CN109266721A - A method of telomerase activation is detected based on no quenching molecules beacon - Google Patents
A method of telomerase activation is detected based on no quenching molecules beacon Download PDFInfo
- Publication number
- CN109266721A CN109266721A CN201811168723.7A CN201811168723A CN109266721A CN 109266721 A CN109266721 A CN 109266721A CN 201811168723 A CN201811168723 A CN 201811168723A CN 109266721 A CN109266721 A CN 109266721A
- Authority
- CN
- China
- Prior art keywords
- telomerase
- cell
- mixture
- primer
- buffer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/48—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to technical field of biological, and in particular to a method of telomerase activation is detected based on no quenching molecules beacon.The 2-aminopurine that the present invention provides a kind of for detecting cancer cell Telomerase Activity is without quencher molecule beacon detection method.Telomerase is extracted from cancer cell, catalysis recurring unit (TTAGGG) n is added to substrate chain and generates the duplicate extension products of telomere, with the addition of KF polymerase, primer extends to form double-strand along template, the chain of 2-AP MB can be by T7 exonuclease degradation in double-strand, free 2-AP molecule and primer extension chain are released, free primer extension chain can form new double-strand in conjunction with other 2-AP MB, cause the degradation of next round T7 excision enzyme.The molecule of the present invention compared to the prior art believes method, realizes dual signal amplification, and there is highly sensitive and specificity, the exploitation applied to anti-tumor drug to be of great significance.
Description
Technical field
The invention belongs to technical field of biological, and in particular to a kind of based in no quenching molecules beacon detection cancer cell
The method of telomerase activation.
Background technique
Telomerase is a kind of important reverse transcriptase, by the way that repetitive sequence (TTAGGG) n is added in the end chromosome 3', is come
Prevent the shortening of natural telomere.In most of normal cells, Telomerase Expression is inhibited by stringent, causes telomere with thin
The division of born of the same parents and be gradually shortened.In contrast, in 85% or more human cancer cell, the significant up-regulation or sharp of the activity of Telomerase
Living, wherein lung cancer, breast cancer, gastric cancer, prostate cancer, bladder transitional cell carcinoma play an important role in cell immortality.It is normal thin
The difference of telomerase activation makes potential source biomolecule marker of the Telomerase as cancer diagnosis between born of the same parents and cancer cell.In addition, telomere
The inhibition of enzymatic activity can effectively inhibit the growth of human cancer cell, even result in cancer cell death, and Telomerase is made to become cancer
The very attractive target for the treatment of and anticancer drug discovery.
The ultimate challenge of Telomerase activity first is that the expression of cell telomerase is extremely low, it is therefore desirable to it is highly sensitive
Detection method.Telomeric repeat amplification method (TRAP) based on polymerase chain reaction (PCR) is the gold of Telomerase activity
Standard.In TRAP experiment, the telomerase substrate of synthesis is elongated by purpose Telomerase, is then passed through PCR amplification and is quantitatively obtained
Extension products.In addition, passing through the combination of drop digital pcr, nanoparticle, Capillary Electrophoresis and magnetic bead in the art, propose
Some improved TRAP methods, to improve the specificity and sensitivity of detection.However, the method for TRAP usually requires expensive instrument
Device carries out thermal cycle, and PCR induction often generates high background signal with non-specific amplification.
In addition to TRAP method, this field be also developed in conjunction with gold nano grain (AuNP) colorimetric method, Ru (bpy) 32+Electrification
Learn sensor, the micro- monomolecular counting of total internal reflection fluorescent, Telomerase response mesoporous silica nano-particle (MSN) and
AuNPs.However, also needing the signal acquisition of the complicated nano material of synthesis, surface modification program and valuableness in the above method
Instrument.Due to lacking effective signal amplification means, detection means sensitivity in the prior art is lower, it is difficult to meet practical inspection
It surveys and needs.Therefore, developing simple, sensitive Telomerase activity method is highly.
Lung cancer is cancer most fatal in numerous human cancer types, and the whole world death rate relevant to cancer has closely
25%, survival rate is lower than 60% within 5 years.Telomerase can be used as the prognostic indicator of pulmonary cancer diagnosis, and be pressed down in vivo using Telomerase
Preparation GRN163L treatment can effectively prevent lung cancer cell growth.
The inspection policies of molecular beacon (MB) are widely used in bio-sensing field because its is simple, sensitive and selectivity.
However, traditional MB probe is needed using organic dyestuff and quencher double labeling distal hairpin, this is a difficulty and cost
Expensive process.In addition, organic dyestuff photostability used in tradition MB probe is poor, the service life is short.2-aminopurine (2-AP)
It is the analog of adenine and adenosine, high quantum production rate and photostability more better than organic dyestuff and longer with 0.65
Service life.When 2-AP and double-stranded DNA (dsDNA) are combined, due to the superposition with adjacent base, fluorescence is sudden by height
It goes out.This unique 2-AP characteristic has pushed the development without quenching probe, and the probe is for detecting DNA base overturning, DNA damage
Wound, nucleic acid conformation variation, microRNA expression and enzymatic activity.Due to because Telomerase cannot directly induce turning for 2-AP fluorescence
Change, is had not been reported using the research of 2-AP MB probe in detecting Telomerase.It is living that 2-AP fluorescence probe is used for cancer cell telomerase
The detection of property, is of great significance for the exploitation of antineoplastic.
Summary of the invention
For blank in the prior art, it is living that the present invention provides a kind of no quenching molecules beacon detection cancer cell telomerase
The method of property.The present invention devises a kind of 2-aminopurine fluorescence probe, by introducing nucleic acid primer and KF polymerase, Telomerase
Presence can promote the secondary amplification of target signal specificity, discharge a large amount of free 2-AP molecule, enhancing fluorescence signal, significantly
Improve sensitivity.Can be achieved the Telomerase in single lung carcinoma cell is detected, and without any additional quencher,
Surface modification and thermal cycle operation.
In order to realize above-mentioned technical effect, the technical solution adopted by the present invention are as follows: extract Telomerase from cancer cell, the end
Granzyme catalysis telomeric repetitive unit (TTAGGG) n is added to the end 3' of telomerase substrate chain, generates the duplicate Telomerase of telomere and prolongs
Stretch product.As Large fragment polymerase (KF polymerase, 3' → 5'exo-) is added, primer extends (i.e. 2-AP MB) along template
Double-strand is formed, to replace the extension products of Telomerase.
Wherein template sequence are as follows: 5'-TAACACTGTCTGGTAAAGATGGCCCTATAGTGAGTCGTATTA-3 '.
