CN109251867A - A kind of acid protease superior strain and its application - Google Patents
A kind of acid protease superior strain and its application Download PDFInfo
- Publication number
- CN109251867A CN109251867A CN201810793554.XA CN201810793554A CN109251867A CN 109251867 A CN109251867 A CN 109251867A CN 201810793554 A CN201810793554 A CN 201810793554A CN 109251867 A CN109251867 A CN 109251867A
- Authority
- CN
- China
- Prior art keywords
- acid protease
- trichoderma reesei
- asp
- ser
- gly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/58—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The present invention relates to a kind of trichoderma reesei mutant strain, deposit number is CCTCC NO:M2018390.The mutant strain is obtained by taking turns Uv-induced screening more, the yield of acid protease can be increased substantially, 20L tank ferments after 160h, acid protease enzyme activity is up to 51352u/ml in the mutant strain fermented supernatant fluid, 36% is improved than going out bacterium germination, unexpected technical results have been achieved.The Li's Trichoderma strains can be widely applied to the production of acid protease, to advantageously reduce the production cost of acid protease, promote its popularization and application in the fields such as alcohol processing and feed.
Description
Technical field
The present invention relates to gene engineering technology field, particular content is related to a kind of acid protease superior strain and its answers
With.
Background technique
Acid protease is the aspartic protease that a kind of Optimun pH is 2.5~5.0, and relative molecular mass is
30 000~40 000, isoelectric point is 3.0~5.0, can be widely applied to food, feed processing and medicine and other fields.It is acid
Protease plays an important role in brewed spirit.When producing white wine as raw material using corn, addition is certain in fermentation process
The acid protease of amount makes the protein degradation in raw material, while destroying raw cell wall construction, is conducive to the benefit of carbohydrase
With；Increase sugared content in raw material, is conducive to improve distillation yield.On the other hand, by the effect of acid protease, in raw material
Organic nitrogen content also increases, and is conducive to the growth and breeding of yeast, to be conducive to the liquor-producing ability of saccharomycete, when shortening fermentation
Between, reduce cost.In addition, addition acid protease can also increase the fragrance of white wine, acyclic acidic of the acid protease in wine brewing
Under border, the protein in raw material is hydrolyzed into amino acid, amino acid is further converted into the objects such as alcohol, ester, phenol under the action of enzyme
Matter makes white wine have distinctive distilled spirit fragrance.
In addition, industrial scale cultivates beasts, birds and aquatic products, the especially childhood in cultivation raises animal, because of its digestive organs point
The enzyme system and enzyme amount (endogenous enzymes) secreted are insufficient, poor to feed protein digestion power, easily cause indigestion, diarrhea and disappear
The diseases such as thin.It has been investigated that being conducive to improve the digestibility of protein by adding acid protease in feed, make egg
White matter is degraded into the amino acid and polypeptide digested and assimilated conducive to growing animal, to be conducive to the growth and development of animal, shortening is educated
The fertile time.
At present acid protease mostly derive from microorganism, also have in animal and plant it is many.Produce the micro- of acid protease
Biology mainly have aspergillus niger, aspergillus oryzae, saitox aspergillus, aspergillus awamori, Aspergillus usamii, Mucor pusillus, mould, head mold etc. with
And their variant, mutant strain.In addition, as saccharomyces cerevisiae, Candida albicans, button capsule cover in middle rhizopus chinensis, terrestrial yeast
Also the secreting acidic protease such as film yeast.Compared with animal protease and plant rennet, one of microorganism acid protease
Distinguishing feature is with diversity and complexity, and usual one plant of bacterial strain can secrete one or more acid proteases.
China to the research of acid protease more relatively late.Shanghai Industrial institute of microbiology in 1970 is first from black song
One plant of production acid protease bacterial strain is filtered out in mould, and cooperates with Shanghai Alcohol Plant and carries out scale up test, has filled up China's acidity
The blank of protease preparation.It is high, degeneration-resistant to be devoted to greatly breeding producing enzyme vigor for the domestic research on acid protease in recent years
Property good strain, the acidic protein enzyme-producing bacteria being commercialized is mainly aspergillus niger, Aspergillus usamii and aspergillus oryzae etc. for number
Few bacterial strain.The yield of enzyme of the bacterial strain of acid protease production at present be not still it is very high, cause the production cost of the enzyme occupy it is high not
Under, the extensive use of acid protease is also limited to a certain extent.
