CN109223804B

CN109223804B - Quinone methyl triterpenoid and pharmaceutical composition for treating refractory rheumatoid arthritis

Info

Publication number: CN109223804B
Application number: CN201810752435.XA
Authority: CN
Inventors: 刘良; 黄锦伟; 罗婉君; 邱聪龄
Original assignee: Macau Univ of Science and Technology
Current assignee: Macau Univ of Science and Technology
Priority date: 2017-07-10
Filing date: 2018-07-10
Publication date: 2022-05-03
Anticipated expiration: 2038-07-10
Also published as: CN109223804A

Abstract

The application of the quinone methyl triterpenoid or the pharmaceutically acceptable salt, solvate or anhydride thereof in preparing the medicine for treating refractory rheumatoid arthritis and the medicine for inducing synoviofibroblast autophagy. A pharmaceutical composition comprising an effective amount of a quinone methyl triterpenoid and an anti-arthritic compound. Quinone triterpenoids are useful in the treatment of refractory rheumatoid arthritis, particularly ABC-protein dependent rheumatoid arthritis and rheumatoid arthritis deficient in apoptosis. The quinone methyl triterpenoid also has obvious effect of inhibiting the growth of synovial fibroblasts, and particularly aims at the regulation of calcium homeostasis in synovial fibroblasts of multidrug resistant rheumatoid arthritis.

Description

Quinone methyl triterpenoid and pharmaceutical composition for treating refractory rheumatoid arthritis

Technical Field

The present invention relates to a method for treating rheumatoid arthritis, in particular refractory rheumatoid arthritis, by administration of a quinone methyl triterpenoid. The invention also relates to a pharmaceutical composition which comprises the quinone methyl triterpenoid and the anti-arthritis compound, and is particularly used for treating refractory rheumatoid arthritis.

Background

Drug resistance has been a constant obstacle to the treatment of rheumatoid arthritis, especially intractable rheumatoid arthritis. Resistance to classical therapeutic drugs is largely divided into two major categories: inherent resistance to genetic development and acquired resistance to development due to selective pressure caused by exposure to drugs. In fact, intrinsic drug resistance is more common in inflammatory diseases such as Rheumatoid Arthritis (RA). Rheumatoid Arthritis Synovial Fibroblasts (RASFs) have anti-apoptotic properties due to low expression levels of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) death receptors. This anti-apoptotic phenotype is considered to be a major feature of refractory rheumatoid arthritis. RASFs also exhibit the phenotype of "tumors": these cells are redefined from "inert" cells as invasive, destructive, immunogenic proliferating cells, which exhibit profound inflammatory properties, promoting the pathological process of rheumatoid arthritis. The synovial environment of rheumatoid arthritis favors the survival and hinders clearance of RASFs by apoptosis.

In addition to the apoptotic protein, the tumor suppressor protein p53 is a sensor of cellular stress and is also a key trigger protein for apoptosis. In general, the high frequency of the p53 mutation ultimately leads to chemical resistance in cancer cells. Surprisingly, the p53 mutation was also frequently found in synovium with rheumatoid arthritis. In particular, the dominant negative p53 mutation of N239S and R213 resulted in the inhibition of apoptosis and the production of inflammatory cytokines. These findings suggest that p53 may have mutations in the pathogenesis of refractory rheumatoid arthritis.

In addition, refractory rheumatoid arthritis patients may exhibit multidrug resistance (MDR). Such multidrug resistance may be intrinsic or acquired resistance. The MDR phenotype exhibits an unresponsive state to many drugs by expelling the drug, which may be mediated by ABC transporters. ABC transporters have been found to be expressed and overexpressed in a number of drug resistant diseases, with p-glycoprotein being considered as the key to multidrug resistance. The P-glycoprotein (P-gp) is an ATP-dependent membrane transporter of 170kd, which can reduce the optimal drug concentration in the cell. Maillefer JF et al in the Br J Rheumatol journal 1996(35) report that in rheumatoid arthritis patients treated with prednisolone, the percentage of peripheral blood lymphocytes expressing p-gp is significantly increased, which may lead to efflux of corticosteroid drugs and disease-modifying antirheumatic rheumatic drugs (DMARDs) from the lymphocytes and eventually to development of drug resistance and severe inflammatory states in the patients.

Therefore, there is an urgent need for effective methods for treating refractory rheumatoid arthritis and for effective treatment and methods for synovial fibroblasts of rheumatoid arthritis with multidrug resistance. In particular, there is an urgent need for effective treatment regimens to specifically treat subjects with refractory rheumatoid arthritis, which subjects have ABC transporter expression or overexpression, or decreased expression of pro-apoptotic proteins and increased expression of anti-apoptotic proteins, respectively, that is, to specifically treat specific subgroups of subjects with rheumatoid arthritis.

Disclosure of Invention

In a first aspect, the present invention relates to a method of treating a subject suffering from refractory rheumatoid arthritis, in particular at least one of (i) ABC protein-dependent refractory rheumatoid arthritis or (ii) refractory rheumatoid arthritis lacking apoptosis. The method comprises administering to a subject having refractory rheumatoid arthritis an effective amount of a quinone methyl triterpenoid.

The quinone methyl triterpenoid compound has a structure shown in a formula (I), and comprises salts, solvates or anhydrates thereof, particularly pharmaceutically acceptable salts, solvates or anhydrates thereof.

Wherein the content of the first and second substances,

-

represents a single or double bond;

-R¹is selected from-CH₃、-CH₂OH, -OH or-H;

-R²is selected from-CH₃、-CH₂OH、-OH、-COOH、-COOCH₃、＝CH₂or-H;

-R³selected from-OH, ═ O, or-H;

-R⁴is selected from-OH or-H;

-R⁵is selected from-OH or-H.

Specifically, the quinone methyl triterpenoid compound has a structure represented by a formula (II):

wherein:

-R¹is selected from-CH₃or-CH₂OH；

-R²Selected from-COOH or-COOCH₃；

-R³Selected from-OH, ═ O, or-H.

Preferably, the quinone methyl triterpenoid has a structure represented by formula (IIIa):

in particular, the quinone methyl triterpenoid has a structure represented by formula (IIIb):

specifically, the compound of formula (I) is used in combination with at least one agent for treating rheumatoid arthritis, for example, an anti-arthritis compound selected from the group consisting of: methotrexate, dexamethasone, prednisolone, Abeticept, adalimumab, chloroquine, etanercept, golimumab, infliximab, leflunomide, rituximab, sulfasalazine, colchicine, or derivatives thereof.

According to the present invention, the above-described quinomethyltridenes are useful as medicaments for the treatment of refractory rheumatoid arthritis, in particular ABC protein dependent refractory rheumatoid arthritis, such as P-glycoprotein dependent refractory rheumatoid arthritis, or refractory rheumatoid arthritis lacking apoptosis. The refractory rheumatoid arthritis lacking apoptosis is associated with at least one of a p53 mutation or a TRAIL death receptor defect.

Another aspect of the present invention relates to the use of a quinone methyl triterpenoid as described above for the preparation of a medicament for the treatment of refractory rheumatoid arthritis, in particular ABC-protein dependent, such as P-glycoprotein dependent or devoid of apoptosis. The refractory rheumatoid arthritis lacking apoptosis is associated with at least one of a p53 mutation or a TRAIL death receptor defect. In particular, the above quinone methyl triterpenoids are used in combination with a further medicament, preferably an anti-arthritic compound as described above for the treatment of rheumatoid arthritis.

The invention also relates to the application of the quinone methyl triterpenoid as a P-glycoprotein inhibitor or calcium mobilizer for treating refractory rheumatoid arthritis.

In another aspect, the invention relates to a method of inducing synovial fibroblast autophagy by a quinone triterpenoid or a salt, solvate or anhydrate thereof as described above, in particular multidrug resistant rheumatoid arthritis synovial fibroblasts. Specifically, the method comprises contacting a population of synovial fibroblasts with a quinone triterpenoid as described above, or a salt, solvate or anhydrate thereof. Preferably, the method induces the death of synovial fibroblasts, or inhibits the growth of synovial fibroblasts.

Furthermore, the invention also relates to the application of the quinone methyl triterpenoid or the salt, the solvate or the anhydrate thereof in the preparation of the medicine for inducing the synoviofibroblast autophagy.

In another aspect, the invention relates to a method of inducing calcium release in synovial fibroblasts, in particular synovial fibroblasts for multi-drug resistant rheumatoid arthritis. The method comprises contacting a population of synovial fibroblasts with a quinone triterpenoid as described above. In one embodiment, the synovial fibroblasts are P-glycoprotein dependent or lack apoptosis, which lack apoptosis is associated with the P53 mutation. The method alters calcium homeostasis in synovial fibroblasts and can ultimately cause the death of synovial fibroblasts.