The telomerase extended products of release can trigger the new polymerization reaction period in conjunction with other 2-AP MB, generate
A large amount of double-strand.Meanwhile in double-strand 2-AP MB chain by T7 exonuclease degradation, lead to free 2-AP molecule and primer
Extended chain is all released, and exposed 2-AP molecule issues fluorescence signal, and primer extension chain is due in the end primer 5' phosphoric acid
Change modification and retain, and form new double-strand in conjunction with other 2-AP MB, causes next round T7 excision enzyme degradation reaction.
In the present invention, each Telomerase can trigger multiple polymerization cycle, generate a large amount of double-strand, and each double-strand
Multiple degradation cycle can be caused again, generate Cascaded amplification effect.The present invention constructs secondary singal amplification system, can fast quick-release
Amplification quantity has the free 2-AP molecule of hyperfluorescence transmitting, and fluorescence signal is stablized, and can be supervised by sepectrophotofluorometer
It surveys.
It, should in order to realize that the above technical purpose, first aspect present invention provide a kind of no quencher molecule beacon fluorescence probe
No quencher molecule beacon fluorescence probe is 2-aminopurine fluorescence probe, the sequence of the fluorescence probe are as follows: 5'-
AAGCTGAGGTCTTGG(2-AP)CACCCTAACCCTAACCCTAATGTCCAAGA-3'。
Second aspect of the present invention provides a kind of detection kit based on no quencher molecule beacon detection telomerase activation,
The detection kit include 2-aminopurine fluorescence probe, telomerase substrate, primer, KF polymerase, T7 exonuclease and
DNTP, the wherein sequence of 2-aminopurine fluorescence probe are as follows: 5'-AAGCTGAGGTCTTGG (2-AP)
CACCCTAACCCTAACCCTAATGTCCA AGA-3'；
The sequence of telomerase substrate are as follows: 5'-AATCCGTCGAGCAGAGTT-3'；
Primer sequence are as follows: 5'-T*C*T*TGGAC-3', wherein * represents thio-modification.
It preferably, further include buffer in above-mentioned detection kit.
It is further preferred that the buffer includes cell lysis buffer solution, annealing buffer, NEBuffer 2 and Tris-
Edta buffer liquid.
Third aspect present invention provides a kind of method based on no quencher molecule beacon detection telomerase activation, enzyme is mentioned
It takes object, telomerase substrate mixing to be incubated for and obtain mixture A, 2-APMB fluorescence probe, primer, dNTP, KF is added into mixture A
Polymerase and T7 exonuclease are incubated for obtain mixture B, and detect the fluorescence signal intensity of mixture.
Preferably, the step of above-mentioned detection method is as follows:
1) extraction of Telomerase: cracking cancer cell under certain condition, obtains cell extract.
2) 2-APMB is pre-processed: annealing single-stranded 2-APMB to form hairpin structure.
3) it Telomerase experiment reaction: is incubated for after cell extract, telomerase substrate and buffer are mixed, obtains Telomerase
Extend mixture A；The 2-APMB prepared in step 2), primer, dNTP, KF polymerase and T7 exonuclease are added and mixed
Reaction a period of time obtains mixture B in object A.
4) fluorescence detection: sepectrophotofluorometer using xenon lamp as excitation light source at room temperature to mixture B into
Row detection.
Preferably, above-mentioned steps 1) in by cancer cell using phosphate buffer cleaning after, received after trypsin digestion
Collection is added lysis buffer hatching into the cell that collection obtains and prepares cancer cell extract.
It is further preferred that Human Lung Cancer cell strain (A549 cell), human cervical cancer cell line's (HeLa cell) and people
Class breast cell line (MCF-7 cell) is cultivated in suitable moist environment, and cell is clear with phosphate-buffered salt (pH 7.4)
After washing twice, cell is digested from culture dish bottom with trypsase, and by the cell of collection on 2000rpm centrifuge
4 DEG C centrifugation 5-20 minutes.About 1 × 106A cell is resuspended with the cold 1 × CHAPS cracking buffer solution of 200 μ L, is hatched on ice
It 20-40 minutes, is followed by centrifuged 10-30 minutes in 4 DEG C, 12000rpm.After centrifugation, removal supernatant is rapidly frozen and storage
In -80 DEG C of refrigerators.
Still more preferably, the composition that 1 × CHAPS cracks buffer solution includes: 10mM Tris-HCl, pH 7.5,
1mM MgCl2, 1mM [ethylenebis (oxyethylenenitrilo)] tetraacetic acid, 0.1mM benzenecarboximidamide,
5mM β-mercaptoethanol, 3-0.5% (3-cholamidopropyl)-dimethylammonio
Propanesulfonate, 10% glycerol, volume ratio 10000:1000:1000:100:5000:5:100.
Preferably, in step 2) single-stranded 2-APMB sequence are as follows: 5'-AAGCTGAGGTCTTGG (2-AP)
CACCCTAACCCTAACCCTAATGTCCA AGA-3'；
Preferably, in step 2) single-stranded 2-APMB 90-100 DEG C annealing 5-10 minutes.
It is further preferred that 10 μM of single-stranded 2-AP MB with 1 × annealing buffer 90-100 DEG C annealing 5-10 minutes.It moves back
When fiery, being slowly cooled to room temperature makes single-stranded 2-APMB form hairpin structure.
It is further preferred that the group of the annealing buffer becomes 10mM Tris-HCl, pH 8.0,50mM NaCl, 10mM
MgCl2。
Still more preferably, above-mentioned Tris-HCl, sodium chloride, magnesium chloride volume ratio be (1:5:1).
Preferably, step 3) concrete operations are as follows: cell extract that step 1) is obtained, telomerase substrate and 10 ×
NEBuffer 2 makes telomere extend to obtain mixture A in incubation 20-40 minutes at 30-40 DEG C.2-APMB that step 2) is prepared,
Primer, dNTP, KF polymerase, T7 exonuclease are added in mixture A, obtain mixture within reaction 30-90 minutes at 30-40 DEG C
B, 70-85 DEG C inactivation 10-20 minutes.
It is further preferred that 20 μ L reaction systems include 1 μ L cell extract, 200nM telomerase substrate and 2 μ L 10 ×
200nM 2-AP MB, 200nM primer is added after obtaining mixture A in NEBuffer 2 accordingly, and 500 μM of dNTP, 1U KF are poly-
Synthase and 10U T7 exonuclease.Wherein, 1 unit (1U) is the amount that the KF polymerase being commercialized is demarcated, with other substances
Amount there is no conversion relation.10 units (10U) are the amount that the T7 exonuclease of commercialization is demarcated, the amount with other substances
There is no conversion relation.