Summary of the invention
The present invention is to solve prior art problem, provides a kind of trichoderma reesei of high yield acid protease
(Trichoderma reesei) bacterial strain.Applicant constructs first obtains the trichoderma reesei engineering bacteria of recombinant expression acid protease
Then strain obtains the mutant strain that one plant of acidic protein production of enzyme is significantly improved by the method screening of ultraviolet mutagenesis, can
It is widely used in the production of acid protease.
One aspect of the present invention provides a kind of trichoderma reesei engineered strain, and the bacterial strain carries expression acid protease base
The recombinant plasmid of cause.
The amino acid sequence of the acid protease is SEQ ID NO:1, and coding nucleotide sequence is SEQ ID NO:
2。
One aspect of the present invention provides a kind of mutant strain trichoderma reesei 4QA5 (Trichoderma reesei 4QA5),
It is preserved in the China typical culture collection center of Wuhan, China Wuhan University on June 21st, 2018, deposit number is
CCTCC NO:M2018390。
The present invention also provides application of the trichoderma reesei mutant strain in production acid protease.
The present invention will derive from the acid protease gene of aspergillus niger (Aspergillus niger) in trichoderma reesei
It is expressed in (Trichoderma reesei) host cell, building obtains the fermentation of recombinant bacterial strain trichoderma reesei 4Q-ASP, 20L tank
After 160h, acid protease enzyme activity reaches 37691u/ml in fermented supernatant fluid.Applicant is to set out with trichoderma reesei 4Q-ASP
Bacterial strain finally screens by taking turns ultraviolet mutagenesis more and obtains a plant mutant bacterium trichoderma reesei 4QA5, can increase substantially acidic protein
The expression quantity of enzyme, 20L tank ferment after 160h, and acid protease enzyme activity is up to 51352u/ml in fermented supernatant fluid, than going out bacterium germination
36% is improved, unexpected technical results have been achieved.The Li's Trichoderma strains can be widely applied to acid protease
Production promotes its popularization in the fields such as alcohol processing and feed to advantageously reduce the production cost of acid protease
With application.
Detailed description of the invention
Fig. 1 is plasmid pTG map；
Fig. 2 is 20L tank course of fermentation curve；
Fig. 3 is SDS-PAGE protein electrophoresis figure: wherein: M is molecular weight of albumen Marker, and swimming lane 1,2 is respectively mutant bacteria
Trichoderma reesei 4QA5, go out bacterium germination trichoderma reesei 4Q-ASP fermented supernatant fluid；Protein band at arrow meaning 42kDa is acidity
Protease.
Specific embodiment
The routine techniques and method that the present invention has used genetic engineering and molecular biology field uses, such as
MOLECULAR CLONING:A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENT
Documented method in PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003).These general bibliography
Provide definition well known by persons skilled in the art and method.But those skilled in the art can be recorded in the present invention
Technical solution on the basis of, using the other conventional methods in this field, experimental program and reagent, and be not limited to of the invention specific
The restriction of embodiment.
The present invention will be described in detail With reference to embodiment.
The clone of 1 acid protease gene of embodiment
Using aspergillus niger (Aspergillus niger) genome, as template, acid egg is amplified using primer 1 and primer 2
White enzyme gene segment, nucleotides sequence are classified as SEQ ID NO:2, and the amino acid sequence of coding is SEQ ID NO:1.
PCR primer and reaction condition are as follows:
Primer 1 (F): ATGGTCGTCTTCAGCAAAACC
Primer 2 (R): CTAAGCTTGAGCAGCGAAGCC
Reaction condition are as follows: 94 DEG C of denaturation 5min；Then 94 DEG C of denaturation 30s, 56 DEG C of renaturation 30s, 72 DEG C of extension 80s, 30
After circulation, 72 DEG C of heat preservation 10min.Agarose electrophoresis is the results show that the acid protease gene size that amplification obtains is 1339bp.
The building of 2 recombinant vector of embodiment
The above-mentioned acid protease gene of PCR amplification, primer both ends introduce the site XbaI.Primer sequence is as follows:
Primer 3 (F): GCTCTAGA ATGGTCGTCTTCAGCAAAACC
Primer 4 (R): GCTCTAGA CTAAGCTTGAGCAGCGAAGCC
PCR reaction condition are as follows: 94 DEG C of denaturation 5min；Then 94 DEG C of denaturation 30s, 56 DEG C of renaturation 30s, 72 DEG C of extension 80s, 30
After a circulation, 72 DEG C of heat preservation 10min.Agarose gel electrophoresis results show that acid protease gene is the piece of size 1339bp
Section.