The invention also relates to a pharmaceutical composition comprising an effective dose of a quinone methyl triterpenoid as described above and an effective dose of at least one other anti-arthritic compound commonly used in the treatment of rheumatoid arthritis, namely methotrexate, dexamethasone, prednisolone, Abelicept, adalimumab, chloroquine, etanercept, golimumab, infliximab, leflunomide, rituximab, azalomidine, colchicine or derivatives thereof. The pharmaceutical composition may further comprise an excipient, in particular a pharmaceutically acceptable excipient, such as a carrier, a salt, a buffer, water or a combination thereof.

Thus, the present invention provides a novel and highly advantageous way of treating refractory rheumatoid arthritis (refractory RA) of different origins by (i) administration of a quinone methyl triterpenoid as described above, or (ii) combining a quinone methyl triterpenoid as described above as an adjuvant with other anti-arthritic compounds. It has been found that said quinomethyl triterpenoids having the structure of formula (IIIa) or (IIIb) are particularly suitable for inducing autophagy and apoptosis by promoting calcium mobilization (calcium mobilization), thereby accumulating autophagosomes and reducing inflammation. The quinomethyl triterpenoids are also useful for inhibiting ABC protein activity, such as P-glycoprotein activity, thereby accumulating cytotoxic compounds or drugs in the synovial fibroblasts (particularly in multidrug resistant RASF) while specifically increasing cytotoxic activity against RASF. The quinone methyltrerpenoids are effective to target the refractory rheumatoid arthritis and RASF, respectively, alone or in combination with conventional anti-arthritis compounds. Thus, the present invention provides an advantageous and well-suited regimen for the treatment of refractory rheumatoid arthritis.

Drawings

Fig. 1A shows images obtained by immunocytochemical staining, which shows the time dependence of tripterine in inducing Rheumatoid Arthritis Synovial Fibroblast (RASF) autophagy. RASF was treated with DMSO as a control or 1 μ M tripterine for 10, 30, 60 or 240 minutes. Cells were then fixed and endogenous LC3-II expression was observed by fluorescence microscopy using LC3-II antibody plus TRITC-labeled anti-mouse secondary antibody as the fluorescent signal.

FIG. 1B shows the percentage of RASF cells expressing endogenous LC3-II spots treated with 1 μ M tripterine for 10, 30, 60, or 240 minutes with DMSO treatment as a control group. Data in the bar graphs represent mean ± standard deviation, error bars, s.d.. x, P <0.001 of three independent experiments.

Figure 2A shows images obtained by immunocytochemical staining showing the effect of tripterine on rheumatoid arthritis fibroblast-like synovial cells (RAFLS) autophagy induction. RAFLS was treated with DMSO as a control or with tripterine at concentrations of 0.25, 0.5, 1 or 2 μ M for 24 hours. The results indicate that tripterine exerts a dose-dependent autophagy inducing effect in RAFLS.

FIG. 2B shows the percentage of RAFLS expressing endogenous LC3-II spots treated with 0, 0.25, 0.5, 1 or 2 μ M tripterine for 24 hours. Data from the bar graphs represent mean ± standard deviation, error bars, s.d.. x, P <0.001 of three independent experiments.

FIG. 3A shows the results of flow cytometry analysis of treated RAFLS with DMSO-treated RASF cells as a control and additional RASF cells treated with 0.25, 0.5, 1 or 2 μ M tripterine for 24 hours. The results show that tripterine has dose-dependent toxicity to RAFLS cells.

Figure 3B shows the percent cell death after 24 hours of treatment of RAFLS with 0, 0.25, 0.5, 1 or 2 μ M tripterine. Data in bar graphs represent mean ± standard deviation of three independent experiments; error bars, s.d.. x, P < 0.001.

FIG. 4 shows the results of flow cytometry analysis of treated RAFLS treated for 0-24 hours with or without 1 μ M tripterine. The treated RAFLS was stained with Fluo-3 dye prior to flow cytometry analysis. These results demonstrate that tripterine can time-dependently mobilize calcium release in RAFLS.

Figure 5 shows the results of flow cytometry analysis of treated RAFLS treated with 0, 0.1, 0.2,0.5, 1 and 2 μ M tripterine for 4 hours. After treatment, the RAFLS was stained with Fluo-3 dye prior to flow cytometry analysis. These results indicate that tripterine dose-dependently mobilizes calcium release in RAFLS.

FIG. 6 shows a calcium signaling profile of calcium dynamics in RASFs after treatment with 1 μ M thapsigargin (a SERCA inhibitor), 1 μ M tripterine, 5 μ M Compound C (an AMPK inhibitor) and 1 μ M tripterine, or 1 μ M thapsigargin and 1 μ M tripterine. RASFs were stained with FLIPR calcium 6 detection kit. Calcium dynamics in RASFs were measured by SpectraMax paramigm after staining. Data in the graph represent mean ± standard deviation of three independent experiments; error bars, s.d. results indicate that tripterine may target SERCA to mobilize calcium.

FIG. 7A shows immunocytochemical fluorescence images of RAFLS after 24 hours treatment with DMSO, 1 μ M tripterine, 10 μ M calcium chelator BAPTA/AM, or 1 μ M tripterine and 10 μ M BAPTA/AM. The fluorescence image was magnified X60 times; scale bar 15 microns. The results indicate that the calcium chelator BAPTA/AM abolishes autophagy by tripterine in RAFLS.

FIG. 7B is a bar graph showing the percentage of RAFLS expressing endogenous LC3-II after treatment with 0 or 1 μ M tripterine in the presence or absence of 10 μ M BAPTA/AM.

FIG. 8 shows immunoblot results of changes in LC3-I and LC3-II (LC3-I, 18 kDa; LC3-II, 16kDa) of 0 or 2 μ M tripterine-treated RASFs in the presence or absence of 10 μ M BAPTA/AM. The bar graph shows the fold change in LC3 conversion in the treated RASFs.

FIGS. 9A-9G show flow cytometry data obtained from RAFLS treated with DMSO (control), 5mM 3-methyladenine (3-MA), 5. mu.M PTA/AM (BM), 1. mu.M tripterine, 2. mu.M tripterine and 5mM 3-MA, or 2. mu.M tripterine and 5. mu.M BM. Celastrol-induced cell death stained annexin V was measured after flow cytometry analysis.

Figure 9H shows a bar graph of the percent cell death of RAFLS after the above treatment. Data represent mean ± standard deviation of three independent experiments; error bars, s.d. x, P < 0.01; p < 0.001. This result indicates that BAPTA/AM and 3-MA reduce autophagic cell death in tripterine-mediated RAFLS.

Fig. 10A shows the immunoblot results for p53 in p53 mutant transfected RAFLS (N239S and R213), wild type RAFLS and control.

Fig. 10B shows immunoblot results of pro-apoptotic markers (including PARP, Bax and Bak) in p53 mutant transfected RAFLS (N239S and R213), wild type RAFLS and controls.

FIG. 10C shows the immunoblot results of anti-apoptotic markers (including C-IAP1, TRAF and Bcl-2) in p53 mutant transfected RAFLS (N239S and R213), wild type RAFLS and control groups.

FIG. 11 shows a bar graph of the relative expression levels of P-glycoprotein (P-gp) obtained from blood of Rheumatoid Arthritis (RA) patients and non-RA patients.

FIG. 12 showsAssay results for P-gp GLO activity after treatment with tripterine at concentrations of 0, 0.5, 1 or 2 μ M, activated P-gp, and 200 μmM verapamil (verapamil). The results show that the tripterine has direct inhibition effect on P-gp activated by verapamil. In the assay, tripterine was incubated with P-gp protein, 200. mu.M verapamil and ATP for 1 hour at 37 ℃. Then through P-gp Glo^tmThe system detects the luminous intensity. The change in luminescence (RLU) indicates P-gp activity, while the activity of the control group indicates a baseline for P-glycoprotein ATPase activity.

FIGS. 13A to 13H, flow cytometry data of RAFLS transfected with highly expressed P-gp is shown. The treatment group was incubated with or without 10 μ M verapamil, or with 0.1, 0.5 or 1 μ M tripterine at 37 ℃ for 4 h. After incubation, 3. mu.g/mL rhodamine 123 dye (Rho123) was added to each sample well and incubated for an additional 1h at 37 ℃. Rhodamine 123 stained transfected RAFLS were measured by flow cytometry.

FIG. 13I is a bar graph showing the percent RAFLS stained with Rho123 treated as described above. Rho123 exclusion analysis results show that tripterine has inhibitory effect on P-gp activity.