Preferably, step 3) telomerase substrate sequence are as follows: 5'-AATCCGTCGAGCAGAGTT-3'；
Primer sequence are as follows: 5'-T*C*T*TGGAC-3', wherein * represents thio-modification.
It is further preferred that the composition of NEBuffer 2 are as follows: NaCl 500mM, 100mM Tris-HCl, 100mM
MgCl2, 10mM DTT, pH7.9.
Still more preferably, sodium chloride, Tris-HCl, magnesium chloride, dithiothreitol (DTT) volume ratio be (50:10:10:
1)。
Preferably, fluorescence spectrum is recorded in the range of 350-550nm with the excitation wavelength of 340nm in step 4).Excitation
5.0 and 5.0nm are respectively set as with transmite slit.
Still more preferably, sepectrophotofluorometer is F-7000 sepectrophotofluorometer (Japan, Hitachi).
Fifth aspect present invention provides above-mentioned fluorescence probe and detection kit in terms of test sample Telomerase Activity
Non-disease diagnoses and treatment purpose application.
Preferably, above-mentioned sample is cancer cell extract.
Further, above-mentioned cancer cell is lung carcinoma cell or HeLa cell, MCF-7 cell.Lung carcinoma cell can be
A549 cell.
Preferably, the application of the above-mentioned non-disease diagnoses and treatment in terms of detecting telomerase activation is detection telomerase inhibitor
Application or the application in terms of screening Telomerase related drugs target spot of active aspect etc..
Beneficial effects of the present invention
1. the technical issues of can not directly inducing 2-aminopurine fluorescence conversion for Telomerase, the present invention provides one kind
2-aminopurine probe is used for the means of telomerase activation detection, has filled up blank in the prior art.2-aminopurine is natural
With fluorescence activity, quantum yield is high, and fluorescent stability is good.The method of the present invention is detected compared to common molecular beacon, energy
The step of enough saving organic dyestuff and quencher labels hair clip, and fluorescent stability is good, detects also more convenient.
2. will be polymerize in the present invention by SYBR Gold coloring agent and catabolite dyeing, and it is non denatured by 12%
Polyacrylamide gel electrophoresis (PAGE) analysis, it was confirmed that the cascade signal iodine in the present invention only exists in Telomerase
Shi Caihui occurs, and illustrates that detection method of the invention has good specificity, background interference is low.
3. in molecular beacon iodine in the prior art, probe hybridize with telomerase extended products after through T7 nucleic acid outside
After enzyme cutting shearing, free fluorescence sequence is generated, level-one amplification has been carried out.And in the present invention introduce KF polymerase, primer along
Template extends to form double-strand, to replace the extension products of Telomerase.Meanwhile the chain of 2-AP MB can be circumscribed by T7 in double-strand
Nuclease degradation, free 2-AP molecule and primer extension chain be all released, free primer extension chain can with it is other
2-AP MB, which is combined, forms new double-strand, causes next round T7 excision enzyme degradation reaction, constructs secondary singal amplification system.This
Invention detection method can detect the activity of the Telomerase in single cancer cell, and so significant sensitivity raising is based on existing skill
Art is unforeseen, greatly improves Telomerase activity sensitivity, brings significant technological progress.
Detailed description of the invention
The accompanying drawings constituting a part of this application is used to provide further understanding of the present application, and the application's shows
Meaning property embodiment and its explanation are not constituted an undue limitation on the present application for explaining the application.
Fig. 1: based on the schematic diagram that no quenching molecules beacon detection cancer cell telomerase is living；
Fig. 2: Telomerase activity method specificity verification result figure；
Fig. 2A is the non denatured poly- of the reaction product progress 12% to Telomerase extract (being equivalent to 20000A549 cell)
Acrylamide gel electrophoresis characterization.Wherein, swimming lane M:DNA marker；Swimming lane 1:KF polymerase；Swimming lane 2:
telomerase+KF polymerase；Swimming lane 3:KF polymerase+T7exonuclease；Swimming lane 4:telomerase+
KF polymerase+T7exonuclease.All swimming lanes are by SYBR Gold staining reagent.
Fig. 2 B is the fluorescence detection under different experimental conditions to 2-AP molecule.A represents KF polymerase；B represent KF polymerase+
The combination of T7 excision enzyme shows that there is no polymerization reaction or drops in the case where Telomerase is lacked without apparent fluorescence signal
Solution reaction.C represents the combination of Telomerase+KF polymerase, and 2-AP still merges in the double-strand of synthesis, does not observe fluorescence signal.D generation
Table Telomerase+KF polymerase+T7 excision enzyme detects high fluorescence signal, shows Telomerase activated polymerization/degradation reaction hair
It is raw, so that release has the 2-APs of fluorescence signal.
Fig. 3: the relational graph between fluorescence intensity and A549 number of cells；
Wherein, Fig. 3 A indicates 2-AP fluorescence emission spectrum corresponding to the A549 cell extract of different numbers, with cell
The increase of number, fluorescence intensity enhance therewith；Fig. 3 B indicates the linear pass between fluorescence intensity (F) and A549 number of cells (N)
System.What error bar indicated is the standard deviation of three repeated experiments.
Fig. 4: Telomerase specificity verification result figure；
The control group without any enzyme is detected, telomere enzyme extract (is equivalent to 20000A549 cell)；CpG transmethylase
M.SssI；HhaI restriction enzyme；Carbonamidine yl pyrimidines [fapy]-DNA glycosyl enzyme (FpG) and bovine serum albumin(BSA) BSA institute are right
The fluorescence intensity answered.What error bar indicated is the standard deviation of three repeated experiments.
Fig. 5: variation diagram of the telomerase inhibitor of various concentration to Telomerase relative activity corresponding to MST-312；
The number of telomere enzyme extract is 20000.What error bar indicated is the standard deviation of three repeated experiments.Fig. 6:
The corresponding fluorescence intensity figure of different tumour cells；
Experimental subjects is respectively control group, 20000 A549 cells, the A549 cells of 20000 inactivations, and 20000
Hela cell, the corresponding fluorescence intensity of 20000 MCF-7 cells.What error bar indicated is the standard deviation of three repeated experiments.
Specific embodiment
It is noted that following detailed description is all illustrative, it is intended to provide further instruction to the application.Unless another
It indicates, all technical and scientific terms used herein has usual with the application person of an ordinary skill in the technical field
The identical meanings of understanding.