It is mono- that the acid protease gene segment of above-mentioned acquisition and expression vector pTG are subjected to restriction enzyme XbaI respectively
Digestion, digestion condition are as follows:
37 DEG C of water-bath digestions handle 2h, and two target fragments are separately recovered after electrophoresis, are dissolved in 20ul ddH2O.Use T4DNA
Ligase is attached, and linked system is as follows:
22 DEG C of connection 1h convert escherichia coli DH5a competence, are coated with LB+AAP plate, grow list after 37 DEG C of overnight incubations
Bacterium colony, bacterium colony PCR verifying, which connects correct transformant, extracts plasmid and send sequencing, to get to containing acidic protein after sequencing correctly
The recombinant vector pTG-ASP of enzyme gene.
The building of 3 trichoderma reesei recombinant bacterial strain of embodiment
1, prepared by protoplast:
Being inoculated with host cell trichoderma reesei (Trichoderma reesei) 4Q, (potato 200g/L, boils in PDA+U
Filtering and removing slag after 20-30min；Glucose 2%；Uridine 1%；Agar powder 1.5%) plate, 30 DEG C of culture 5-7d；It extracts
The fungus block of 2cm × 2cm size, (potato 200g/L boils filtering and removing slag after 20-30min to inoculation 100ml liquid PDA+U；Portugal
Grape sugar 2%；Uridine 1%) in culture medium, 30 DEG C of culture 16h growth mycelium are for converting；The mycelium grown is filtered
Afterwards, it is resuspended with 20ml 1.2M Adlerika；0.2g lysozyme, 30 DEG C, 100rpm culture 2-3h is added；By cracked bacterium
Silk is filtered with 2 layers of lens wiping paper, and 3000rpm is centrifuged 10min and obtains protoplast；Cracked mycelia is filtered with lens wiping paper, from
The heart obtains protoplast；It is resuspended again with suitable sorbitol solution.
2, it converts:
The trichoderma reesei 4Q protoplast of above-mentioned acquisition is cleaned 2 times with 1.2M sorbitol solution, then with suitable sorb
Alcoholic solution is resuspended, and protoplast concentration is made to reach 108A/ml；It is ready heavy that 10ul is separately added into every 200ul protoplast
Group carrier pTG-ASP, is added PEG6000, the ice bath 20min of 50ul 25%, adds the PEG6000 of 2ml 25%, room temperature is put
Set 5min；4ml sorbitol solution is added to be mixed by inversion, after pouring into 50ml conversion upper layer culture medium, it is flat to pour into 4 conversion lower layers
In plate, after the solidification of upper layer culture medium, culture 5d is inverted in 30 DEG C of incubators.
3, transformant screening:
After cultivating 5d, the bacterium colony that picking is grown, dibbling carries out secondary screening, 30 DEG C of culture 3d to conversion lower layer's plate.It will be normal
The transformant of growth is inoculated into fresh PDA plate, 30 DEG C of culture 5-7d respectively.Each transformant extracts 2cm × 2cm size
Fungus block is inoculated with 50ml liquid submerged culture base (glucose 1% respectively；Lactose 2%；Corn pulp 1.5%；Ammonium sulfate 0.9%；Sulphur
Sour magnesium 0.15%；Citric acid 0.073%；Calcium chloride 0.1125%；Microelement 0.1%) in fermentation, 28 DEG C of culture 5d.Culture
After 5d, it is crude enzyme liquid that centrifugation thallus, which obtains supernatant, carries out the detection of SDS-PAGE protein electrophoresis and acid protease enzyme activity
Detection.
Acid protease activity in positive transformant fermented supernatant fluid is detected, the highest positive transformant of enzyme activity is filtered out,
It is named as trichoderma reesei 4Q-ASP (Trichoderma reesei 4Q-ASP), acid protease in shake flask fermentation supernatant
Enzyme activity reaches 3145u/ml.
4 mutagenesis screening of embodiment
Mutation randomness caused by ultraviolet mutagenesis is very strong, and it is also random for being mutated the effect of generation, it is difficult to be predicted.Therefore,
In order to obtain effective direct mutation, technical staff usually requires to carry out more wheel ultraviolet mutagenesis, the larger workload of screening, Er Qiecun
A possibility that can not obtain effective direct mutation.But because equipment needed for ultraviolet mutagenesis is simple, expense is few, and can be in the short time
Interior acquisition mass mutation body, therefore, it is still a kind of common mutagenic breeding method now.
