CN109212205A - Pseudorabies virus gC protein antibodies, the kit containing the antibody and application - Google Patents

Pseudorabies virus gC protein antibodies, the kit containing the antibody and application Download PDF

Info

Publication number
CN109212205A
CN109212205A CN201710515776.0A CN201710515776A CN109212205A CN 109212205 A CN109212205 A CN 109212205A CN 201710515776 A CN201710515776 A CN 201710515776A CN 109212205 A CN109212205 A CN 109212205A
Authority
CN
China
Prior art keywords
antibody
monoclonal antibody
variable region
pseudorabies virus
albumen
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710515776.0A
Other languages
Chinese (zh)
Other versions
CN109212205B (en
Inventor
田克恭
王莹
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Luoyang Pu Laikewantai Bioisystech Co Ltd
Original Assignee
Luoyang Pu Laikewantai Bioisystech Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Luoyang Pu Laikewantai Bioisystech Co Ltd filed Critical Luoyang Pu Laikewantai Bioisystech Co Ltd
Priority to CN201710515776.0A priority Critical patent/CN109212205B/en
Publication of CN109212205A publication Critical patent/CN109212205A/en
Application granted granted Critical
Publication of CN109212205B publication Critical patent/CN109212205B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens

Abstract

The present invention relates to the variable region sequences of the mouse monoclonal antibody of specific binding pseudorabies virus gC albumen, are the variable region sequences of mouse monoclonal antibody 1B9 or the variable region sequences of mouse monoclonal antibody 1F2；The invention further relates to by the variable region sequences weight chain variabl area sequence or its conservative variant, and/or its corresponding pseudorabies virus gC protein antibodies that respectively light-chain variable sequence or its conservative variant form in the variable region sequences.With the antibody establish ImmunohistochemistryMethods Methods solve the problems, such as PCR cannot tissue and into the cell carry out expliciting the position, DYNAMIC DISTRIBUTION, qualitative and half-quantitative detection of the cause of disease in body can not be tracked.Kit containing the antibody accurately detects the content of PRVgC albumen based on the sandwich principle of double monoclonal antibodies, and overcoming after PRVgC albumen and other albumen expressing in series or amalgamation and expression can not the technical problem that can not verify of accurate quantitative analysis, expected expression effect.

Description

Pseudorabies virus gC protein antibodies, the kit containing the antibody and application
Technical field
The invention belongs to herding class biopharmaceutical technologies, are related to pseudorabies virus gC protein antibodies, containing the antibody Kit and application.
Background technique
Porcine pseudorabies, also known as AujeszkyShi disease, are by the pig in herpetoviridae (Herpesviridae) α subfamily Simplex Virus Type I (Suid herpesvirus type I, also known as pseudorabies virus Pseudorabies virus, PRV) institute A variety of domestic animals such as caused pig, ox, sheep, dog, cat, rabbit, mouse, wild boar, ermine, bear, fox, wild animal one kind to generate heat, surprise itches (in addition to pig) and encephalomyelitis are the acute infectious disease of primary symptom.
The pseudoabies of pig is widely present in China, and harm is serious, be restrict large-scale pig farm production principal disease it One, pregnant sow miscarriage, stillborn foetus or the mummification of fetus, piglet can be caused nervous symptoms, paralysis and big-and-middle porcine respiratory disease occur Shape etc., particularly the death rate is up to 100% after infection in 20 week old.Research shows that the Asia based on PRVgB, gC, gD albumen is single Position vaccine can provide corresponding protection to immune animal especially pig, pig can not only be made from the invasion of porcine pseudorabies, also The invasion for the pseudoabies that pig can be made to be caused from porcine pseudorabies virus variant；Particularly in three kinds of albumen the two or The expressing in series or amalgamation and expression effect of three is the most significant.But after genetic engineering means expressing in series or amalgamation and expression Problem existing for albumen is to be only capable of the total protein content by after common BCA or Bradford method quantitative expression, and nothing The content of the respective protein expression of method accurate quantitative analysis, and not can determine that whether each albumen reaches expected expression effect, so as to cause Subunit vaccine can not be prepared.
The clinical detection of PRV cause of disease is mainly polymerase chain reaction PCR method, primer involved in the method, enzyme at present Deng being mostly external import and costly, so that farm is especially small-scale or casual household's cultivation is hung back；In addition the method Though the diagnosis of epidemic disease is widely used in, since it cannot organize and carry out expliciting the position into the cell, can not track cause of disease in machine DYNAMIC DISTRIBUTION, the half-quantitative detection of body, to limit application of the PCR in Histopathology.