It should be noted that term used herein above is merely to describe specific embodiment, and be not intended to restricted root
According to the illustrative embodiments of the application.As used herein, unless the context clearly indicates otherwise, otherwise singular
Also it is intended to include plural form, additionally, it should be understood that, when in the present specification using term "comprising" and/or " packet
Include " when, indicate existing characteristics, step, operation, device, component and/or their combination.
As background technique is introduced, in the prior art not yet exploitation using 2-aminopurine fluorescence probe as molecule
The method that beacon detects telomerase activation, in order to solve technical problem as above, present applicant proposes a kind of based on without being quenched
The method of molecular beacons detection cancer cell Telomerase Activity.
As shown in Figure 1, the technical program devises 2-AP molecular beacon (2-AP MB) probe for Telomerase activity.
The ring of 2-AP MB and 3 ' end shank respectively with telomerase product and Primers complementary.T7 excision enzyme is a kind of toolenzyme, by urging
The double-stranded DNA degradation for changing the direction 5' to 3', discharges 2-AP from 2-AP MB.In the case where Telomerase missing, since there are single-stranded
5' protruding terminus, 2-AP MB will not be degraded by T7 excision enzyme.Therefore, 2-AP is still contained in the double-strand handle region of 2-AP MB
Domain, and effectively quenched by adjacent base.On the contrary, the presence of target Telomerase can be catalyzed telomeric repetitive unit (TTAGGG)
N is added to the end 3' of telomerase substrate chain, generates the duplicate telomerase extended products of telomere.It is calculated by NUPACK software,
2-AP MB/ telomerase product/primer triple hydridization specific ionizations 2-AP MB (- 6.80kcal/mol) free energy it is low (-
34.46kcal/mol).Therefore, Telomerase amplified production tends to that loop-stem structure is unfolded in conjunction with 2-AP MB, to make primer
It is annealed to 2-AP MB, forms 2-AP MB/ Telomerase amplified production/triple heterozygotes of primer.As (KF is poly- for Large fragment polymerase
Synthase, 3' → 5'exo-) it is added, primer extends (i.e. 2-AP MB) along template and forms double-strand, to replace the extension of Telomerase
Product.The telomerase extended products of release can trigger the new polymerization reaction period in conjunction with other 2-AP MB, generate big
The double-strand of amount.Meanwhile the chain of 2-AP MB can be by T7 exonuclease degradation in double-strand, and primer extension chain is due in primer
The end 5' phosphorylation modification and retain.As a result, free 2-AP molecule and primer extension chain is all released.Free primer extend
Chain can form new double-strand in conjunction with other 2-AP MB, cause next round T7 excision enzyme degradation reaction.Obviously, each
Telomerase can trigger multiple polymerization cycle, generate a large amount of double-strand, and each double-strand can cause multiple degradation cycle.Cause
This, constructs secondary singal amplification system, the free 2-AP molecule that can largely have hyperfluorescence to emit with quick release, and is easy to
Sepectrophotofluorometer is monitored.
As shown in Fig. 2, the presence of target Telomerase, which can be catalyzed telomeric repetitive unit (TTAGGG) n, is added to Telomerase bottom
The end 3' of object chain generates the duplicate telomerase extended products of telomere, induces the generation of telomerase activating polymerization/degradation reaction, from
And discharging the 2-APs with fluorescence signal is key point.In order to confirm that this point, the present invention will be gathered with SYBR Gold coloring agent
It closes and catabolite dyes, and analyzed by 12% native polyacrylamide gel electrophoresis (PAGE).As shown in Fig. 2, being added 1
μ L telomere enzyme extract is equivalent to 20000 A549 cells, and the presence of telomere enzyme extract and KF polymerase can generate significantly
Chain band (Fig. 2A, swimming lane 2) shows the generation of Telomerase initiated polymerization.With the addition (figure of T7 exonuclease
2A, swimming lane 4), when Telomerase+KF polymerase combines, the band intensity of double-strand reduces (Fig. 2A, swimming lane 2) and shows 2-AP in double-strand
MB is degraded by T7 exonuclease.On the contrary, either independent KF polymerase (Fig. 2A, swimming lane 1) is also lacking telomere enzyme extract
It is the appearance for the chain band that KF polymerase+T7 exonuclease (Fig. 2A, swimming lane 3) cannot all induce, only free 2-
When the telomerase substrate of AP MB sum is observed (the too short gel of primer strand), show not reacting hair when lacking Telomerase
It is raw.
In order to verify feasibility of the technical program for fluorescence detection telomerase activation, present invention measurement is in presence and not
There are the fluorescence emission spectrums of 2-AP when Telomerase.As shown in Figure 2 B, when there are telomere enzyme extract, than telomere is not present
High 3.3 times of the fluorescence intensity of control group when enzyme or more (Control).These results clearly show that method proposed by the present invention
It can be used for the activity of efficiently detection of alkaline phosphatase.
As shown in figure 3, the present invention is under optimum experimental condition in order to assess the sensitivity of the technical program detection Telomerase
Probe into fluorescence intensity corresponding to the A549 cell of different numbers.Fig. 3 A is that the A549 cell of different numbers is thin at 0 to 10000
Corresponding fluorescence emission spectrum in the range of born of the same parents, number of cells successively increases curve from bottom to top in figure.The fluorescence of 365 nanometers
Intensity gradually increases (Fig. 3 A) with the increase of number of cells.Fluorescence intensity and A549 number of cells range from 0 to 10000
It is interior that good linear relationship (Fig. 3 B) is presented.Regression equation is F=135.98+86.23log10N, related coefficient (R2) be
0.997, wherein F is the fluorescence intensity of 365 nanometers, and N is A549 cell number.According to 3 σ/K method, detection limit (LOD) is calculated
For 1 A549 cell, wherein σ is the standard deviation (SD) of control group, and K is the slope of linear regression curves.It is worth noting that,
The sensitivity of this method is substantially better than the measuring method of the Telomerase of most of reports.This test can be in traditional analysis side TRAP
It is operated under the isothermy for not having thermal cycle to participate in method；Since accumulation interaction influences, 2-AP effectively quenches in 2-AP MB
Fire does not need any additional quencher；Compared with organic dyestuff fluorescent inspection method is used in the past, 2-AP has better light steady
Qualitative and longer service life, preferably raising operational capacity；This method does not need to consume functional nanomaterials and electrode
When synthesis and modification.This hypersensitivity is attributable to following: (1) in the case where no target Telomerase, containing low
The 2-AP of background signal, the presence of (2) Telomerase can promote target specificity secondary singal to amplify, and discharge a large amount of free 2-
AP molecule enhances fluorescence signal.This is enough the height for illustrating the detection sensitivity of the technical program.