Applicant carries out science of heredity transformation to it using trichoderma reesei 4Q-ASP as starting strain, by ultraviolet mutagenesis method,
Further increase the yield of its acid protease.
1, lethality is determined:
Starting strain trichoderma reesei 4Q-ASP is inoculated in PDA plate, 30 DEG C of culture 5-7d.A large amount of spores are generated to bacterium colony surface
The period of the day from 11 p.m. to 1 a.m draws the sterile water elution of 5ml, obtains spore liquid, is resuspended after centrifugation with sterile water, is counted with blood counting chamber.Take one
90mm culture dish, the spore suspension that 5ml has diluted is added, and (concentration is 1 × 107), rotor is added and is stirred on magnetic stirring apparatus
Spore liquid is set to be in uniform state.In aseptic superclean bench, the ultraviolet lamp for being 9w with power is in the upper of vertical range 20cm
Side's irradiation, irradiates 30s, 45s, 60s, 75s, 90s, 105s, 120s respectively, the spore liquid dilution 10,100,1000 after taking irradiation
Times, it takes 100ul to be coated with PDA plate, is counted after 30 DEG C of culture 2-3d, be control with non-irradiated spore liquid, calculate lethality.Its
When middle irradiation 90s, lethality 95% chooses the irradiation time and carries out subsequent Mutagenesis experiments.
2, first round mutagenesis screening:
A 90mm culture dish is taken, the spore suspension that 5ml has diluted is added, and (concentration is 1 × 107), rotor is added and in magnetic
Stirring makes spore liquid be in uniform state on power blender.In aseptic superclean bench, the ultraviolet lamp for being 9w with power is in vertical
The directly top irradiation of distance 20cm, dilutes 1000 times after irradiating 90s, 100ul is taken to be coated with PDA plate, 30 DEG C of culture 2-3d.
It is coated with 200 pieces of PDA plates altogether, after 30 DEG C of culture 2-3d, each plate grows 30-50 bacterium colony, first passes through bacterium colony
Form screens the mutant of short branch.Applicant's picking goes out that colonial morphology is smaller, mycelia is fine and close, periphery of bacterial colonies villus is shorter
Mutant bacteria is inoculated into PDA plate, 30 DEG C of culture 5-7d for totally 90 respectively.Each mutant bacteria extracts the fungus block of 2cm × 2cm size,
It is inoculated with 50ml liquid submerged culture base (glucose 1% respectively；Lactose 2%；Corn pulp 1.5%；Ammonium sulfate 0.9%；Magnesium sulfate
0.15%；Citric acid 0.073%；Calcium chloride 0.1125%；Microelement 0.1%) in fermentation, 28 DEG C of culture 5d.After cultivating 5d,
Being centrifuged thallus and obtaining supernatant is crude enzyme liquid, carries out protein electrophoresis detection and the detection of acid protease enzyme activity respectively.
The results show that in the 90 plant mutant bacterium that first round Uv-induced screening obtains, without a plant mutant bacterium fermentation supernatant
The enzyme activity of acid protease is higher than bacterium germination in liquid enzyme；Wherein, the enzyme activity and bacterium germination out of 53 plant mutant bacterium are substantially suitable, remaining 37
The enzyme activity of plant mutant bacterium even generally reduces 9-23% than going out bacterium germination.
Applicant has continued 6 wheel mutagenesis screenings according to the method described above, finally obtains 5 plants of acidic protein production of enzyme ratios and goes out
Bacterium germination raising is more than 30% mutant strain, is respectively designated as trichoderma reesei 4QA1,4QA2,4QA3,4QA4 and 4QA5.Wherein,
The enzyme activity highest of acid protease in trichoderma reesei 4QA5 shake flask fermentation supernatant reaches 5214u/ml, improves than going out bacterium germination
65%.
(1) definition of acid protease enzyme-activity unit
Under conditions of 40 DEG C, pH value are 3.0, caseinhydrolysate per minute generates the enzyme amount of the tyrosine of 1 μ g, is defined as
One enzyme activity unit U.
(2) enzyme activity determination method
Casein solution (10g/L): weighing casein 1.000g, and after being moistened with a small amount of lactic acid, the cream of appropriate pH3.0 is added
Sour sodium buffer about 80ml, heats while stirring in boiling water bath, boils 30min to being completely dissolved, after cooling, is transferred to 100ml
Constant volume in volumetric flask.