According to general knowledge known in this field, it can be used in the antibody meeting of immunohistochemistry (Immunohistochemistry, IHC) It is made in its operation instructions and clearly identifies and indicate, it is most of all to cannot be used for IHC inspection shown in the explanation by these antibody It surveys.Although individual antibody, which is indicated, can be used for IHC, our practical application discoveries are really not so.These antibody are research examination Agent is not tested or is verified by great amount of samples clinical case, and the not crucial positioning to virus infection tissue or cell is examined Survey ability causes trouble for the accurate investigation of epidemiology and preventing, treating for later period.
Summary of the invention
It is anti-the technical problem to be solved by the present invention is in view of the deficiencies of the prior art, provide pseudorabies virus gC albumen Body, the kit containing the antibody and application.
For this purpose, first aspect present invention provides the mouse monoclonal antibody of specific binding pseudorabies virus gC albumen Variable region sequences are the variable region sequences of mouse monoclonal antibody 1B9 or the variable region sequences of mouse monoclonal antibody 1F2.
In some embodiments of the invention, in the variable region sequences of mouse monoclonal antibody 1B9, heavy chain variable region amino Acid sequence is amino acid sequence shown in SEQ ID No.2 or the sequence by one or more amino acid additions, deletion, replacement Or the conservative variant that modification conservative mutation obtains；And/or chain variable region amino acid sequence is shown in SEQ ID No.4 Amino acid sequence or the sequence by one or more amino acid additions, delete, replacement or modification conservative mutation obtain Conservative variant.
In other embodiments of the invention, in the variable region sequences of mouse monoclonal antibody 1F2, heavy chain variable region ammonia Base acid sequence is that amino acid sequence shown in SEQ ID No.6 or the sequence are added, delete, replaced by one or more amino acid Change or modify the conservative variant of conservative mutation acquisition；And/or chain variable region amino acid sequence is SEQ ID No.8 institute The amino acid sequence shown or the sequence are obtained by one or more amino acid additions, deletion, replacement or modification conservative mutation Conservative variant.
Second aspect of the present invention provides pseudorabies virus gC protein antibodies, can be changed as described in first aspect present invention Light-chain variable sequence in weight chain variabl area sequence or its conservative variant and/or the variable region sequences in region sequence Or its conservative variant composition；The segment of the antibody or the antibody still keeps the energy of specific binding pseudorabies virus Power.
According to the present invention, the antibody is monoclonal antibody or genetic engineering antibody；It is preferred that the genetic engineering antibody packet Include the segment of single-chain antibody, chimeric mAb, reshaping monoclonal antibody, pig resource monoclonal antibody or the antibody；It is preferred that The antibody is mouse monoclonal antibody 1B9 or mouse monoclonal antibody 1F2.
Third aspect present invention provides antibody described in second aspect of the present invention in the puppet for carrying out non-diagnostic purpose Application in hydrophobin detection.
According to the present invention, the pseudorabies virus detection of the non-diagnostic purpose includes epidemiological analysis, in vitro group Knit detected, Epitope Identification research, the semi-finished product of vaccine and product inspection and qualitative and quantitative diagnostic test be containing pseudo- mad dog The detection of pseudorabies virus antigen in the vaccine composition of sick viral antigen and other antigens.
In certain embodiments of the present invention, the pseudoabies disease of non-diagnostic purpose is carried out using the method for immunohistochemistry Poison detection.
In some preferred embodiments of the invention, the method for the immunohistochemistry use mouse monoclonal antibody 1F2 for Primary antibody.
In some further preferred embodiments of the invention, the primary antibody using when make 1:50-1:1000 dilution.
Fourth aspect present invention provides a kind of ELISA kit comprising antibody described in second aspect of the present invention or institute Segment, the pseudorabies virus gC protein standard substance of antibody are stated, and the detection examination for being detected to antigen-antibody reaction Agent.
In some embodiments of the invention, the antibody includes mouse monoclonal antibody 1B9 and mouse monoclonal antibody 1F2, And one of described mouse monoclonal antibody 1B9 and mouse monoclonal antibody 1F2 is coated on microwell plate, the labeled object of another kind Label.
In other embodiments of the invention, the marker includes enzyme, fluorophor or chemiluminescent groups；
In other embodiment of the invention, the detection reagent includes that the bottom of color reaction occurs with the marker Object；Preferably, the detection reagent includes enzyme colour reagent, fluorescent reagent or chemical illuminating reagent.
Some specific embodiments according to the present invention, the kit include the mouse monoclonal antibody 1B9 of enzyme label, use In the mouse monoclonal antibody 1F2 and pseudorabies virus gC protein standard substance of coating microwell plate.
In some specific preferred embodiments of the invention, the package amount of the mouse monoclonal antibody 1F2 is 0.075- 0.15μg/ml；Carry out 1:(1500-9000 when the mouse monoclonal antibody 1B9 use of enzyme label) volume dilution.