As shown in figure 4, in order to assess the specificity of the technical program, the present invention with HhaI restriction enzyme (HhaI, 5
A every liter of unit), CpG transmethylase (M.SssI, 5 every liter of units), carbonamidine yl pyrimidines [fapy]-DNA glycosyl enzyme (FpG,
5 every liter of units) and bovine serum albumin(BSA) (BSA, 10 milligrams per liter) as negative control carry out specificity experiments.HhaI can be identified
Residue GCGC ... 3' chain on C and G between and is cut in 5' ....M.SssI can be specifically in methylated CpG sequences
All cytosine residues.FpG removes impaired purine from double-stranded DNA.Bovine serum albumin(BSA) is a kind of common albumen.Reason
By upper, these interference not can induce the extension of telomerase substrate, therefore polymerization and degradation reaction will not occur, and can not detect
To 2-AP fluorescence signal.As shown in figure 4, only can just be detected when Telomerase extractive content reaches 20000A549 cell
High fluorescence signal.On the contrary, the interference albumen more than being added, is only capable of generating low-down fluorescence signal, add with no any albumen
The control group (Control) entered is compared, and fluorescence intensity does not have significant change, it is indicated above that the technical program has high special
Property, target Telomerase albumen uncorrelated with other can be distinguished.
As shown in figure 5, in order to detect the inhibitor that can the technical program be used to detect Telomerase, the present invention uses N, N '
1,3-phenylenebis- (2,3-dihydroxy-benzamide) (MST-312) is used as inhibitor, and MST-312 is a kind of competing
The telomerase inhibitor of striving property effectively inhibits the activity of Telomerase by the active site with enzyme.The phase of Telomerase
Active (RA) is measured in accordance with the following methods:
RA (100%)=(Fi-F0)/(Ft-F0) × 100%
Wherein F0It is the fluorescence intensity in no telomere enzyme extract, FtIt is that there are fluorescence when telomere enzyme extract is strong
Degree, FiIt is telomere enzyme extract and fluorescence intensity when inhibitor MST-312 is existed simultaneously.It micro- rubs as concentration increases to 3 from 0
You have every liter, and the relative activity of Telomerase significantly reduces.503nhibiting concentration (the IC50, i.e., by Telomerase of MST-312 is calculated
Inhibitor concentration needed for activity reduces by 50%) it is 0.62 every liter of micromole.It is worth noting that, IC 50 is a relative value,
Its value changes with the variation of different substrate type and concentration of substrate, therefore it is not the inhibitor work of the different substrates of comparison
Suitable parameters.These results clearly show that detection method proposed by the present invention has very the inhibition detection of Telomerase
High reliability and accuracy has huge potentiality in the screening of inhibitor medicaments.
As shown in fig. 6, in order to probe into detection of the technical program to actual sample, present invention measurement is thin from human breast carcinoma
The activity of the Telomerase of both different cell lines of born of the same parents (MCF-7) and human cervical carcinoma (HeLa) cell.As shown, appointing with nothing
The low background signal of the control group (Control) of what cell extract is compared, and mentioning from MCF-7 cell and HeLa cell is added
When taking object, it is able to detect that the fluorescence signal being remarkably reinforced.It is obvious that the fluorescence signal ratio MCF-7 of HeLa cell extract is thin
The fluorescence signal of born of the same parents' extract is 1.6 times high, illustrates that expression of the Telomerase in different type cell line is different, this with before
The result of report is consistent, and therefore, the method proposed can be used for distinguishing the expression of the Telomerase between cancer cell and non-cancerous cells.
Although it is worth noting that, it has been reported that many methods are used to detect telomerase activation in living cells, institute of the present invention
The method of proposition is the method for quantitative detection telomerase activation for the first time, and detects and limit extremely low (1 cell).These results indicate that
The technical program can pin-point accuracy and delicately detect cancer cell in endogenous telomerase activity.
In order to enable those skilled in the art can clearly understand the technical solution of the application, below with reference to tool
The technical solution of the application is described in detail in the embodiment and comparative example of body.
Embodiment 1
1) extraction of Telomerase, Human Lung Cancer cell strain (A549 cell), human cervical cancer cell line's (HeLa cell) and
Human breast gland cell system (MCF-7 cell) in comprising 10% fetal calf serum and 1% glutamine DMEM culture medium with 50U/
ML penicillin and 50mg/mL streptomysin are cultivated in containing 5% carbon dioxide, 37 DEG C of suitable moist environment；Cell phosphoric acid
After buffer salt (pH 7.4) cleaning twice, cell is digested from culture dish bottom with trypsase, and by the cell of collection
It is centrifuged 10 minutes for 4 DEG C on 2000rpm centrifuge.About 1 × 106A cell is molten with the ice-cold 1 × CHAPS cracking buffering of 200 μ L
Liquid is resuspended, and hatches 30 minutes on ice, is followed by centrifuged 20 minutes in 4 DEG C, 12000g.After centrifugation, the fast quickly cooling of supernatant is removed
Freeze and is stored in -80 DEG C of refrigerators.The control of Grape berry, active cell extract is in 85 DEG C of heating and surveys for 10 minutes in advance
Amount；
2) 1 μM of single-stranded 2-AP MB annealing buffer is annealed 5 minutes at 95 DEG C, is followed by slowly cooled to room temperature shape
At hairpin structure, and -20 DEG C are stored it in further use；
3) 20 μ L reaction systems of Telomerase experiment reaction include 1 μ L cell extract, 200nM telomerase substrate and 2 μ L
NEBuffer 2 is incubated for 30 minutes at 37 DEG C makes telomere extend to obtain mixture A.Then 200nM 2-AP MB, 200nM primer,
500 μM of dNTP, 1U KF polymerase and 10U T7 exonuclease are added in reaction solution, are reacted 60 minutes at 37 DEG C
To mixture B, inactivated 15 minutes at 80 DEG C.
4) fluorescence measurement is carried out to sample.F-7000 fluorescence spectrophotometer of the fluorescence spectrum equipped with xenon lamp as excitation light source
Photometer measures at room temperature.With 340 nanometers of excitation wavelength, fluorescence spectrum is recorded in the range of 350-550nm.Excitation and
Transmite slit is respectively set as 5.0 and 5.0nm.Analysis of experimental data is carried out using the fluorescence intensity at 365nm, as shown in Figure 2.