Enzyme solution: being diluted to suitable multiple with the sodium lactate buffer of pH3.0, controls light absorption value in 0.25-0.4 range.
The drafting of l-tyrosine standard curve: the l-tyrosine standard solution 0 of the 100ug/ml prepared respectively, 1,2,3,4,
5ml is settled to 10ml with water, as standard point solution.Above-mentioned standard point each 1ml of solution is taken, it is molten that 0.4mol/L sodium carbonate is added
Liquid 5ml, Folin reagent use liquid 1ml, and shaken well, develop the color in 40 DEG C of water-baths 20min, and taking-up spectrophotometer is in wavelength
680nm measures its absorbance using 0 pipe without tyrosine as blank respectively.Using absorbance A as ordinate, the concentration of tyrosine
C is abscissa, draws standard curve.According to mapping, the amount (ug) of the tyrosine when absorbance is 1 is calculated, as extinction is normal
Number K value, K value should be within the scope of 95-100.
Casein solution: being first placed in 40 DEG C of waters bath with thermostatic control by measurement, preheats 5min；The enzyme solution diluted is added in test tube
Casein solution 1ml, 40 DEG C of reaction 10min after mixing is added in 1ml, 40 DEG C of balance 2min, and trichloroacetic acid 2ml is added and mixes, takes out
It is filtered after standing 10min；1ml filtrate is taken, 0.4mol/L sodium carbonate liquor 5ml is added, Folin reagent is added to use liquid 1ml, 40 DEG C of water
Develop the color 20min in bath, and taking-up spectrophotometer measures it using 0 pipe without tyrosine as blank in wavelength 680nm respectively
Absorbance.
Enzyme activity calculation formula:
In formula:
The enzyme activity of X --- sample, unit U/ml；
A --- the difference of sample blank light absorption value；
K --- extinction constant；
4 --- the total volume (ml) of reaction reagent；
N --- extension rate；
10 --- reaction time, 10min；
4 fermentation scale-up of embodiment
Applicant will further go out bacterium germination trichoderma reesei 4Q-ASP and 5 plant mutant bacterium (trichoderma reesei 4QA1,4QA2,4QA3,
4QA4,4QA5), it ferments in 20L tank respectively；It ferments at the end of 160h, measures acidic protein in fermented supernatant fluid respectively
Enzyme enzyme activity.The results show that acid protease enzyme activity reaches 37691u/ml in bacterium germination trichoderma reesei 4Q-ASP fermented supernatant fluid out,
The fermentation enzyme activity of mutant bacteria generally improves 16-36% than going out bacterium germination, wherein in mutant bacteria trichoderma reesei 4QA5 fermented supernatant fluid
Acid protease enzyme activity highest reaches 51352u/ml, improves 36% than going out bacterium germination.
The course of fermentation curve of bacterium germination trichoderma reesei 4Q-ASP and mutant bacteria trichoderma reesei 4QA5 are as shown in Fig. 2, fermentation out
After 40h, the fermentation enzyme activity of mutant bacteria trichoderma reesei 4QA5 starts to be significantly higher than bacterium germination out；At the end of fermentation 160h, out in bacterium germination
Acid protease enzyme activity reaches 37691u/ml in family name's trichoderma 4Q-ASP fermented supernatant fluid, and mutant bacteria trichoderma reesei 4QA5 ferments
Acid protease enzyme activity is up to 51352u/ml in supernatant.
Meanwhile applicant carries out the fermented supernatant fluid of bacterium germination trichoderma reesei 4Q-ASP out and mutant bacteria trichoderma reesei 4QA5
SDS-PAGE electrophoresis detection.As a result as shown in figure 3, the protein band at arrow meaning 42kDa is acid protease, swimming lane 1
The content of acid protease is significantly higher than the bacterium germination trichoderma reesei 4Q- out of swimming lane 2 in mutant bacteria trichoderma reesei 4QA5 fermented supernatant fluid
The content of acid protease in ASP fermented supernatant fluid, unexpected technical results have been achieved.
Applicant is on June 21st, 2018 by above-mentioned mutant strain trichoderma reesei 4QA5 (Trichoderma reesei
It 4QA5) is preserved in the China typical culture collection center of Wuhan, China Wuhan University, deposit number is CCTCC NO:
M2018390。
Sequence table
<110>Qingdao Weilan Biology Group Co., Ltd.