Fifth aspect present invention provides a kind of pseudo- using the detection of ELISA detection kit described in fourth aspect present invention The method of the content of hydrophobin gC albumen comprising:
Standard items serial dilutions, measuring samples dilution are added in microwell plate simultaneously, are incubated for by step S1；
Step S2 abandons reaction solution；
Step S3, by the enzyme labelled antibody micropore plate incubation after dilution；
Step S4 abandons reaction solution；
Step S5 adds developing solution, is incubated for；
Step S6 adds terminate liquid, and surveys absorbance value OD with microplate reader450nm；
Step S7 draws standard curve according to the absorbance value of standard items serial dilutions, calculates PRVgC in measuring samples The corresponding content of albumen.
In some preferred embodiments of the invention, the standard items serial dilutions pass through standard items sample is dilute It releases liquid and is diluted to 0-720ng/ml.
In some further preferred embodiments of the invention, the standard items series diluted is 0-360ng/ ml。
Sixth aspect present invention provides a kind of ELISA detection kit as described in the fourth aspect of the present invention in quantitative inspection Survey pseudorabies virus gC albumen holoprotein or its segment or its conservative variant or its active fragment single expression, or and its The application of the content of pseudorabies virus gC albumen when its albumen expressing in series or amalgamation and expression.
The tool of pseudorabies virus gC protein monoclonal antibody provided by the present invention and the kit containing these antibody Have following the utility model has the advantages that solve with the ImmunohistochemistryMethods Methods that the monoclonal antibody is established cannot be in tissue and thin using PCR Progress expliciting the position intracellular, can not track cause of disease the DYNAMIC DISTRIBUTION of body, without legal and half-quantitative detection the problem of；It makes up Existing commercial antibody because test or verify without great amount of samples clinical case without have it is crucial to PRV classics strains, become The detection and localization ability of different strain virus infection tissue or cell, and be thus the accurate investigation and the prevention in later period of epidemiology, Treatment causes the problem of trouble.Kit containing the monoclonal antibody is based on double sandwich principles of monoclonal antibody and accurately detects PRVgC egg White content, overcoming can not accurate quantitative analysis, expected expression effect after PRVgC albumen and other albumen expressing in series or amalgamation and expression The technical problem that fruit can not be verified solves the critical issue for preparing vaccine.
Specific embodiment
To be readily appreciated that the present invention, the present invention is described more detail below.
The present invention relates to the variable region sequences of mouse monoclonal antibody 1B9 for specifically binding pseudorabies virus gC albumen a kind of Column, wherein 1) heavy chain variable amino acid sequence be amino acid sequence or sequence shown in SEQ ID No.2 by one or Multiple amino acid additions are deleted, the conservative variant of replacement or modification conservative mutation acquisition；2) chain variable region amino acid Sequence be amino acid sequence or sequence shown in SEQ ID No.4 by one or more amino acid additions, delete, replacement or Modify the conservative variant that conservative mutation obtains.
The invention further relates to a kind of pseudorabies virus gC protein antibodies, can be changed by the monoclonal antibody 1B9 In region sequence in weight chain variabl area sequence or its conservative variant and/or the variable region sequences light-chain variable sequence or Its conservative variant composition.The antibody can be monoclonal antibody, genetic engineering antibody；Wherein, the genetic engineering is anti- Body includes the segment of single-chain antibody, chimeric mAb, reshaping monoclonal antibody, pig resource monoclonal antibody or the antibody； The segment of the antibody or the antibody still keeps the ability of specific binding pseudorabies virus.
In some preferred embodiments of the invention, the antibody is monoclonal antibody 1B9.
The ELISA potency of the mouse monoclonal antibody 1B9 >=1:1024000, IPMA potency is 1:800, with PRVgC egg Bletilla PRV antigen has good reactivity.
The invention further relates to the variable regions of mouse monoclonal antibody 1F2 for specifically binding pseudorabies virus gC albumen a kind of Sequence, wherein 1) heavy chain variable amino acid sequence is that amino acid sequence shown in SEQ ID No.6 or the sequence pass through one Or the conservative variant that multiple amino acid additions, deletion, replacement or modification conservative mutation obtain；2) light chain variable region amino Acid sequence is amino acid sequence shown in SEQ ID No.8 or the sequence by one or more amino acid additions, deletion, replacement Or the conservative variant that modification conservative mutation obtains.