The composition of 1 × CHAPS cracking buffer solution are as follows: 10mM Tris-HCl, pH 7.5,1mM MgCl2, 1mM
[ethylenebis (oxyethylenenitrilo)] tetraacetic acid, 0.1mM benzenecarboximidamide, 5mM β-
Mercaptoethanol, 0.5%3- (3-cholamidopropyl)-dimethylammonio propanesulfonate,
10% glycerol)
Tris-HCl, MgCl2, ethylenebis (oxyethylenenitrilo) tetraacetic acid, benzene first
Amidine, β-mercaptoethanol, 0.5%3- [(3-cholamidopropyl)-dimethylammonio]
Propanesulfonate, the volume ratio of 10% glycerol are (1000 μ L, 100 μ L, 100 μ L, 10 μ L, 500 μ L, 0.5 μ L).
The composition of NEBuffer 2 are as follows: NaCl 500mM, 100mM Tris-HCl, 100mM MgCl2, 10mM DTT,
pH7.9；Sodium chloride, Tris-HCl, magnesium chloride, dithiothreitol (DTT) volume be respectively (50 μ L, 10 μ L, 1 μ L)
The preparation of dsRNA substrate stock solution:
Oligonucleotides is diluted with 10 × trishydroxymethylaminomethane-ethylenediamine tetra-acetic acid (Tris-EDTA) buffer and is made
Standby stock solution.The 2-AP MB double-strand of 1 μm of ol/L is incubated for 5 minutes in annealing buffer in 95 DEG C, then slowly cools to room
Temperature.The dsRNA substrate of formation is stored in 4 DEG C of uses.
The composition of 1 × annealing buffer are as follows: 10mM Tris-HCl, pH 8.0,50mM NaCl, 10mM MgCl2。
Tris-HCl, sodium chloride, magnesium chloride volume be respectively 0.1 μ L, 5 μ L, 0.1 μ L.
Embodiment 1 is a citing of the application method, and detecting and examine below is all on the basis of embodiment 1, in fact
The telomere enzyme extract for applying example 1 is equivalent to 20000 A549 cells, and gel electrophoresis, inhibitor test, dynamic analysis is all real
The result that example 1 obtains is applied to be tested.
Gel electrophoresis:
The product that 1 step 3) of embodiment is obtained is with 12% non-denaturing polyacrylamide gel (PAGE) in 1 × tbe buffer
Liquid (trishydroxymethylaminomethane-hydrochloric acid (Tris-HCl) of the pH 7.9 of 9mmol/L, the boric acid of 9mmol/L, 0.2mmol/L's
Ethylenediamine tetra-acetic acid) in, electrophoretic analysis is carried out under 110V constant voltage.Gel is imaged by Bio-Rad ChemiDoc MP
System (Hercules, CA) imaging.
Inhibitor test:
In order to detect the effect of telomerase inhibitor, after MST-312 and A549 the cell incubation 48h of various concentration, collect
Cell carries out Telomerase activity.It tests identical as the detection mode of above-mentioned detection Telomerase.The relative activity (RA) of Telomerase is pressed
It is measured according to following methods:
RA (100%)=(Fi-F0)/(Ft-F0) × 100%
Wherein F0It is the fluorescence intensity in no telomere enzyme extract, FtIt is that there are fluorescence when telomere enzyme extract is strong
Degree, FiIt is telomere enzyme extract and fluorescence intensity when MST-312 is existed simultaneously.According to relative activity (RA)-vanadic acid na concn
Curve calculate 503nhibiting concentration (IC50) value.As a result as shown in Figure 5.
In the detection of human embryo kidney 293 cells (HEK) and human cervical carcinoma (HeLa) cell telomerase:
Certain density Telomerase in 1 step 1) of embodiment is substituted for human breast cancer cell (MCF-7) and people uterus
The extract of neck cancer (HeLa) cell, other steps are identical.
The preparation method of cell culture and cell extract:
Human Lung Cancer cell strain (A549 cell), human cervical cancer cell line's (HeLa cell) and human breast adenocarcinoma cell
It is (MCF-7 cell) in Dulbecco's improvement Iger training containing 10% fetal calf serum (FBS) and 1% Pen .- Strep
It supports in base (DMEM), is cultivated in the incubator containing 5% carbon dioxide in 37 DEG C.Cell quantity is thin by Count star
Born of the same parents' counter measures.Cell is collected with trypsin digestion, is washed twice afterwards with ice-cold phosphate buffer solution (pH 7.4),
It is centrifuged 5 minutes in 1000rpm.Then cell is suspended in lysis buffer (the three hydroxyl first of the pH 8.0 of 10mmol/L of 100 μ L
Base aminomethane-hydrochloric acid (Tris-HCl), the sodium chloride of 150mmol/L, 1% Nonidet P40 (NP-40),
The NaTDC of 0.25mmol/L, 1.0% glycerol and 4- (2- amine ethyl) benzene sulfonyl fluorine hydrochloride of 0.1mmol/L) in,
It is incubated for 30 minutes, is then centrifuged 20 minutes at 4 DEG C in 12000rpm on ice.Supernatant is transferred in new centrifuge tube, is protected
In the presence of -80 DEG C.
The foregoing is merely preferred embodiment of the present application, are not intended to limit this application, for the skill of this field
For art personnel, various changes and changes are possible in this application.Within the spirit and principles of this application, made any to repair
Change, equivalent replacement, improvement etc., should be included within the scope of protection of this application.
SEQUENCE LISTING
<110>Shandong Normal University
<120>a kind of method based on no quenching molecules beacon detection telomerase activation
<130> 2010
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 42
<212> DNA
<213>artificial sequence
<400> 1
taacactgtc tggtaaagat ggccctatag tgagtcgtat ta 42
<210> 2
<211> 44
<212> DNA
<213>artificial sequence
<400> 2
aagctgaggt cttggcaccc taaccctaac cctaatgtcc aaga 44
<210> 3
<211> 18
<212> DNA
<213>artificial sequence
<400> 3
aatccgtcga gcagagtt 18
<210> 4
<211> 8
<212> DNA
<213>artificial sequence
<400> 4
tcttggac 8
Claims (10)
1. a kind of no quencher molecule beacon fluorescence probe, which is characterized in that the fluorescence probe is 2-aminopurine fluorescence probe,
The full length sequence of the fluorescence probe are as follows:
5'-AAGCTGAGGTCTTGG(2-AP)CACCCTAACCCTAACCCTAATGTCCAAGA-3'。
2. a kind of detection kit based on no quencher molecule beacon detection telomerase activation, which is characterized in that the detection examination
Agent box includes 2-aminopurine fluorescence probe, telomerase substrate, primer, KF polymerase, T7 exonuclease and dNTP, the 2-
The sequence of adenine phosphate fluorescence probe are as follows:
5'-AAGCTGAGGTCTTGG(2-AP)CACCCTAACCCTAACCCTAATGTCCAAGA-3'；
The sequence of the telomerase substrate are as follows: 5'-AATCCGTCGAGCAGAGTT-3'；
The primer sequence are as follows: 5'-T*C*T*TGGAC-3', wherein * represents thio-modification；
It preferably, further include buffer in the detection kit；It is further preferred that the buffer includes cell cracking buffering
Liquid, annealing buffer, NEBuffer 2 and Tris-EDTA buffer.