<120>a kind of acid protease superior strain and its application
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 394
<212> PRT
<213>aspergillus niger (Aspergillus niger)
<400> 1
Met Val Val Phe Ser Lys Thr Ala Ala Leu Val Leu Gly Leu Ser Thr
1 5 10 15
Ala Val Ser Ala Ala Pro Ala Pro Thr Arg Lys Gly Phe Thr Ile Asn
20 25 30
Gln Ile Ala Arg Pro Ala Asn Lys Thr Arg Thr Ile Asn Leu Pro Gly
35 40 45
Met Tyr Ala Arg Ser Leu Ala Lys Phe Gly Gly Ala Val Pro Gln Ser
50 55 60
Val Lys Glu Ala Ala Ser Lys Gly Ser Ala Val Thr Thr Pro Gln Asn
65 70 75 80
Asn Asp Glu Glu Tyr Leu Thr Pro Val Thr Val Gly Lys Ser Thr Leu
85 90 95
His Leu Asp Phe Asp Thr Gly Ser Ala Asp Leu Trp Val Phe Ser Asp
100 105 110
Glu Leu Pro Ser Ser Glu Arg Thr Gly His Asp Val Tyr Thr Pro Ser
115 120 125
Ser Ser Ala Thr Lys Leu Ser Gly Tyr Ser Trp Asp Ile Ser Tyr Gly
130 135 140
Asp Gly Ser Ser Ala Ser Gly Asp Val Tyr Arg Asp Thr Val Thr Val
145 150 155 160
Gly Gly Val Thr Thr Asn Lys Gln Ala Val Glu Ala Ala Ser Lys Ile
165 170 175
Ser Ser Glu Phe Val Gln Asp Thr Ala Asn Asp Gly Leu Leu Gly Leu
180 185 190
Ala Phe Ser Ser Ile Asn Thr Val Gln Pro Lys Ala Gln Thr Thr Phe
195 200 205
Phe Asp Thr Val Lys Ser Gln Leu Asp Ser Pro Leu Phe Ala Val Gln
210 215 220
Leu Lys His Asp Ala Pro Gly Val Tyr Asp Phe Gly Tyr Ile Asp Asp
225 230 235 240
Ser Lys Tyr Thr Gly Ser Ile Thr Tyr Thr Asp Ala Asp Ser Ser Gln
245 250 255
Gly Tyr Trp Gly Phe Asn Pro Asp Gly Tyr Ser Ile Gly Asp Ser Ser
260 265 270
Ser Ser Ser Ser Gly Phe Ser Ala Ile Ala Asp Thr Gly Thr Thr Leu
275 280 285
Ile Leu Leu Asp Asp Glu Ile Val Ser Ala Tyr Tyr Glu Gln Val Asp
290 295 300
Gly Ala Gln Glu Ser Asn Glu Ala Gly Gly Tyr Val Phe Ser Cys Ser
305 310 315 320
Thr Thr Pro Pro Asp Phe Thr Val Ile Ile Gly Asp Tyr Lys Ala Val
325 330 335
Val Pro Gly Lys Tyr Ile Asn Tyr Ala Pro Ile Ser Thr Gly Ser Ser
340 345 350
Thr Cys Phe Gly Gly Ile Gln Ser Asn Ser Gly Leu Gly Leu Ser Ile
355 360 365
Leu Gly Asp Val Phe Leu Lys Ser Gln Tyr Val Val Phe Asn Ser Glu
370 375 380
Gly Pro Lys Leu Gly Phe Ala Ala Gln Ala
385 390
<210> 2
<211> 1185
<212> DNA
<213>aspergillus niger (Aspergillus niger)
<400> 2
atggtcgtct tcagcaaaac cgctgccctc gttctgggtc tgtccaccgc cgtctctgcg 60
gcaccggctc ccactcgcaa gggcttcacc atcaaccaga ttgcccggcc tgccaacaag 120
acccgcacta tcaacctgcc gggtatgtat gcccgctcct tggccaagtt tggcggtgcg 180
gtgccccaga gcgtgaagga ggctgccagc aagggtagtg ccgtgaccac gccccagaac 240
aatgatgagg agtacctgac tcccgtcact gtcggaaagt ccacccttca tctggacttt 300
gacaccggat ctgcagatct ctgggtcttc tcagacgagc tcccttcctc ggaacggacc 360
ggtcacgatg tgtacacgcc tagctccagc gcgaccaagc tgagcggcta ctcttgggac 420
atttcctacg gtgacggcag ctcggccagc ggagacgtgt accgggatac tgtcaccgtc 480
ggcggtgtca ccaccaacaa gcaggccgtt gaagctgcca gcaagatcag ctccgagttc 540
gttcaggaca cggccaatga tggtcttctg ggactagcct tcagctccat caacactgtc 600
cagcccaagg cgcagaccac cttcttcgac accgtcaagt ctcagctgga ctctcctctt 660
ttcgccgtgc agctgaagca cgacgccccc ggtgtctacg actttggcta catcgatgac 720
tccaagtaca ccggttccat cacctacaca gatgccgata gctcccaggg ctactggggc 780
ttcaatcccg atggctacag catcggcgac agcagctcca gctccagtgg attcagtgcc 840
attgctgaca ccggtaccac cctcatcctc ctcgacgacg agatcgtctc cgcctactat 900
gagcaggttg atggcgccca ggagagcaat gaagccggtg gctacgtttt ctcctgctcg 960
accacccctc ctgacttcac tgtcatcatc ggcgactaca aggccgtcgt tcctggaaag 1020
tacatcaact acgctcccat ttcgaccggc agctccacct gcttcggcgg tatccagagc 1080
aacagcggtc tgggactgtc catcctgggt gatgtgttcc tgaagagcca gtacgtggta 1140
ttcaactctg agggtcctaa gctgggcttc gctgctcaag cttag 1185
Claims (6)
1. a kind of trichoderma reesei engineered strain, which is characterized in that the trichoderma reesei engineered strain conversion/transfection has for weight