The present invention is further directed to a kind of pseudorabies virus gC protein antibodies, can by the monoclonal antibody 1F2 Become in region sequence light chain variable region sequence in weight chain variabl area sequence or its conservative variant and/or the variable region sequences The antibody of column or its conservative variant composition；The antibody can be monoclonal antibody, genetic engineering antibody；Wherein, described Genetic engineering antibody includes single-chain antibody, chimeric mAb, reshaping monoclonal antibody, pig resource monoclonal antibody or described anti- The segment of body；The segment of the antibody or the antibody still keeps the ability of specific binding pseudorabies virus.
In some preferred embodiments of the invention, the antibody is monoclonal antibody 1F2.
The ELISA potency of the monoclonal antibody 1F2 >=1:2048000, IPMA potency is 1:12800, with PRVgC egg Bletilla PRV antigen has good reactivity.
Term " gC albumen " used is also known as gIII albumen in the present invention, is the main sugar on mature virion cyst membrane surface One of albumen, gene order about 1.5kb.
Term " monoclonal antibody " used refers to the antibody obtained from substantially homologous antibody population in the present invention, i.e. composition should The antibody individual of group is all identical, in addition to there may be a small amount of possible spontaneous mutations.Therefore, modifier " monoclonal " refers to this The property of antibody is not the mixture of discrete antibody.Preferably, the monoclonal antibody includes unit price or single-chain antibody, double Chain antibody, chimeric antibody, humanized antibody and above-mentioned antibody derivative, functional equivalent and homologue, also include antibody Segment and any polypeptide containing antigen-binding domains." antibody " is to cover appointing for the binding structural domain with required specificity Anticipate Specific binding members, thus, this term cover antibody fragment homologous therewith, derivative, humanized antibody and The functional equivalent and homologue of antibody also include any polypeptide containing antigen-binding domains, either it is natural still It is synthetically produced.The example of antibody is immunoglobulin hypotype (such as IgG, IgE, IgM, IgC and IgA) and its isotype sub-classes；? It can be segment such as Fab, scFv, Fv, dAb, Fd comprising antigen-binding domains；With double-chain antibody (diabodies).Fusion To another polypeptide, chimer molecules comprising antigen-binding domains or equivalent be also included within wherein.Chimeric antibody Cloning and expression describes in EP0120694A and EP0125023A.Antibody can be modified in many ways, can be recombinated with DNA Technology retains the other antibody or chimeric molecule of original antibody specificity to generate.This technology may include by encoding antibody The DNA of immune globulin variable region or complementarity-determining region (CDRs) introduces the constant region of different immunoglobulins or constant region adds Framework region, referring to EP184187A, GB2188638A or EP239400A.To hybridoma or the other of antibody can also be generated Cell carries out genetic mutation or other changes, the binding specificity of antibody produced by this can change or does not change.For this " monoclonal antibody " of invention can also be made with hybridoma method, because the DNA sequence dna of coding source of mouse antibody of the present invention is available Conventional means well known to those skilled in the art, such as according to the present invention the disclosed artificial synthesized nucleotide sequence of amino acid sequence or It expands to obtain with PCR method, thus recombinant DNA method can also be used, the sequence can be connected into conjunction with various methods well known in the art In suitable expression vector.Finally, culture converts resulting host cell, then under conditions of being suitble to antibody expression of the present invention Those skilled in the art isolate and purify means using well known routine and purify to obtain monoclonal antibody of the invention.Antibody includes logical Cross the polypeptide chain solid that disulfide-bridged, two is connected together, referred to as all masters of the two of light chain and heavy chain polypeptide backbone composition antibody Want structured sort (isoreagent).Heavy chain and light chain all can further be divided into some subprovinces of referred to as variable region and constant region.Heavy chain Including single variable region and three different constant regions, light chain then include single variable region (different from the variable region of heavy chain) and Single constant region (different from the constant region of heavy chain).It is responsible for the binding specificity of antibody in the variable region of heavy chain and light chain.
Term " heavy chain variable region " used refers to a kind of polypeptide in the present invention, the length is 110 to 125 amino acid, Heavy chain amino sequence of the amino acid sequence corresponding to monoclonal antibody of the present invention since heavy chain N-terminal amino acid.Equally, art Language " light chain variable region " refers to a kind of polypeptide, and the length is 95 to 115 amino acid, amino acid sequence is single corresponding to the present invention Light chain amino acid sequence of the clonal antibody since light chain N-terminal amino acid.Those of ordinary skill in the art obviously know, at this Invention in the heavy chain variable region and chain variable region amino acid sequence basis of specifically disclosed monoclonal antibody, can be by normal It advises genetic engineering and protein engineering method carries out the modifications such as addition, deletion, the replacement of one or more amino acid, guarded Property variant, and be still able to maintain and pseudorabies virus specifically bind.Monoclonal antibody in the present invention further includes its activity Segment or conservative variant.