FIGS. 14A to 14F show flow cytometry data obtained after RAFLS treatment, treatment factors including DMSO (control), 450 μ M Methotrexate (MTX), 0.1 μ M tripterine, 0.2 μ M tripterine, 0.1 μ M tripterine, and 450 μ M methotrexate, or 0.2 μ M tripterine and 450 μ M methotrexate. Tripterine-induced cell death was measured by flow cell after annexin V staining.

Figure 14G shows a bar graph of the percent cell death of RAFLS after the above treatment. Data in the bar graph represent mean ± standard deviation of three independent experiments; error bars, s.d.. x, P < 0.01. The results demonstrate that low doses of tripterine sensitize MTX-mediated RAFLS cell death.

FIG. 15A shows arthritis scores and hindpaw volume changes in the following 6 animal models, normal (vehicle), MTX (7.6mg/kg), tripterine (1 and 2mg/kg) or tripterine (1mg/kg) in combination with BAPTA/AM (3.5mg/kg) groups, for a treatment period of 36 days. The arthritis-induced animal model is referred to as an adjuvant-induced arthritis (AIA) model. Arthritis scores were determined with hindpaw volumes (ml) and body weights every 3 days, and organ weights were measured for each group of AIA rats at the end of the experiment. Data are expressed as mean ± SEM (n ═ 8-10), p <0.05, p <0.01, p <0.001 compared to normal groups.

Figure 15B shows representative images of hind paw swelling in AIA rats after the above treatment.

FIG. 16 shows the weight change of AIA rats after treatment, including normal group (vehicle), MTX (7.6mg/kg) group, tripterine (1 and 2mg/kg) group or tripterine (1mg/kg) in combination with BAPTA/AM (3.5mg/kg) group for 36 days.

FIGS. 17A to 17I show the change in body weight of AIA rats after treatment, including normal group, MTX (7.6mg/kg) group, tripterine (1 and 2mg/kg) group or tripterine (1mg/kg) in combination with BAPTA/AM (3.5mg/kg) group for 36 days. The organs measured were spleen, brain, lung, adrenal gland, liver, heart, kidney, thymus and testis.

FIG. 18 shows a bar graph of the results of the inflammatory factor, Erythrocyte Sedimentation Rate (ESR) of AIA rats after treatment with tripterine or a positive control drug, MTX.

Figure 19 shows representative micro-CT images of AIA rats recovered from inflammatory destruction after treatment.

Detailed Description

The following preparations and examples are set forth to provide a person skilled in the art with a clear understanding and appreciation of the invention. The following should not be taken as limiting the scope of the invention but as being illustrative and representative of preferred embodiments. Technical terms used in the present patent application have meanings consistent with those understood by those skilled in the art unless explicitly stated otherwise.

The present invention relates in a first aspect to a method of treating refractory rheumatoid arthritis (refractory RA). The method for treating refractory rheumatoid arthritis includes the step of administering an effective amount of a quinone methyltrioterpenoid to a subject. The quinone methyl triterpenes may be synthesized or obtained from extracts of respective plants, in particular from Celastraceae (Celastraceae), in particular from plants of the genera Arabidopsis (Celastrus), catarrh (Catha), maytans (Maytenus), Salacia (Salacia) or Tripterygium (Tripterygium), more preferably from the genera Arabidopsis and/or Tripterygium.

The term quinone methyl triterpenoid generally refers to a subset of pentacyclic triterpenoids derived from the oleanane basic structure. The quinone methyl triterpenoid compound has a structure represented by a formula (I), and comprises salts, solvates or anhydrates thereof:

wherein

Represents a single bond or a double bond.

R¹Is selected from-CH₃、-CH₂OH, -OH or-H. Preferably, R¹represents-CH₃or-CH₂OH。

R²Is selected from-CH₃、-CH₂OH、-OH、-COOH、-COOCH₃、＝CH₂or-H.

R²Selected from-COOH or-COOCH₃。

R³Selected from-OH, ═ O, or-H.

R⁴Is selected from-OH or-H.

R⁵Is selected from-OH or-H.

The invention also contemplates any pharmaceutically acceptable salts, hydrates, solvates, anhydrates as well as enantiomers and mixtures thereof, stereoisomeric forms, racemates, diastereomers and mixtures thereof.

As used herein, the term "solvent" refers to various stoichiometric complexes formed from a solute, i.e., from a solute (i.e., a quinone methyl triterpenoid) and a solvent. If the solvent is water, the solvate formed is a hydrate. As used herein, the term "anhydrate" refers to any compound that contains no water of hydration, as is understood in the art. Suitable pharmaceutically acceptable salts are those suitable for administration to a subject, particularly a mammal such as a human, and may be prepared in sufficient purity and used to prepare a pharmaceutical composition. The skilled person is aware of the following terms: stereoisomers, diastereomers, enantiomers, and racemates.

The quinone methyl triterpenoid compound of the present invention preferably has a structure represented by the following formula (II):

R¹is selected from-CH₃or-CH₂OH, more preferably R¹is-CH₃。R²Selected from-COOH or-COOCH₃More preferably R²is-COOH.R³represents-OH, ═ O, or-H, more preferably R³is-H.

In a preferred embodiment of the present invention, the quinone methyltrioterpenoid has the structure represented by the following formula (IIIa):

including salts, solvates or anhydrates thereof and including any stereoisomers, diastereomers, enantiomers or racemates thereof.

Specifically, the quinone methyl triterpenoid has a structure represented by formula (IIIb):

including salts, solvates or anhydrates thereof. The compound of formula (IIIb) is tripterine, and can be prepared according to methods known to those skilled in the art or isolated from Tripterygium Wilfordii (Tripterygium Wilfordii) and Tripterygium Regelii (Celastrus Regelii).

The terms "effective amount" and "effective dose" generally refer to a dose sufficient to produce a therapeutically desirable result, wherein the nature of the result varies depending on the particular condition being treated. When the disease is refractory rheumatoid arthritis, the result is generally inhibition of synovial fibroblast proliferation, reduction of synovial fibroblasts, or amelioration of symptoms associated with refractory rheumatoid arthritis, such as reduction of inflammation.

The subject may be a human or an animal, in particular the subject is a mammal, preferably a human. Therefore, the subject is preferably a human suffering from refractory rheumatoid arthritis. Thus, the subject includes subjects with multidrug resistance that are multidrug resistant to conventional therapeutics that induce synovial fibroblast cell death (for the treatment of refractory rheumatoid arthritis).

The effective amount of the quinomethyltrioterpenoid of the present invention depends on the kind, weight, age and individual condition of the subject, and can be determined by, for example, experimental procedures such as cell culture or animal experiments. When the subject is a human, an effective amount is preferably from about 0.1mg/kg to about 0.5mg/kg, 0.13mg/kg to about 0.3mg/kg, 0.135mg/kg, or 0.27 mg/kg. In embodiments where the subject is a rodent, the effective amount is preferably about 0.5mg/kg to 3mg/kg, 1mg/kg to 2mg/kg, 1mg/kg, or 2 mg/kg. The quinone methyl triterpenoids are preferably administered for at least 1 day, at least 2 days, at least 5 days, or at least 10 days, depending on the severity of the disease.

The term "rheumatoid arthritis" (RA) refers primarily to autoimmune diseases that cause chronic inflammation at joints, and in some cases also at other body sites. Subjects with rheumatoid arthritis often have swollen and painful joints, stiff sensations, and loss of joint function. The term "refractory" refers to a particular type of rheumatoid arthritis, which does not show sufficient or even therapeutic response to conventionally used anti-arthritic drugs. That is, subjects with refractory rheumatoid arthritis exhibit multiple resistance to one or more conventional therapeutic agents in the treatment of rheumatoid arthritis. Such multidrug resistance may be intrinsic or acquired. This acquired resistance, or what is referred to as "acquired resistance," may be caused by inadequate or delayed treatment or overexposure to conventional therapeutic agents. In general, subjects with refractory rheumatoid arthritis have multidrug resistant rheumatoid arthritis synovial fibroblasts, and these cells have at least 1.4 or more times resistance to conventional therapeutic agents.

The methods provided herein are useful for, and particularly effective in, treating a subject having refractory rheumatoid arthritis, particularly refractory rheumatoid arthritis having at least one ABC-protein dependent refractory rheumatoid arthritis or lacking apoptosis.

ABC-protein-dependent refractory rheumatoid arthritis, i.e.mediated by ABC transporters (hereinafter referred to as "ABC-proteins"), is associated, for example by P-glycoprotein, with an increased expression or enhanced function of at least one ABC-protein in Rheumatoid Arthritis Synovial Fibroblasts (RASF), in particular with P-glycoprotein.