3. a kind of method based on no quencher molecule beacon detection telomerase activation, which is characterized in that by enzyme extract, Telomerase
Substrate mixing, which is incubated for, obtains mixture A, and 2-APMB fluorescence probe, primer, dNTP, KF polymerase and T7 are added into mixture A
Exonuclease is incubated for obtain mixture B, and detects the fluorescence signal intensity of mixture.
4. method as claimed in claim 3, which is characterized in that the method comprises the following steps:
1) extraction of Telomerase: cracking cancer cell under certain condition, obtains cell extract；
2) 2-APMB is pre-processed: annealing single-stranded 2-APMB to form hairpin structure；
3) Telomerase experiment reaction: being incubated for after cell extract, telomerase substrate and buffer are mixed, and obtains Telomerase extension
Mixture A；Mixture A is added in the 2-APMB prepared in step 2), primer, dNTP, KF polymerase and T7 exonuclease
Middle reaction a period of time obtains mixture B；
4) fluorescence detection: the sepectrophotofluorometer using xenon lamp as excitation light source at room temperature examines mixture B
It surveys.
5. method as claimed in claim 4, which is characterized in that clean cancer cell using phosphate buffer in step 1)
Afterwards, it is collected after trypsin digestion, lysis buffer hatching is added into the cell that collection obtains and prepares cancer cell extract；
Preferably, A549 cell, HeLa cell, MCF-7 cell are cultivated in suitable environment, cell phosphate-buffered salt (pH
7.4) cleaning twice after, cell is digested from culture dish bottom with trypsase, and by the cell of collection 2000rpm from
4 DEG C centrifugation 5-20 minutes in scheming, 1 × 106A cell is resuspended with the cold 1 × CHAPS cracking buffer solution of 200 μ L, on ice
Hatching 20-40 minutes is centrifuged 10-30 minutes in 4 DEG C, 12000rpm after the completion of incubation and obtains cell extract；Further preferably
, the composition that 1 × CHAPS cracks buffer solution includes: 10mM Tris-HCl, pH 7.5,1mM MgCl2, 1mM
[ethylenebis (oxyethylenenitrilo)] tetraacetic acid, 0.1mM benzenecarboximidamide, 5mM β-
Mercaptoethanol, 3-0.5% (3-cholamidopropyl)-dimethylammonio propanesulfonate,
10% glycerol, still more preferably, volume ratio 10000:1000:1000:100:5000:5:100.
6. method as claimed in claim 4, which is characterized in that 2-APMB single-stranded sequence in step 2) are as follows: 5'-
AAGCTGAGGTCTTGG(2-AP)CACCCTAACCCTAACCCTAATGTCCAAGA-3'。
7. method as claimed in claim 4, which is characterized in that single-stranded 2-APMB is at 90-100 DEG C of annealing 5-10 points in step 2)
Clock；Preferably, 1 × annealing buffer is added in 10 μM of single-stranded 2-AP MB；It is further preferred that the group of the annealing buffer becomes
10mM Tris-HCl, pH 8.0,50mM NaCl, 10mM MgCl2。
8. method as claimed in claim 4, which is characterized in that step 3) concrete operations are as follows: the cell that step 1) is obtained
Extract, telomerase substrate and 10 × NEBuffer 2 make telomere extend to obtain mixture A in incubation 20-40 minutes at 30-40 DEG C；
2-APMB, primer, dNTP, KF polymerase, the T7 exonuclease that step 2) is prepared are added in mixture A, at 30-40 DEG C
Reaction obtains mixture B in 30-90 minutes, 70-85 DEG C inactivation 10-20 minutes；Preferably, 20 μ L reaction systems include 1 μ L thin
Born of the same parents' extract, 200nM telomerase substrate and 2 10 × NEBuffer of μ L 2, are added 200nM 2- after obtaining mixture A accordingly
AP MB, 200nM primer, 500 μM of dNTP, 1U KF polymerase and 10U T7 exonuclease；It is further preferred that
The composition of NEBuffer 2 are as follows: NaCl 500mM, 100mM Tris-HCl, 100mM MgCl2, 10mM DTT, pH7.9；It is preferred that
, telomerase substrate sequence are as follows: 5'-AATCCGTCGAGCAGAGTT-3'；Primer sequence are as follows: 5'-T*C*T*TGGAC-3',
Middle * represents thio-modification.
9. method as claimed in claim 4, which is characterized in that the excitation wave of sepectrophotofluorometer 340nm in step 4)
It is long, fluorescence spectrum is recorded in the range of 350-550nm, excitation and transmite slit are respectively set as 5.0 and 5.0nm；Preferably,
The sepectrophotofluorometer is F-7000 sepectrophotofluorometer.