Term " conservative variant " used, which refers to, in the present invention substantially remains its maternal characteristic, exempts from Ru basic Epidemiology biological nature, architectural characteristic, control characteristic or biochemical characteristic variant.Generally, the conservative variant of polypeptide it Amino acid sequence is different from maternal polypeptide, but limited difference, so that overall with the sequence of maternal polypeptide and conservative variant It is upper closely similar, and be identical in many regions.Difference on conservative variant and maternal polypeptid acid sequence can To be for example: replacement, addition and the deletion of one or more amino acid residues and any combination thereof.The amino acid of replacement or insertion Residue can be by genetic code encoding, can not also be by genetic code encoding.The conservative variant of polypeptide can generate naturally, or It can be the variant of non-natural generation.The conservative variant of the non-natural generation of polypeptide can by induced-mutation technique or directly It synthesizes and generates.
The invention further relates to antibody described above in the pseudorabies virus detection for carrying out non-diagnostic purpose Application.
In the present invention, the pseudorabies virus detection of the non-diagnostic purpose includes epidemiological analysis, in vitro tissue It is detected, Epitope Identification research, the semi-finished product of vaccine and product inspection and qualitative and quantitative diagnostic test be containing pseudoabies The detection of pseudorabies virus antigen in the vaccine composition of viral antigen and other antigens.
In certain embodiments of the present invention, the pseudoabies disease of non-diagnostic purpose is carried out using the method for immunohistochemistry Poison detection.
In some preferred embodiments of the invention, the method for the immunohistochemistry use mouse monoclonal antibody 1F2 for Primary antibody, using enzyme target sheep anti-mouse antibody as ELIAS secondary antibody.
In some further preferred embodiments of the invention, the primary antibody using when make 1:50-1:1000 dilution.
The present invention additionally relates to antibody described above in preparation for carrying out the pseudoabies disease of non-diagnostic purpose The application in reagent in poison detection.
In the present invention, the pseudorabies virus detection of the non-diagnostic purpose includes epidemiological analysis, in vitro tissue It is detected, Epitope Identification is studied and the vaccine of qualitative and quantitative diagnostic test antigen containing pseudorabies virus and other antigens The detection of pseudorabies virus antigen in composition.
In certain embodiments of the present invention, the pseudoabies disease of non-diagnostic purpose is carried out using the method for immunohistochemistry Poison detection.
In some preferred embodiments of the invention, the method for the immunohistochemistry use mouse monoclonal antibody 1F2 for Primary antibody, using enzyme target sheep anti-mouse antibody as ELIAS secondary antibody.
In some further preferred embodiments of the invention, the primary antibody using when make 1:50-1:1000 dilution.
According to certain embodiments of the present invention, the ImmunohistochemistryMethods Methods the following steps are included:
Step 1) materials: acquiring the tissue samples such as the tonsillotome, brain, lung of pig, be immediately placed in formalin and fix, necessary When block is suitably repaired to it；
The preparation of step 2) paraffin section: the tissue sample after fixed is taken off with automatic dehydrator again after flowing water rinses Water, transparent, waxdip are sliced after being embedded with embedding machine, open up piece, mounting piece on processed slide, bakes piece；
Step 3) inhibits endogenous enzyme: slide being dewaxed to distilled water, 3%H is added dropwise2O2It stands to inhibit endogenous enzyme；
Step 4) antigen retrieval: it with multiple such as the hot high pressure reparation of antigen hot repair, boils multiple hot repair, microwave thermal reparation or enzyme and disappears Slide after the roasting piece of change method processing is to repair antigen；
Step 5) closing: being washed 3 times with phosphate buffer, and confining liquid such as horse serum or bovine serum albumin(BSA) is added dropwise (BSA) it closes；
Step 6) dyeing: being added diluted primary antibody after sucking confining liquid, is incubated at room temperature 1 hour or 37 DEG C incubation 45-60 and divides Clock or 2-8 DEG C of overnight incubation；It is washed 3 times with phosphate buffer, ELIAS secondary antibody is added, be incubated at room temperature 1 hour or 37 DEG C and be incubated for 45-60 minutes:
Step 7) colour developing: being washed 3 times with phosphate buffer, and AEC (3-amino-9-ethylcarbozole, 3- is added Amino -9- ethyl card azoles) or the colour developing of DAB (Diaminobenzidine, 3,3- diaminobenzene diamines) developing solution, depending on staining conditions It is terminated with phosphate buffer or distilled water；Haematoxylin lining dye nucleus is added to redye, is dehydrated when necessary, is transparent, envelope Piece, microscopy；
Wherein, primary antibody described in the step 6) is that the mouse monoclonal antibody 1F2 variable region sequences are corresponding described anti- The segment of body or the antibody；
Wherein, primary antibody described in the step 6) is the mouse monoclonal antibody 1F2；
Wherein, primary antibody described in the step 6) using when make 1:50-1:1000 dilution；
Wherein, ELIAS secondary antibody described in the step 6) is enzyme target sheep anti-mouse antibody.