Refractory rheumatoid arthritis lacking apoptosis, i.e. decreased expression of at least one pro-apoptotic protein and/or decreased activity of at least one pro-apoptotic protein and/or increased expression of at least one anti-apoptotic protein and/or increased activity of at least one anti-apoptotic protein in RASFs cells, in particular RASFs cells containing a p53 mutant.

In one embodiment, refractory rheumatoid arthritis is ABC-protein dependent, specifically P-glycoprotein (P-gp) dependent. In another embodiment of the invention, the refractory rheumatoid arthritis is deficient, in particular associated with a p53 mutation, i.e. carrying a p53 mutant and/or associated with a deficiency of TRAIL death receptor.

ABC-proteins are transporters that may act to remove therapeutic agents from cells. The resulting multidrug resistant phenotype can be specifically detected in a subject, tissue or cell by: by administering to a subject, tissue or cell a compound transported by an ABC-protein, e.g. an anti-arthritic compound, i.e. a substrate for an ABC-protein, such as P-glycoprotein. The method then comprises comparing to a control group, which is cells that do not express the multi-drug resistant phenotype, to determine the amount of the anti-arthritic compound or a change thereof in the cells.

Said ABC-proteins are in particular selected from the "B" subfamily, "C" subfamily or "G" subfamily of ABC proteins. Preferably, the ABC-protein is a protein encoded by the human genes ABCB1, ABCB4, ABCB5 or ABCB11 or other corresponding mammalian genes, which can transport drugs, in particular proteins encoded by the ABCB1 and/or ABCB5 genes. In one embodiment of the invention, said ABC-protein is P-glycoprotein and the refractory rheumatoid arthritis is P-glycoprotein dependent refractory rheumatoid arthritis. P-glycoprotein as used herein refers to the protein encoded by the human ABCB1 and/or ABCB5 genes or the respective genes, including SNPs and natural mutations of the genes or encoded by the corresponding genes in other mammals.

Elevated expression or enhanced functional activity of at least one ABC-protein (i.e., ABC-protein dependent) refers to expression or functionality that exceeds, specifically significantly exceeds, expression and/or functional activity in normal cells or tissues (i.e., in synovial fibroblasts without a multidrug-resistant phenotype). The term "increased expression" or "enhanced functional activity" in the expression of at least one ABC protein, such as P-glycoprotein, includes, in the examples, an increase or enhancement of function of an ABC-protein, such as P-glycoprotein, expressed in a multidrug resistant rheumatoid arthritis synovial fibroblast cell, while a control group, i.e., a synovial fibroblast cell that does not have a multidrug resistant phenotype, or means that said ABC-protein, such as P-glycoprotein, is not expressed at all. That is, multidrug resistant rheumatoid arthritis synovial fibroblasts with detectable expression or functional activity of ABC-protein (e.g., P-glycoprotein) are ABC-protein dependent when the reference control does not express ABC-protein such as P-glycoprotein. Examples of ABC-proteins include P-glycoprotein, which is P-glycoprotein dependent as defined above, on multidrug resistant rheumatoid arthritis synovial fibroblasts with detectable P-glycoprotein expression or functional activity.

Whether refractory rheumatoid arthritis is ABC-protein dependent, such as P-glycoprotein dependent, can be determined by methods known to those skilled in the art, in particular immunological methods including the use of MDR-specific antibodies, immunocytochemistry and immunohistochemistry; by determining the respective mRNA level, for example by Northern blotting or quantitative RT-PCR; the efflux of the marker is detected in vivo experiments with MDR-specific antibodies or with ABC-proteins such as the P glycoprotein efflux assay.

In particular, ABC-proteins such as the P-glycoprotein efflux assay can be used to determine the functional activity of ABC-proteins, i.e., to determine whether refractory rheumatoid arthritis is ABC-protein dependent. Labels that can be used in the above-described efflux assay include drugs, radionuclides or dyes such as rhodamine 123 (also known as "Rho 123"), 6-amino-9- (2-methoxycarbonylphenyl) xanthen-3-ylidene ] chloronitril, DiOC2(3,3' -diethyloxacarbocyanine iodide), or Calcein AM (Calcein, a, ω -diacetate tetrakis (acetoxymethyl) ester) as a substrate for the corresponding ABC-protein. The cells to be analyzed are usually incubated with the labeling agent under physiological conditions, i.e., in particular at about 37 ℃ for at least 20 minutes, or at least 30 minutes, or about 1 hour. Typically, the cells are subsequently washed at least 1 time, specifically preferably more than 1 time with buffer, specifically 5 times with ice-cold Phosphate Buffered Saline (PBS). By detecting the elimination or retention of the marker in multidrug resistant cells and comparing it to a reference control, i.e., the same type of cell or tissue that has ABC-protein expression but does not have a multidrug resistance phenotype. For example, the fluorescence of the fluorescent marker can be determined by flow cytometry.

Preferably, the ABC-protein dependent, e.g. P-glycoprotein dependent, refractory rheumatoid arthritis comprises synovial fibroblasts, in particular multidrug resistant RASFs cells having at least 5%, in particular at least 10% more ABC-protein expression or ABC-protein functional activity than in a reference control. For example, the expression or functional activity of P-glycoprotein in P-glycoprotein-dependent synovial fibroblasts is at least 5% or at least 10% higher than the expression or functional activity of P-glycoprotein in a control.

The term "apoptosis-deficient" as used herein refers to refractory rheumatoid arthritis having at least one of: (i) reduced expression and/or reduced pro-apoptotic activity of at least one pro-apoptotic protein, or (ii) enhanced expression and/or enhanced anti-apoptotic activity of an anti-apoptotic protein, i.e. (i) and (ii). Pro-apoptotic and/or anti-apoptotic proteins include in particular p53 mutants, Bcl-2 protein, PARP, apoptotic proteins and TRAF receptor proteins. Whether refractory rheumatoid arthritis is apoptotic defect can be determined by known methods by measuring expression of pro-apoptotic proteins and/or anti-apoptotic proteins and/or by assaying the apoptotic activity of pro-apoptotic proteins and/or anti-apoptotic proteins and comparing with a control group. The control group was synovial fibroblasts without the multidrug resistant phenotype. Suitable methods for determining expression include immunological methods using specific antibodies, immunocytochemistry and immunohistochemistry, or by determining the respective mRNA levels, e.g. Northern blotting or quantitative RT-PCR. Apoptotic activity can be determined by assays for the rate of apoptosis known to those skilled in the art, e.g., assays to determine alterations in cell morphology, such as DNA fragmentation by TUNEL assays and flow cytometry, assays to detect targets downstream of apoptotic pathways, substrates of degradation, regulatory factors and inhibitors, membrane alterations, or mitochondrial assays. As will be appreciated by those skilled in the art, any suitable means of detecting apoptosis may be used in the present invention.

Anti-apoptotic proteins are proteins that prevent apoptosis. The at least one anti-apoptotic protein is preferably selected from the Bcl-2 family. The enhanced expression and/or enhanced anti-apoptotic activity of said anti-apoptotic proteins specifically means that the expression and/or anti-apoptotic activity of said at least one protein is increased by at least 5%, more preferably by at least 10%, and most preferably by more than 50% compared to a reference control. The reference control was synovial fibroblasts without the multidrug resistant phenotype. The enhanced expression and/or enhanced anti-apoptotic activity of the anti-apoptotic protein may, for example, be increased by expression of an anti-apoptotic wild-type protein and/or have increased anti-apoptotic activity of expression of an anti-apoptotic mutein. The mutant anti-apoptotic proteins have amino acid sequences that differ from the wild-type protein expressed in healthy cells, which have no mutation in the corresponding coding gene.

Pro-apoptotic proteins are proteins that induce and initiate apoptotic pathways. In particular, the pro-apoptotic protein is selected from the group consisting of p53 proteins. The term "p 53 protein" as used herein includes isoforms of each of p53 encoded by the TP53 gene, such as p53 α, p53 β, p53 γ, Δ 40p53 α, Δ 40p53 β, Δ 40p53 γ, Δ 133p53 α, Δ 133p53 β, Δ 133p53 γ, Δ 160p53 α, Δ 160p53 β, Δ 160p53 γ, and the like. In another embodiment, the pro-apoptotic protein is selected from the Bcl-2 family of pro-apoptotic proteins. The Bcl-2 family pro-apoptotic protein is preferably at least one of Bax, Bak, Bad, Bik, Bim, PUMA, NOXA, Bok, Bad, Bmf, Hrk and Bid, and particularly at least one of Bax or Bak. By reduced expression of a pro-apoptotic protein and/or reduced pro-apoptotic activity is meant in particular that the expression of said at least one protein and/or the pro-apoptotic activity is reduced by at least 5%, more preferably by at least 10%, and most preferably by more than 50% compared to a reference control, which is a synovial fibroblast cell without a multidrug-resistant phenotype. The reduced expression of the at least one pro-apoptotic protein and/or the reduced pro-apoptotic activity may be caused, for example, by a reduced expression of a pro-apoptotic wild-type protein and/or a reduced expression of a pro-apoptotic mutant protein having reduced pro-apoptotic activity. The mutant pro-apoptotic proteins have amino acid sequences that differ from the wild-type protein expressed in healthy cells, which have no mutation in the corresponding coding gene. .