The recombinant plasmid of group expression acid protease gene.
2. trichoderma reesei engineered strain as described in claim 1, which is characterized in that the acid protease, amino acid
Sequence is SEQ ID NO:1.
3. trichoderma reesei engineered strain as described in claim 1, which is characterized in that the acid protease encodes core
Nucleotide sequence is SEQ ID NO:2.
4. a kind of trichoderma reesei mutant strain, which is characterized in that the deposit number of the trichoderma reesei mutant strain is CCTCC
NO:M2018390。
5. application of the trichoderma reesei engineered strain described in claim 1 in production acid protease.
6. application of the trichoderma reesei mutant strain as claimed in claim 4 in production acid protease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810793554.XA CN109251867B (en) | 2018-07-18 | 2018-07-18 | High-yield strain of acid protease and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810793554.XA CN109251867B (en) | 2018-07-18 | 2018-07-18 | High-yield strain of acid protease and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109251867A true CN109251867A (en) | 2019-01-22 |
| CN109251867B CN109251867B (en) | 2022-03-04 |
Family
ID=65048916
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810793554.XA Active CN109251867B (en) | 2018-07-18 | 2018-07-18 | High-yield strain of acid protease and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109251867B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115820692A (en) * | 2022-08-17 | 2023-03-21 | 大连理工大学 | Protease capable of simultaneously removing egg shells of wool lice and preventing felting and application |
| WO2024183792A1 (en) * | 2023-03-09 | 2024-09-12 | 武汉康复得生物科技股份有限公司 | Protein with no or low methionine content and use thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102268448A (en) * | 2011-06-28 | 2011-12-07 | 华东理工大学 | Expression equipment for expressing heterologous protein in Trichoderma reesei cell, and gene engineering bacteria |
| CN104711242A (en) * | 2013-12-12 | 2015-06-17 | 青岛蔚蓝生物集团有限公司 | Neutral protease and use thereof |
| CN104711200A (en) * | 2013-12-12 | 2015-06-17 | 青岛蔚蓝生物集团有限公司 | Neutral protease production bacterial strain and use thereof |
| CN107586789A (en) * | 2017-10-11 | 2018-01-16 | 南京百斯杰生物工程有限公司 | High yield acid protease aspergillus niger recombinant strains and its construction method and application |
-
2018
- 2018-07-18 CN CN201810793554.XA patent/CN109251867B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102268448A (en) * | 2011-06-28 | 2011-12-07 | 华东理工大学 | Expression equipment for expressing heterologous protein in Trichoderma reesei cell, and gene engineering bacteria |
| CN104711242A (en) * | 2013-12-12 | 2015-06-17 | 青岛蔚蓝生物集团有限公司 | Neutral protease and use thereof |
| CN104711200A (en) * | 2013-12-12 | 2015-06-17 | 青岛蔚蓝生物集团有限公司 | Neutral protease production bacterial strain and use thereof |
| CN107586789A (en) * | 2017-10-11 | 2018-01-16 | 南京百斯杰生物工程有限公司 | High yield acid protease aspergillus niger recombinant strains and its construction method and application |
Non-Patent Citations (3)
| Title |
|---|
| RILEY,R.等: "hypothetical protein ASPFODRAFT_138292 [Aspergillus luchuensis CBS 106.47]GenBank: OJZ84599.1", 《NCBI》 * |
| VESTH,T.C.等: "Aspergillus piperis CBS 112811 preproproctase B (BO85DRAFT_375591), partial mRNA，NCBI Reference Sequence: XM_025656178.1", 《NCBI》 * |
| 张秀江等: "里氏木霉产酶菌株的选育研究", 《河南科学》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115820692A (en) * | 2022-08-17 | 2023-03-21 | 大连理工大学 | Protease capable of simultaneously removing egg shells of wool lice and preventing felting and application |