Term used herein " enzyme " includes any of horseradish peroxidase, alkaline phosphatase and beta-D-galactosidase Kind.
Term used herein " phosphate buffer " refers to containing phosphoric acid or its salt and the solution for being brought to desired pH, It is the most widely used a kind of buffer in biochemical research.Generally, phosphate buffer is from phosphoric acid or phosphate (including but not limited to sodium and sylvite) preparation.Some phosphate, such as sodium dihydrogen phosphate and di(2-ethylhexyl)phosphate has been known in the art Hydrogen potassium, disodium hydrogen phosphate and dipotassium hydrogen phosphate, sodium phosphate and potassium phosphate.Know that phosphate is deposited in the form of the hydrate of salt ?.Due to the second level dissociation of buffer, the pH value range of buffering is very wide, for example, about the range of 4-10, preferably from about 5-9's Range, more have choosing about 6-8 range, most preferably from about 7.4.It is further preferred that the phosphate buffer be sodium chloride-containing and The phosphate buffer of potassium chloride.
Term used in the present invention " porcine pseudorabies " is also known as " pseudoabies ".Similarly, term " porcine pseudorabies disease Poison " is also known as " pseudorabies virus ", and equally similarly " porcine pseudorabies virus gC albumen " is also known as " pseudorabies virus gC Albumen ".
The invention further relates to a kind of ELISA kits comprising the segment of above-mentioned antibody or the antibody, pseudorabies virus GC protein standard substance, and the detection reagent for being detected to antigen-antibody reaction.
In some embodiments of the invention, the antibody includes mouse monoclonal antibody 1B9 and mouse monoclonal antibody 1F2, And one of described mouse monoclonal antibody 1B9 and mouse monoclonal antibody 1F2 is coated on microwell plate, the labeled object of another kind Label.
In other embodiments of the invention, the marker includes enzyme, fluorophor or chemiluminescent groups；
In other embodiment of the invention, the detection reagent includes that the bottom of color reaction occurs with the marker Object；Preferably, the detection reagent includes enzyme colour reagent, fluorescent reagent or chemical illuminating reagent.
In some embodiments of the invention, the ELISA kit includes be marked with marker a effective amount of The segment of the antibody of variable region sequences with mouse monoclonal antibody 1B9 or the antibody and/or a effective amount of there is mouse Dan Ke The antibody of the variable region sequences of grand antibody 1F2 or the segment of the antibody, for and pseudorabies virus gC albumen into The detection reagent and pseudorabies virus gC protein standard substance that row antigen-antibody reaction is detected；Wherein, the marker Including enzyme, fluorophor, chemiluminescent groups；The reagent of the detection antigen-antibody reaction is that color occurs with the marker The substrate of reaction, including enzyme colour reagent, fluorescent reagent, chemical illuminating reagent.
In some embodiments of the invention, the ELISA kit includes be marked with marker a effective amount of The monoclonal antibody 1B9, a effective amount of monoclonal antibody 1F2 and pseudorabies virus gC albumen carry out antigen-antibody React the detection reagent detected and pseudorabies virus gC protein standard substance；Wherein, the monoclonal of the label The marker of antibody 1B9 includes that enzyme, fluorescence, chemiluminescence and the reagent of the detection antigen-antibody reaction are and the mark Remember that the substrate of color reaction, including enzyme colour reagent, fluorescent reagent, chemical illuminating reagent occur for object.
In some preferred embodiments of the invention, the ELISA kit includes being coated with the monoclonal antibody 1F2 Microwell plate, enzyme label the monoclonal antibody 1B9 and pseudorabies virus gC protein standard substance；Wherein, the Dan Ke The package amount of grand antibody 1F2 is 0.075-0.15 μ g/ml, the monoclonal antibody 1B9 of enzyme label using when make V/V1: 1500-1:9000 dilution.
In some specific preferred embodiments of the invention, the ELISA kit includes being coated with the monoclonal to resist The monoclonal antibody 1B9, the sample diluting liquid, cleaning solution, developing solution, terminate liquid that microwell plate, the enzyme of body 1F2 marks, and Pseudorabies virus gC protein standard substance；Wherein, the package amount of the monoclonal antibody 1F2 is 0.075-0.15 μ g/ml, described Enzyme label the monoclonal antibody 1B9 using when make V/V1:1500-1:9000 dilution.