Most preferably, the apoptosis-deficient refractory rheumatoid arthritis exhibits reduced expression or reduced pro-apoptotic activity of at least one pro-apoptotic protein. Specifically, subjects or cells with apoptosis-deficient refractory rheumatoid arthritis have a p53 mutant.

In a preferred embodiment of the invention, the quinone methyltrerpene compound is administered in combination with an effective amount of at least one anti-arthritic compound. As used herein, the term "anti-arthritic compound" includes drugs (i.e., drugs known to be useful in the treatment of rheumatoid arthritis) that are generally advantageously administered to subjects and cells that do not have a multidrug resistance phenotype.

Specifically, the anti-arthritic compound is selected from methotrexate, dexamethasone, prednisolone, abatacept, adalimumab, chloroquine etanercept, golimumab, infliximab, leflunomide, rituximab, sulfasalazine, colchicine, or derivatives thereof. Preferably, the chemotherapeutic compound is selected from methotrexate, dexamethasone or prednisolone.

In a particularly preferred embodiment of the invention, the quinone methyl triterpenoid has a structure represented by formula (IIIa) or (IIIb):

the anti-arthritis compound may be administered before, after or simultaneously with the quinone methyl triterpenoid, in particular before or simultaneously with the quinone methyl triterpenoid, further preferably simultaneously with the quinone methyl triterpenoid.

The method of the invention may comprise the following steps prior to administration of the quinone methyl triterpenoid having the structure of formula (I), in particular of formula (II), (IIIa) or (IIIb):

● obtaining a sample from the subject, in particular synovial fibroblasts;

● testing the sample, including at least one of:

-expression of at least one ABC-protein, in particular P-glycoprotein;

-a functional activity of at least one ABC-protein, in particular of P-glycoprotein;

-expression of at least one pro-or anti-apoptotic protein, in particular at least one selected from p53, Bax or Bak;

-the pro-apoptotic activity of at least one pro-or anti-apoptotic protein, in particular at least one selected from p53, Bax or Bak;

● optionally correlating the expression and/or functional activity of the at least one ABC-protein, in particular P-glycoprotein, and/or the expression or activity of at least one pro-or anti-apoptotic protein with the outcome, if appropriate, administering to the subject a quinone methyl triterpenoid, in particular a quinone methyl triterpenoid having the structure of formula (II), (IIIa) or (IIIb), alone or in combination with a chemotherapeutic compound.

The person skilled in the art is aware of methods for determining the expression of P-glycoprotein or its functional activity, such as antibody assays and efflux assays, e.g. by incubating the cells with a dye such as rhodamine 123. The person skilled in the art is also aware of methods for detecting the expression or activity of pro-or anti-apoptotic proteins.

According to the present invention there is also provided a compound having the structure of formula (I), in particular a compound of formula (II), (IIIa) or (IIIb), for use as a medicament in the treatment of refractory rheumatoid arthritis, in particular for P-glycoprotein dependent refractory rheumatoid arthritis or apoptosis-deficient refractory rheumatoid arthritis. The compounds having the structure of formula (I), in particular the compounds having the structure of formula (II), (IIIa) or (IIIb), can be used in an effective amount for the treatment of an animal or human, in particular a mammal, preferably a human.

Another aspect of the present invention relates to the use of a compound having the structure of formula (I), in particular a compound having the structure of formula (II), (IIIa) or (IIIb), for the manufacture of a medicament for the treatment of refractory rheumatoid arthritis, in particular P-glycoprotein dependent refractory rheumatoid arthritis and/or apoptosis-deficient refractory rheumatoid arthritis. In particular, apoptosis-deficient refractory rheumatoid arthritis is associated with the p53 mutation. The compound of formula (I), in particular the compound of formula (II), (IIIa) or (IIIb), may be used in combination with at least one further therapeutic compound, preferably a therapeutic compound for the treatment of rheumatoid arthritis, for example an anti-arthritic compound.

The invention also relates to methods of treating refractory rheumatoid arthritis using compounds having the structure of formula (I), specifically compounds having the structure of formula (II), (IIIa) or (IIIb), as inhibitors of P-glycoprotein efflux pump or calcium mobilization agents. The method comprises using an effective amount of the compound for inhibiting P-glycoprotein or promoting calcium mobilization in synovial fibroblasts, particularly multidrug resistant RASFs, thereby initiating cell death and alleviating the associated symptoms.

In another aspect of the invention, there is provided a method for inducing autophagy of synovial fibroblasts, in particular multidrug resistant Rheumatoid Arthritis Synovial Fibroblasts (RASF), comprising contacting a population of synovial fibroblasts with a quinone methyl triterpenoid or a salt, solvate or anhydrate thereof as described above. Specifically, cell death of synovial fibroblasts is induced or growth of synovial fibroblasts is inhibited. MTT assays or flow cytometry assays can be used to measure the effect on cell death and cell viability.

Synovial fibroblasts are ABC-protein dependent, as described above, and most preferably P-glycoprotein dependent and/or apoptosis deficient as described above. In one embodiment of the invention, the synovial fibroblast is a rheumatoid arthritis synovial fibroblast, and specifically contains a p53 mutant.

In embodiments of the invention, synovial fibroblast resistance refers to resistance to anti-arthritic compounds as described above or to at least 1.2-fold resistance to conventional therapeutic agents or to at least 1.2 resistance factors.

The concentration of quinone methyltrerpenoid for contacting synovial fibroblasts can be 0.1. mu.M to 5. mu.M, preferably 0.1. mu.M to 2. mu.M, specifically 0.25. mu.M, 0.5. mu.M, 0.75. mu.M, 1. mu.M, 1.25. mu.M, 1.5. mu.M or 2. mu.M. Synovial fibroblasts are preferably contacted with the quinone methyl triterpenoid of the invention for at least 10 minutes, at least 15 minutes, at least 30 minutes, or at least 60 minutes.

Preferably, the IC of quinone methyltricherpenoids against multidrug resistant RASFs₅₀Is at most 5. mu.M, more preferably at most 2. mu.M or in particular about 1. mu.M. In one embodiment, the IC is about 72 hours later₅₀About 1. mu.M. The resistance factor of the inventive quinone methyltrerpenoids to multidrug resistant RASFs is preferably less than 1.5 or about 1 ± 0.5. IC of multidrug resistant RASF by treatment of quinone methyl triterpenoids₅₀Divided by its pair of slip filmsIC with fibroblasts not having multidrug resistant phenotype₅₀To calculate the resistance factor. Resistance factor<1 indicates that the compounds are particularly effective in treating refractory rheumatoid arthritis or inducing apoptosis and/or autophagy in ABC-dependent or apoptosis-deficient synovial fibroblasts.

In a particularly preferred embodiment of the invention, the quinone methyltrioterpenoid used to contact synovial fibroblasts has a structure represented by formula (IIIa) or (IIIb):

and, synovial fibroblasts are contacted with said quinone methyltrerpenoid at a concentration of between 0.1 μ M and 2 μ M.

The step of contacting synovial fibroblasts with the quinone methyl triterpenoid of the present invention, especially the quinone methyl triterpenoid having a structure of formula (II), (IIIa) or (IIIb), may be performed by adding a culture solution containing the compound having a structure of formula (I), (II), (IIIa) or (IIIb) to the synovial fibroblasts. The incubation solution may further comprise suitable excipients, such as buffers or suitable growth media.

The method may further comprise contacting a therapeutic compound with the cell, in particular an anti-arthritic compound selected from the group consisting of: methotrexate, dexamethasone, prednisolone, Abeticept, adalimumab, etanercept, golimumab, infliximab, rituximab, leflunomide, sulfasalazine, colchicine, or derivatives thereof. Preferably, the growth of multi-drug resistant RASFs is inhibited or cell death is induced.

In another aspect, the invention relates to a method of inducing calcium in synovial fibroblasts, in particular multidrug resistant RASFs. The method comprises contacting a population of synovial fibroblasts with a quinone methyltrioterpenoid or a salt, solvate or anhydrate thereof as described above.