| CN115820692B (en) * | 2022-08-17 | 2024-05-10 | 大连理工大学 | Protease capable of simultaneously removing eggshells of wool lice and preventing felting and application |
| WO2024183792A1 (en) * | 2023-03-09 | 2024-09-12 | 武汉康复得生物科技股份有限公司 | Protein with no or low methionine content and use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109251867B (en) | 2022-03-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104962483B (en) | A kind of monascus purpureus bacterial strain and application thereof | |
| CN108118002B (en) | Acremonium ramosum and application thereof | |
| CN113862241B (en) | Chitosanase Csncv, mutant CsnB thereof and application of mutant CsnB | |
| CN110713996B (en) | Trehalase, and carrier and application thereof | |
| CN107603937A (en) | A kind of recombination bacillus coli and its construction method for expressing lysine aminopeptidase | |
| CN106906106A (en) | A kind of esterified red yeast preparation method of brewed wine | |
| CN107164398A (en) | A kind of recombinant alpha galactosidase gene, carrier, engineering bacteria and its application | |
| CN112111474B (en) | Recombinant lysozyme LYZ-2 with improved enzyme activity, and mutant and application thereof | |
| CN109251867A (en) | A kind of acid protease superior strain and its application | |
| CN110408545A (en) | A kind of purplish red aspergillus kind and the method and product that Hongqu powder (red colouring agent) is prepared by it | |
| CN110423700A (en) | A kind of Aspergillus niger strain of high yield rhamnosidase | |
| CN108753631B (en) | Trichoderma reesei and application thereof in tannase production | |
| CN109371004B (en) | Acid protease Bs2688 mutant K203E with improved thermal stability and gene and application thereof | |
| CN110423701A (en) | A kind of Aspergillus niger strain of high yield arabinofuranosidase | |
| CN112553226B (en) | Pichia pastoris genetically engineered bacteria and method for preparing D-pantolactone hydrolase by using same | |
| CN107418909A (en) | One plant of marine source bacillus licheniformis is used for the biological reinforced method of vinegar | |
| CN109880731A (en) | A kind of preparation method of selenium-enriched anka vinegar | |
| CN117721135A (en) | Recombinant strain for expressing alpha-amylase and construction method and application thereof | |
| CN109161489A (en) | A kind of Aspergillus niger strain of high yield acid protease | |
| CN103060249A (en) | Escherichia coli and method for efficiently secreting and expressing human epidermal growth factor by using same | |
| CN106381273B (en) | The Aspergillus niger strain of one plant height production zytase | |
| CN108004153B (en) | Trichoderma reesei strain capable of producing pectin lyase in high yield and application thereof | |
| CN105420123B (en) | One plant of monascus purpureus bacterial strain and its preparing the application in food | |
| CN113832129B (en) | Chitosanase mutant CsnBa1 and application thereof | |
| CN109355274A (en) | The beta-glucosidase that a kind of pair of trypsase stomach function regulating protease resistant improves |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220307 Address after: 261500 south of Xianghe Road, east of Yi'an Avenue, Gaomi City, Weifang City, Shandong Province (in Xiazhuang Industrial Park) Patentee after: WEIFANG KDN BIOTECH CO.,LTD. Patentee after: Qingdao Weilan biological Group Co., Ltd Address before: 266061 Shandong 12A07 Shandong High Speed Building, 29 Miaoling Road, Laoshan District, Qingdao City, Shandong Province Patentee before: QINGDAO VLAND BIOTECH GROUP Co.,Ltd. |