In some further specific preferred embodiments of the invention, in the ELISA kit:
The sample diluting liquid is phosphate buffer；
The cleaning solution is the phosphate buffer of the Tween-20 containing 0.05%V/V；
The terminate liquid is 2M H2SO4；
The developing solution includes A liquid and B liquid；Wherein,
The A liquid is added after 10ml dehydrated alcohol for TMB 20mg and is settled to 100ml with distilled water, sterile point after mixing Dress；
The B liquid is citric acid 2.1g, anhydrous Na2HPO42.82g, 0.75% hydrogen peroxide urea 0.64ml steamed with double Water dissolves and is settled to 100ml, aseptic subpackaged after mixing.
Pseudorabies virus gC albumen is detected using ELISA detection kit of the present invention the invention further relates to a kind of Content method comprising:
Standard items serial dilutions, measuring samples dilution are added in microwell plate simultaneously, are incubated for by step S1；
Step S2 abandons reaction solution；
Step S3, by the enzyme labelled antibody micropore plate incubation after dilution；
Step S4 abandons reaction solution；
Step S5 adds developing solution, is incubated for；
Step S6 adds terminate liquid, and surveys absorbance value OD with microplate reader450nm；
Step S7 draws standard curve according to the absorbance value of standard items serial dilutions, calculates PRVgC in measuring samples The corresponding content of albumen.
Some preferred embodiments according to the present invention, the standard items serial dilutions pass through standard items sample is dilute It releases liquid and is diluted to 0-720ng/ml.
In some preferred embodiments of the invention, the standard items series diluted is 0-360ng/ml.
In some specific preferred embodiments of the invention, detected using ELISA detection kit of the present invention The method of the content of pseudorabies virus gC albumen the following steps are included:
(1) standard items are diluted to after 720ng/ml with sample diluting liquid carry out 2 times of doubling dilutions i.e. 360,180,90, 45, measuring samples sample diluting liquid is diluted 1:100-1:200 by 0ng/ml, and standard items serial dilutions, measuring samples are dilute Release liquid simultaneously by 100 holes μ l/ be added microwell plate in, 37 DEG C of sealing plate juxtaposition incubations 45-90 minutes or be incubated at room temperature 60 minutes；
(2) reaction solution is abandoned, is washed 2-4 times with cleaning solution, is patted dry or drain；
(3) 37 DEG C of sealing plate juxtaposition incubation 30-45 minutes or room temperature after the enzyme labelled antibody after dilution being added by 100 holes μ l/ It is incubated for 45 minutes；
(4) reaction solution is abandoned, is washed 2-4 times with cleaning solution, is patted dry or drain；
(5) add developing solution A liquid, each hole 50 μ l/ of B liquid, set 37 DEG C and incubate 10 minutes or be incubated at room temperature 15 minutes；
(6) add 50 hole μ l/ of terminate liquid, read absorbance value OD with microplate reader in 10 minutes450nm；
(7) standard curve is drawn according to the absorbance value of standard items serial dilutions, calculates PRVgC albumen in measuring samples Corresponding content.
It is complete in quantitative detection pseudorabies virus gC albumen that the invention further relates to ELISA detection kits of the present invention Albumen or its segment or its conservative variant or its active fragment single expression, or with other albumen expressing in series or merge table Up to when pseudorabies virus gC albumen content in application.
According to certain embodiments of the present invention, the ELISA kit quantitative detection pseudorabies virus gC is provided Albumen holoprotein or its segment or its conservative variant or its active fragment single expression, or with other albumen expressing in series or The method of the content of pseudorabies virus gC albumen when amalgamation and expression comprising:
Step T1, standard items are diluted to after 720ng/ml with sample diluting liquid carry out 2 times of doubling dilutions i.e. 360, 180,90,45,0ng/ml, by measuring samples with sample diluting liquid dilute 1:100-1:200, by standard items serial dilutions, to Inspection sample diluting liquid is pressed 100 holes μ l/ simultaneously and is added in microwell plate, 37 DEG C of sealing plate juxtaposition incubation 45-90 minutes or incubation at room temperature 60 Minute；
Step T2 abandons reaction solution, is washed 2-4 times with cleaning solution, pat dry or drain；
Step T3, by the enzyme labelled antibody after dilution by 100 holes μ l/ be added after 37 DEG C of sealing plate juxtaposition incubation 30-45 minutes or Incubation at room temperature 45 minutes；
Step T4 abandons reaction solution, is washed 2-4 times with cleaning solution, pat dry or drain；
Step T5 adds each hole 50 μ l/ of developing solution A liquid, B liquid, sets 37 DEG C and incubates 10 minutes or be incubated at room temperature 15 minutes；
Step T6 adds 50 hole μ l/ of terminate liquid, reads absorbance value OD with microplate reader in 10 minutes450nm；
Step T7 draws standard curve according to the absorbance value of standard items serial dilutions, calculates PRVgC in measuring samples The corresponding content of albumen.