Synovial fibroblasts are as described above, in particular synovial fibroblasts are multidrug resistant Rheumatoid Arthritis Synovial Fibroblasts (RASFs). In one embodiment, synovial fibroblasts have at least an ABC-protein dependent or apoptotic defect. Preferably, the synovial fibroblasts are P-glycoprotein dependent and have P-gp overexpression. In another embodiment, the synovial fibroblasts are apoptotic-deficient and contain a p53 mutant and have overexpression of an anti-apoptotic protein and/or reduced expression of a pro-apoptotic protein.

The inventors have found that quinone methyl triterpenoids effectively affect calcium homeostasis in synovial fibroblasts. In particular, quinone methyltrerpenoids increase the level of free calcium ions in the cytoplasm in Rheumatoid Arthritis Synovial Fibroblasts (RASF) by inhibiting the Salico/endoplasmic reticulum (Ca 2+ -ATPase). Thus, the inventive quinone methyltrioterpenoids further contribute to the death of RASF cells.

The concentration of quinone methyltrerpenoid for contacting synovial fibroblasts can range from 0.1 μ M to 2 μ M, especially 0.1 μ M, 0.2 μ M, 0.5 μ M, 1 μ M or 2 μ M. Preferably, the quinone methyl triterpenoids of the present invention and synovial fibroblasts are contacted for a minimum of 10 minutes, 15 minutes, 30 minutes or 60 minutes.

Preferably, the synovial fibroblasts are contacted with a quinone methyl triterpenoid having a structure represented by formula (IIIa) or (IIIb):

wherein the synovial fibroblasts are preferably contacted with the quinone methyl triterpenoid at a concentration of between 0.1 μ M and 2 μ M.

In addition, the present invention relates to a pharmaceutical composition comprising an effective amount of

(i) Quinone methyl triterpenoids as described above; and

(ii) at least one chemotherapeutic compound selected from the group consisting of: methotrexate, dexamethasone, prednisolone, Abeticept, adalimumab, etanercept, golimumab, infliximab, rituximab, sulfasalazine, leflunomide, colchicine, and derivatives thereof; preferably selected from the group consisting of methotrexate, linoleic acid, prednisolone and derivatives thereof.

The pharmaceutical composition may further comprise an excipient, especially a pharmaceutically acceptable excipient, such as a carrier, a salt, a buffer, water or a combination thereof. The skilled person will be able to select suitable excipients.

The inventive quinomethyltrerpenoid compounds can be administered to a subject, preferably a human, in solid, semi-solid or liquid form by oral, rectal, topical, intravenous, transdermal or inhalation routes.

Preferably, the quinone methyl triterpenoid has a structure represented by formula (IIIa) or (IIIb):

and the anti-arthritis compound is methotrexate, dexamethasone, prednisolone or its derivatives.

Examples

Example 1 Induction of autophagy

In these cases, all Rheumatoid Arthritis Synovial Fibroblasts (RASFs) were isolated from rheumatoid patients, while immortalized rheumatoid arthritis synovial fibroblasts (RAFLS) were derived from primary Rheumatoid Arthritis Synovial Fibroblasts (RASFs).

To detect endogenous expression of autophagy-related protein LC3-II, RASFs or RAFLS cell lines were treated and fixed at specific times using tripterine (CEL) at specified concentrations, followed by fluorescent staining of the protein-bound anti-mouse antibody using LC3-II and photographing using red fluorescence under a fluorescent microscope.

Flow cytometry analysis was applied. Cell death and survival were determined using Annexin V staining kit (BD Biosciences, san jose, CA, usa).

Briefly, RAFLS was treated with 0-2 μ M tripterine for 24 hours. Cells were then harvested and stained with FITC-labeled Annexin V and propidium iodide (BD Biosciences, San Jose, CA, USA) according to the reagent instructions and analyzed by multiparameter flow cytometry. Flow cytometry was performed using a flow cytometer (BD Biosciences, San Jose, CA, USA). Data collection and analysis was performed by CellQuest (BD Biosciences, San Jose, Calif., USA), all from three independent experiments.

Although synovial fibroblasts in rheumatoid arthritis generally have anti-apoptotic ability, tripterine exhibits considerable cytotoxicity in RASFs and RAFLS. Referring to fig. 1A and 1B, tripterine induced autophagy is time-dependent. As shown in figures 2A,2B,3A and 3B, the red dots indicate the percentage of progressively increasing expression of endogenous LC3-II, as well as the dose-dependent cytotoxicity of tripterine in RAFLS. These results indicate that tripterine has a direct correlation between synovial fibroblast-mediated cell death and autophagosome accumulation.

Example 2 mobilization of cytosolic calcium induced autophagy

The plasma calcium ion concentration was determined kinetically using the FLIPR calcium 6 kit (Molecular Devices) according to the kit instructions. Briefly, RASFs were plated at 10000 cells per well in black-wall/white-bottom 96-well plates (Tewksbury, MA, USA) for 24 hours, after which the calcium 6 reagent was added directly to the cells and incubated at 37 ℃ and 5% carbon dioxide for 2 hours. Tripterine or thapsigargin at various concentrations was added to 96-well plates immediately prior to data collection (Molecular Devices) using a Spectramax Paradigm multimodal microplate reader, and values were read at room temperature using a 1 second reading interval.

Cytosolic calcium levels were determined using flow cytometry. Intracellular free calcium was measured by a Fluo-3 fluorescent dye. Briefly, RAFLS was treated with Celastrol (1. mu.M) for 4 hours and washed twice with DMEM medium, then the cell suspension was incubated at 37 ℃ for 5. mu.M Fluo-330 min. Cells were then washed twice with HBSS. Then, the suspension cells are analyzed by a flow cytometer, and the number of the cells cannot be less than 10000.

RAFLS cells were cultured in varying concentrations of celastrol in the presence or absence of calcium chelator (BM) for 24 hours to determine endogenous expression of LC3-II protein. The cells were then fixed and stained with LC3-II antibody followed by TRITC complex anti-mouse secondary antibody and photographed under a fluorescent microscope. After collection and lysis of cells using lysate (Cell Signaling Technologies Inc. (Beverly, MA), Cell lysate was subjected to SDS-PAGE after electrophoresis, proteins in SDS-PAGE were transferred to nitrocellulose membrane, which was then blocked with 5% skim milk powder for 60 minutes, the membrane was incubated with TBST diluted LC3 primary antibody (1:1000), after shaking overnight at 4 ℃, further incubated with HRP complexed secondary antibody for 60 minutes, and finally protein bands were visualized using ECL Western blotting detection reagent (Invitrogen, Paisley).

AnnexinV flow cytometry analysis. Cell death and survival were determined using Annexin V staining kit (BD Biosciences, San Jose, CA, USA). Briefly, RAFLS was treated with 1 or 2 μ M tripterine for 24 hours in the presence or absence of the autophagy inhibitor 3-MA and the calcium chelator BAPTA/AM (BM). Cells were then harvested according to kit instructions and analyzed using a multiparameter flow cytometer for cells stained with FITC-Annexin V and propidium iodide (BD Biosciences, San Jose, Calif., USA). Data collection and analysis were performed using CellQuest (BD Biosciences, San Jose, Calif., USA). All data were from three independent experiments.

The inventors used a flow cytometry analysis of Fluo-3 dye staining to study the calcium levels of tripterine mobilization in synovial fibroblasts from rheumatoid arthritis. Referring to fig. 4 and 5, the expression of calcium ions was determined by flow cytometry analysis in tripterine-intervened RAFLS using Fluo 3-AM, which indicates that tripterine is time and dose dependent on calcium homeostasis interference in RASFs and RAFLS.

The inventors further investigated whether tripterine can also inhibit the calcium dynamics of SERCA. According to the results shown in FIG. 6, the SERCA inhibitor Thapsigargin (TG) can obviously induce the dynamic change of calcium in RASFs, and the stimulation effect of the tripterine on the dynamic change of the calcium is weaker. In addition, AMPK inhibitors have no inhibitory effect on tripterine-induced calcium dynamics, whereas RASFs pretreated with TG may turn off SERCA activity and have very low calcium mobilization response after tripterine treatment, suggesting that tripterine may target the enzyme sarcoplasmic reticulum calcium adenosine triphosphate (SERCA) to play this role.

As shown in the figure. As shown in FIGS. 7A and 7B, Ca²⁺The chelator (BAPTA/AM) significantly inhibited tripterine-induced endogenous LC3-II spot formation in RAFLS and inhibited LC3-II transformation in RASF, FIG. 8. As shown in figures 9A to 9H in the AnnexinV assay, BAPTA/AM or the autophagy inhibitor 3-MA completely abolished tripterine-mediated autophagic cell death. These findings support tripdiolide-induced autophagy by mediating SERCA to increase cytosolic free calcium ions, while explaining the relationship between tripdiolide-induced autophagic death and calcium ions in RASFs and RAFLS cell lines.