10. detection kit described in fluorescence probe, claim 2 described in claim 1 is in test sample Telomerase Activity side
The application of the non-diagnostic therapeutic purposes in face；Preferably, the sample is cancer cell extract；Preferably, the detection Telomerase is living
Property aspect diagnoses and treatment purpose application include detection telomerase inhibitor activity aspect application or screening Telomerase it is related
Application in terms of drug target.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811168723.7A CN109266721B (en) | 2018-10-08 | 2018-10-08 | Method for detecting telomerase activity based on non-quenching molecular beacon |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811168723.7A CN109266721B (en) | 2018-10-08 | 2018-10-08 | Method for detecting telomerase activity based on non-quenching molecular beacon |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109266721A true CN109266721A (en) | 2019-01-25 |
| CN109266721B CN109266721B (en) | 2021-11-09 |
Family
ID=65195988
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811168723.7A Active CN109266721B (en) | 2018-10-08 | 2018-10-08 | Method for detecting telomerase activity based on non-quenching molecular beacon |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109266721B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109797200A (en) * | 2019-02-13 | 2019-05-24 | 中国科学院苏州生物医学工程技术研究所 | Ratio-type telomere enzyme active quantitive detection method |
| CN110243905A (en) * | 2019-06-12 | 2019-09-17 | 南京市第二医院 | It is a kind of for detecting the electrochemical sensor and its detection method of telomerase activation |
| CN113201579A (en) * | 2021-05-20 | 2021-08-03 | 山东大学 | Telomerase detection system, telomerase detection method and telomerase detection kit for targeting tumors |
| CN113774112A (en) * | 2021-08-19 | 2021-12-10 | 青岛科技大学 | Method for detecting telomerase activity |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102690886A (en) * | 2012-06-12 | 2012-09-26 | 云南路易斯中药现代化工程技术研究中心 | Kit for rapidly detecting telomerase activity and application of kit |
| CN106755284A (en) * | 2016-11-28 | 2017-05-31 | 山东大学 | It is a kind of based on the cascade DNA amplification machine of label-free molecular beacon and application |
| CN107881218A (en) * | 2017-11-23 | 2018-04-06 | 中国科学院合肥物质科学研究院 | A kind of spherical nucleic acid fluorescent probe for telomerase activation detection and its production and use |
| CN108359716A (en) * | 2018-02-26 | 2018-08-03 | 山东师范大学 | A kind of activity test method of telomerase based on primer generation type rolling circle amplification |
-
2018
- 2018-10-08 CN CN201811168723.7A patent/CN109266721B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102690886A (en) * | 2012-06-12 | 2012-09-26 | 云南路易斯中药现代化工程技术研究中心 | Kit for rapidly detecting telomerase activity and application of kit |
| CN106755284A (en) * | 2016-11-28 | 2017-05-31 | 山东大学 | It is a kind of based on the cascade DNA amplification machine of label-free molecular beacon and application |
| CN107881218A (en) * | 2017-11-23 | 2018-04-06 | 中国科学院合肥物质科学研究院 | A kind of spherical nucleic acid fluorescent probe for telomerase activation detection and its production and use |
| CN108359716A (en) * | 2018-02-26 | 2018-08-03 | 山东师范大学 | A kind of activity test method of telomerase based on primer generation type rolling circle amplification |
Non-Patent Citations (4)
| Title |
|---|
| DEMING KONG ET AL: "Real-time PCR detection of telomerase activity using specific molecular beacon probes", 《ANAL BIOANAL CHEM》 * |
| RUOCAN QIAN ET AL: "A Robust Probe for Lighting Up Intracellular Telomerase via Primer Extension To Open a Nicked Molecular Beacon", 《JACS》 * |
| 张慧娟等: "以2-氨基嘌呤为荧光探针研究双链DNA分子内电荷传递机理", 《中国科学 B辑 化学》 * |
| 黄艳萍: "分子信标技术实时定量检测端粒酶活性的研究", 《万方》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109797200A (en) * | 2019-02-13 | 2019-05-24 | 中国科学院苏州生物医学工程技术研究所 | Ratio-type telomere enzyme active quantitive detection method |
| CN109797200B (en) * | 2019-02-13 | 2022-07-19 | 中国科学院苏州生物医学工程技术研究所 | Ratio type telomerase activity quantitative detection method |
| CN110243905A (en) * | 2019-06-12 | 2019-09-17 | 南京市第二医院 | It is a kind of for detecting the electrochemical sensor and its detection method of telomerase activation |
| CN110243905B (en) * | 2019-06-12 | 2021-08-17 | 南京市第二医院 | Electrochemical sensor for detecting telomerase activity and detection method thereof |
| CN113201579A (en) * | 2021-05-20 | 2021-08-03 | 山东大学 | Telomerase detection system, telomerase detection method and telomerase detection kit for targeting tumors |
| CN113774112A (en) * | 2021-08-19 | 2021-12-10 | 青岛科技大学 | Method for detecting telomerase activity |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109266721B (en) | 2021-11-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hu et al. | Simultaneous sensitive detection of multiple DNA glycosylases from lung cancer cells at the single-molecule level | |
| Ou et al. | Simultaneous detection of telomerase and miRNA with graphene oxide-based fluorescent aptasensor in living cells and tissue samples | |
| CN108588178B (en) | Kit and method for detecting alkaline phosphatase | |
| CN109266721A (en) | A method of telomerase activation is detected based on no quenching molecules beacon | |
| CN105018603B (en) | A kind of application based on the concatenated constant temperature index amplifying technique of triple iodines and its in microRNA detections | |
| CN103987846B (en) | A kind of double-strandednucleic acid and its application in ribalgilase detection and kit | |
| CN108088826A (en) | A kind of detection uracil-DNA glycosylase（UDG）Biological sensor | |
| CN109161579A (en) | Constant-temperature amplification method based on ligase and its application in polynucleotide kinase detection | |
| CN107151694A (en) | The Cascaded amplification strategy of ring mediation is used for highly sensitive detection dnmt rna activity | |
| CN113088557B (en) | Fluorescent chemical sensor for simultaneously detecting multiple DNA glycosylases and detection method and application thereof | |
| KR20150041148A (en) | Test composition for screening cancers | |
| Li et al. | A single quantum dot-based nanosensor with multilayer of multiple acceptors for ultrasensitive detection of human alkyladenine DNA glycosylase | |
| Li et al. | Intracellular CircRNA imaging and signal amplification strategy based on the graphene oxide-DNA system | |
| Ma et al. | Ultrasensitive detection of telomerase activity in lung cancer cells with quencher-free molecular beacon-assisted quadratic signal amplification | |
| Liu et al. | Hairpin/DNA ring ternary probes for highly sensitive detection and selective discrimination of microRNA among family members | |
| CN109161583A (en) | The method for the cycle index augmentation detection alkaline phosphatase that primer dephosphorylation causes | |
| Liu et al. | Quantitative Detection of miRNA‐21 Expression in Tumor Cells and Tissues Based on Molecular Beacon | |
| Wang et al. | Primer dephosphorylation-initiated circular exponential amplification for ultrasensitive detection of alkaline phosphatase | |
| Yang et al. | Sensitive detection of telomerase activity in cells using a DNA-based fluorescence resonance energy transfer nanoprobe | |
| Wang et al. | Target-mediated hyperbranched amplification for sensitive detection of human alkyladenine DNA glycosylase from HeLa cells | |
| Chen et al. | An ultrasensitive and point-of-care sensor for the telomerase activity detection | |
| Zhang et al. | Detection of DNA 3'-phosphatase activity based on exonuclease III-assisted cascade recycling amplification reaction | |
| Wang et al. | Aptamer based fluorescence biosensor for protein kinase activity detection and inhibitor screening | |
| Zhang et al. | Combination of bidirectional strand displacement amplification with single-molecule detection for multiplexed DNA glycosylases assay | |
| CN108359716A (en) | A kind of activity test method of telomerase based on primer generation type rolling circle amplification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |