 2 is continuous