Example 3 inhibition of apoptosis-deficient RAFLS by Tripterine

RAFLS transfected with mutant gene p53 was lysed with RIPA lysis buffer. Protein concentrations were determined using the Bio-Rad protein assay (Bio-Rad Laboratories, Inc., Hercules, Calif., USA). Cell lysate samples were electrophoresed on SDS polyacrylamide gels and transferred to enhanced chemiluminescent nitrocellulose membranes (Amersham Biosciences, Piscataway, N.J.) and blocked with 5% skim milk powder protein for 1 hour. The membrane was then incubated with the apoptosis-labeled antibody overnight at 4 ℃. Binding of the antibodies was visualized by peroxidase-conjugated secondary antibodies via ECL western blot detection reagent (Invitrogen, Paisley, Scotland, UK). The band strength was quantified by using the software ImageJ (NIH, Bethesda, MD, USA).

Cytotoxicity assays were performed. All test compounds were dissolved in DMSO at a final concentration of 50mmol/L and stored at-20 ℃ prior to use. Cytotoxicity was assessed using a 3- (4, 5-dimethylthiazol-2-yl) -2, 5-diphenyltetrazolium bromide (MTT) (5.0mg/ml) assay. Briefly, in the pharmaceutical treatmentPreviously, wells were inoculated with 4000 RAFLS transfected cells transfected with mutant gene p53 in 96-well plates. After overnight incubation, cells were exposed to varying concentrations of test compound (0.039-100. mu. mol/L) for 72 hours. Cells without drug treatment were used as controls. Subsequently, MTT (10. mu.L) was added to each well and incubated at 37 ℃ for 4 hours, followed by addition of 100. mu.L of solubilization buffer (10% SDS in 0.01mol/L HCl) and overnight incubation. The following day A was measured from each well₅₇₀. The percentage of cell viability was calculated using the following formula: cell viability (%) ═ a_{Treatment of}/A_ControlX 100. Data were obtained from experiments independent of triplicate.

Clinical studies report that a number of somatic mutations in the p53 tumor suppressor gene were found in synovial membranes of rheumatoid arthritis patients. Some of these dominant negative p53 mutations were associated with inflammatory cytokine production and apoptotic mediators, Bax inhibition, which may further potentiate the development of refractory rheumatoid arthritis. The inventors therefore over-expressed the rheumatoid arthritis hotspot p53 mutants N239S and R213 in RAFLS and determined the expression of apoptosis markers. As expected, as shown in fig. 10A to 10C, the apoptosis markers PARP, Bax and Bak were all down-regulated in p53 mutants transfected with RAFLS, while the anti-apoptosis markers C-IAP1, TRAF and Bcl-2 were up-regulated, indicating the presence of an apoptotic drug-resistant phenotype in p 53-transfected RAFLS. As shown in table 1, tripterine showed the same cytotoxic potency against these RAFLS with or without p53 transfection, whereas the p53 mutant RAFLS showed resistance to methotrexate. These results indicate that triptolide inhibits apoptosis-resistant RAFLS independent of the p53 state.

TABLE 1 results of cytotoxicity assays show resistance of RAFLS transfected with p53 mutant to methotrexate and tripterine.

Example 4 inhibition of P-glycoprotein dependent RAFLS and its P-glycoprotein

P-gp levels were determined in normal and rheumatoid arthritis patients by RT-PCR. By passingFicoll-Paque (GE Healthcare life sciences) isolated human lymphocytes from peripheral blood. Total RNA was isolated from lymphocytes using Trizol reagent (Ambion, Carlsbad, CA, USA). RNA concentration was assessed by absorbance readings using a Nano-Drop2000 spectrophotometer (Thermo Scientific, Fremont, CA, USA). Reverse transcription of RNA was performed using Transcriptor Universal cDNA Master (Roche, USA). Real-time PCR of ABCB5mRNA Using Applied Biosystems ViiA^TM7 real-time fluorescent quantitative PCR system (ABI, USA), and monitoring cDNA amplification by SYBR Green fluorescence assay; real-time PCR was performed in a total volume of 20 μ Ι _: containing 2. mu.L of cDNA, 0.3. mu.L of forward primer (10. mu.M), 0.3. mu.L of reverse primer (10. mu.M), 10. mu.L of SYBR select Master Mix (ABI, Austin, TX, USA), sterile water was added to the reaction mixture. The PCR reaction was started after 10 min denaturation at 95 ℃ followed by 40 cycles of 15 sec denaturation at 95 ℃ and 60 sec annealing at 60 ℃.

Hu-ABCB5-F:ATGTACAGTGGCTCCGTTCC(SEQ ID NO:1)

Hu-ABCB5-R:ACACGGCTGTTGTCACCATA(SEQ ID NO:2)

All test compounds were dissolved in DMSO at a final concentration of 50mmol/L and stored at-20 ℃ prior to use. Cytotoxicity was assessed using a 3- (4, 5-dimethylthiazol-2-yl) -2, 5-diphenyltetrazolium bromide (MTT) (5.0mg/ml) assay. Briefly, 4000 RAFLS cells over-expressed with P-gp per well were seeded in 96-well plates prior to drug treatment. After overnight incubation, cells were exposed to varying concentrations of test compound (0.039-100. mu. mol/L) for 72 hours. Cells without drug treatment were used as controls. Subsequently, MTT (10. mu.L) was added to each well and incubated at 37 ℃ for 4 hours, followed by addition of 100. mu.L of solubilization buffer (10% SDS in 0.01mol/L HCl) and overnight incubation. Selection A the following day₅₇₀The absorbance of each well was measured at nm. The percentage of cell viability was calculated using the following formula: cell viability (%) ═ a_{Treatment of}/A_ControlX 100. Data were from three independent experiments.

The activity of P-gp ATPase expressed in celastrol or verapamil was determined by the Pgp-Glo assay system (Promega, Madison, Wis.). The inhibition of P-gp ATPase activity by celastrol was measured in the presence of verapamil (as a positive stimulator) according to the reagent instructions. Luminescence of the samples reflects ATP levels in the samples, which are inversely correlated with P-gp ATPase activity, and recorded using a Spectramax Paradigm MultiModel microplate reader (Molecular Devices). The activity of the DMSO treatment is expressed as a percentage of the basal activity. By comparing the basal activity to the activity of the test compound treatment, the compound can be classified as stimulating, inhibiting or not affecting basal P-gp ATPase activity.

A rhodamine 123 exclusion assay was performed. RAFLS overexpressing P-gp was inoculated in 6-well plates to a final concentration of 2X 10⁵Individual cells/well, 5% CO at 37 ℃₂Cultured for 24 hours under the conditions of (1). When the cells were confluent, 3mL of fresh medium (with or without 0.2,0.5 and 1. mu.M tripterine) or 10. mu.M verapamil (a known P-gp inhibitor) was added and incubated at 37 ℃ for a further 24 hours. Subsequently, 3mg/mL Rho123 was added to each well, followed by 1 hour incubation at 37 ℃. At the end of incubation, cells were washed 5 times with ice-cold PBS to stop the accumulation of Rho 123. After cell centrifugation, the cell pellet was resuspended in 400 μ L PBS. Intracellular fluorescence was measured using a flow cytometer at an excitation wavelength of 488nm and an emission wavelength of 525 nm. All data collection and analysis were performed in triplicate with CellQuest (BD Biosciences, San Jose, Calif., USA) and the results are shown as the mean of fluorescence intensity.

Annexin V flow cytometry analysis was performed. Cell death and survival were measured using Annexin V staining kit (BD Biosciences, San Jose, CA, USA). Briefly, RAFLS was treated with 0.1 or 0.2 μ M tripterine for 24 hours in the presence or absence of 450 μ M Methotrexate (MTX). Cells were then harvested and analyzed by staining with FITC-Annexin V and propidium iodide (BD Biosciences, San Jose, CA, USA) in multiparameter flow cytometry according to the manufacturer's instructions. Flow cytometry was then performed using a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA, USA). Data collection and analysis were performed with CellQuest (BD Biosciences, San Jose, Calif., USA). Data were obtained from three independent experiments.

Clinical studies have shown that a high percentage of P-gp expression is present in peripheral blood lymphocytes from patients with rheumatoid arthritis treated with DMARDs, and these patients eventually develop resistance to severe inflammatory states. Referring to fig. 11, clinical data also supports these findings: of 7 rheumatoid arthritis patients, 5 rheumatoid arthritis patients showed high P-gp expression in their blood lymphocytes, while of 10 non-rheumatoid arthritis patients, only 1 non-rheumatoid arthritis patient was found to have P-gp overexpression, which suggests that P-gp may be ubiquitous in rheumatoid arthritis patients.

The present inventors cloned and overexpressed P-gp in RAFLS and determined the cytotoxic effects of tripterine. Referring to table 2, P-gp overexpressing RAFLS showed cross-resistance to methotrexate, dexamethasone, prednisolone and colchicine at some level, but no cross-resistance to celastrol, indicating that celastrol is not excluded by P-gp activity.

Table 2. cytotoxicity test results show the resistance of P-gp dependent RAFLS to MTX, DEX, prednisolone and triptolide.

Medicine	RAFLS	RAFLS p-gp overexpression	Drug resistance factor
				Methotrexate (MTX)	219μM	838μM	3.83
Dexamethasone (DEX)	600μM	>2000μM	3.33
				Prednisolone	123μM	216μM	1.76
Colchicine	11.3M	46 M	4.07
				Tripterine	1.3μM	1.45μM	1.12

The activity assay of P-gp Glo further verifies that tripterine directly inhibits the activated form of P-gp in a dose-dependent manner, as shown in FIG. 12, it is concluded that tripterine is a novel P-gp inhibitor.

The results obtained from the function measurement of rhodamine 123(Rho123) are shown in FIGS. 13A to 13H. Under normal conditions, more than 80% of the RAFLS accumulates Rho123 dye. When RAFLS was transfected with P-gp expression constructs, about 50% of the P-gp overexpressing RAFLS accumulated Rho123, and the addition of the P-gp inhibitor verapamil increased Rho123 accumulation by about 80%. Interestingly, relatively low doses of tripterine gradually increased Rho123 accumulation in a dose-dependent manner, fig. 13I. In addition, a non-toxic dose of tripterine (0.1-0.2 μ M) inhibited the function of overexpressed P-gp and prevented it from pumping out MTX, thereby enhancing the toxicity of MTX in P-gp overexpressing RAFLS (fig. 14A to 14G). In general, tripterine is able to circumvent the MDR phenotype in drug resistant RAFLS by directly inhibiting P-gp activity.

Example 5 adjuvant-induced arthritis inhibition by calcium mobilization (AIA)

An adjuvant-induced arthritis (AIA) rat model was used. The experiments were carried out by purchasing male Sprague Dawley (SD) rats at 6 weeks of age weighing 130 + -20 g from the Guangdong center for medical laboratory animals. The animals were placed in a 12 hour light/dark cycle and temperature controlled room with food and water ad libitum.

Arthritis was induced in rats by vaccination with Complete Freund's Adjuvant (CFA). Dried viable Mycobacterium tuberculosis (BD, USA) was emulsified in mineral oil (Sigma, USA) containing 5mg/ml Mycobacterium tuberculosis and ground in one direction on ice. Emulsions prepared with these adjuvants should have a consistency consistent with whipped cream consistency and not disperse quickly when a drop of the emulsion is placed on the surface of a water-filled beaker. Briefly, 100 μ L of emulsified oil was injected intradermally into the tail root of the rat. The first sign of inflammation was observed on day 9 after adjuvant injection. Arthritis scores were assessed and recorded every three days. Each paw was scored on a scale of 0-4, respectively, as follows: 0, no signs of erythema and swelling; erythema and mild swelling localized to the tarsal bones or ankle joints; erythema and mild swelling extending from the ankle to the tarsal bones; 3, erythema and moderate swelling extending from the ankle to the metatarsal joints; erythema and severe swelling including ankles, feet and figures, or a stiff limb 4.

50 male rats were randomly divided into 6 experimental groups: (1) healthy control group (n ═ 8); (2) vehicle control group (n ═ 10), AIA group rats received the same vehicle and route of administration in each respective experiment; (3) positive control group (n ═ 8), AIA group rats were gavaged with MTX 7.6 mg/kg/week in a volume of 10mL/kg body weight. (4) AIA rats were treated with 1mg/kg tripterine (cel) (n ═ 8); (5) AIA rats were treated with 2mg/kg tripterine (cel) (n ═ 8); (6) AIA rats were treated with 1mg/kg tripterine (cel) +3.5mg/kg BAPTA/AM (BM) (n ═ 8). AIA rats were treated by intraperitoneal injection of celastrol. Once daily for the first 19 days, then every 2 days until 36 days, while BM is treated on a daily basis. In the formula(PEG400:H₂Tripterine (chinese achievements MUST, a0106) and BAPTA/AM (Santa cruz, USA) were diluted in ethanol (6: 3:1) and administered intraperitoneally in a volume of 1mL/kg body weight. Methotrexate (MTX) was dissolved in propylene glycol, Tween-80 and normal saline in a ratio of 50:5: 45.

The left hind paw was fixed in 4% PFA and scanned using an in vivo micro CT scanner (SkyScan 1176, Bruker, Belgium). High quality images of rat joints were obtained using the following scan parameters: 35 μm resolution, 85kV, 385 μ A, 65ms exposure time, 360 ° rotation in 0.7 ° steps and 1mm Al filter. Images were reconstructed using nreco software (Bruker-micro CT, Belgium). As shown in fig. 15A and 15B, the in vivo efficacy of tripterine inhibited by SERCA was further demonstrated in an AIA rat model. Tripterine significantly reduced the arthritis score and hindpaw volume in rats without compromising body weight or organ weight compared to vehicle-treated AIA, FIGS. 16 and 17.

Obviously, the addition of the calcium chelating agent BAPTA/AM slows down the anti-arthritis effect of tripterine. As in fig. 15A and 15B. Referring to fig. 18, the Erythrocyte Sedimentation Rate (ESR), an indicator of inflammation after celastrol and MTX treatment, was also down-regulated in the AIA model.

In the microCT analysis, as shown in fig. 19, severe swelling joint and cartilage destruction were observed in the AIA model, and these inflammatory conditions were significantly improved after MTX and tripterine treatment, whereas the AIA model treated with tripterine plus BAPTA/AM showed swelling joint and bone damage compared to tripterine treatment alone. Taken together, the results suggest that the anti-arthritic effects of tripterine may be due to SERCA inhibition and calcium mobilization.

Claims

1. Use of a quinone methyltrerpene compound or a salt, solvate or anhydrate thereof in the manufacture of a medicament for the treatment of refractory rheumatoid arthritis, wherein the quinone triterpenoid compound has a structure represented by formula (I):

wherein the content of the first and second substances,

-

represents a single or double bond;

-R¹is selected from-CH₃、-CH₂OH, -OH or-H;

-R²is selected from-CH₃、-CH₂OH、-OH、-COOH、-COOCH₃、＝CH₂or-H;

-R³selected from-OH, ═ O, or-H;

-R⁴is selected from-OH or-H;

-R⁵is selected from-OH or-H;

wherein the refractory rheumatoid arthritis is associated with a p53 mutation and is resistant to methotrexate.

2. The use of claim 1, wherein the refractory rheumatoid arthritis is at least one of (i) ABC-protein dependent refractory rheumatoid arthritis or (ii) refractory rheumatoid arthritis lacking apoptosis.

3. The use of claim 1, wherein the refractory rheumatoid arthritis is P-glycoprotein dependent refractory rheumatoid arthritis.

4. The use according to claim 1, wherein the quinone methyl triterpenoid has the structure represented by formula (II):

wherein:

-R¹is selected from-CH₃or-CH₂OH；

-R²Selected from-COOH or-COOCH₃；

-R³Selected from-OH, ═ O, or-H.

5. Use according to claim 1, wherein the quinone methyl triterpenoid has the structure represented by formula (IIIa):

6. the use according to claim 5, wherein the quinone methyl triterpenoid has the structure represented by formula (IIIb):

7. use according to claim 1, wherein the quinone methyl triterpenoid is prepared in a medicament with at least one anti-arthritic compound selected from methotrexate, dexamethasone, prednisolone, Abeticept, adalimumab, chloroquine, etanercept, golimumab, infliximab, leflunomide, rituximab, sulfasalazine, colchicine or derivatives thereof.

8. The use according to claim 7, wherein the quinone methyl triterpenoid has a structure represented by formula (IIIa) or (IIIb):

9. use according to claim 1, wherein the concentration of the quinone methyl triterpenoid in the medicament is from 0.1 μ M to 2 μ M.

10. The use of any one of claims 1-9, wherein the medicament is further for inducing synovial fibroblast autophagy.

11. The use of claim 10, wherein the synovial fibroblast is a multidrug resistant rheumatoid arthritis synovial fibroblast, and is at least one of (i) P-glycoprotein dependent or (ii) deficient in apoptosis.