Embodiment
To keep the present invention easier to understand, below in conjunction with embodiment, present invention be described in more detail, these realities Apply example only serve it is illustrative, it is not limited to application range of the invention.If raw material used in the present invention or component nothing Specified otherwise can be made by commercial sources or conventional method.Unmentioned specific experiment method in the following example is led to Often carried out according to routine experiment method.
Embodiment 1: the preparation of the albumen of gC containing pseudorabies virus
The preparation of 1.1PRVgC albumen
Culture (the PRV of PRV HN1201 virus or its different generation is inoculated on well-grown PK15 cell HN1201 plants of deposit numbers are CCTCC NO.V 201311, and the culture referring to patent CN104004774A), the difference generation is Culture within 5-35 generation, extracts PRV genomic DNA, design primer
gC1-F:CGCGGATCCATGGCCTCGCTCGCGCGTGCGAT
gC1-R:TGTGAAGCTTTCACAGCGCGGACCGGCGGTAGT
And PRVgC albumen is prepared by patent CN104004774A method, BCA determination of protein concentration kit (is purchased from Shanghai Green skies Bioisystech Co., Ltd) in specification measure PRVgC albumen (abbreviation PRVgC1), content be 160 μ g/ml.
The preparation of the expressing in series albumen of 1.2 albumen containing PRVgC
Design primer
gC2-F:CCAATGCATATGGCCTCGCTCGCGCGTGCGA
gC2-R:CATGCCATGGTCACAGCGCGGACCGGCGGTA
gB2-F:CGCGGATCCATGCTAGGGGGCGTCGGGGTCCT
gB2-R:TGTGAAGCTTCTAATGCCCGCTGGTGGCGGTCT
The expressing in series albumen of PRVgC albumen Yu PRVgB protein fragments is prepared by patent CN105693827A the method (abbreviation PRVgC2).
Design primer
gC3-F:CCAATGCATATGGCCTCGCTCGCGCGTGCGA
gC3-R:CATGCCATGGTCACAGCGCGGACCGGCGGTA
gD3-F:CGCGGATCCATGCTGCTCGCAGCGCTATT
gD3-R:TGTGAAGCTTCTACGGACCGGGCTGCGCTT
The expressing in series of HN1201 plants of PRVgC albumen and PRVgD albumen is prepared by patent CN105693827A the method Albumen (abbreviation PRVgC3).
Protein quantification is carried out referring to the BCA determination of protein concentration kit method of green skies company, as a result: PRVgC2, PRVgC3 total protein content is 15,19 μ g/ml.
The preparation of the amalgamation and expression albumen of 1.3 albumen containing PRVgC
Design primer
gB4-F:CGCGGATCCATGCTAGGGGGCGTCGGGGTCCT
gB4-R:
TGATCCACCTCCCCCTGATCCACCTCCCCCTGATCCACCTCCCCCATGCCCGCTGGTGGCGGTCTT
gC4-F:
GGGGGAGGTGGATCAGGGGGAGGTGGATCAGGGGGAGGTGGATCAATGGCCTCGCTCGCGCGTGC
gC4-R:TGTGAAGCTTTCACAGCGCGGACCGGCGGTAGT
Amalgamation and expression albumen (the abbreviation of PRVgC albumen and PRVgB albumen is prepared by patent CN105693827A the method PRVgC4)
Design primer
gC5-F:CGCGGATCCATGGCCTCGCTCGCGCGTGCGAT
gC5-R:
TGATCCACCTCCCCCTGATCCACCTCCCCCTGATCCACCTCCCCCCAGCGCGGACCGGCGGTAGTAG
gD5-F:
GGGGGAGGTGGATCAGGGGGAGGTGGATCAGGGGGAGGTGGATCAATGCTGCTCGCAGCGCTATTGG
gD5-R:TGTGAAGCTTCTACGGACCGGGCTGCGCTTTTA
Amalgamation and expression albumen (the abbreviation of PRVgC albumen and PRVgD albumen is prepared by patent CN105693827A the method PRVgC5).Protein quantification is carried out referring to the BCA determination of protein concentration kit method of green skies company, as a result: PRVgC4, The content of PRVgC5 total protein is 5,8.6 μ g/ml.
But PRVgC2, PRVgC3, PRVgC4, PRVgC5 can only measure the content of total protein, can not each albumen of Accurate Prediction Corresponding expression quantity, is unable to monitor whether expression effect reaches expected, causes each component when with seedling unclear, also can not be to vaccine The reason for the quality that tells on after immune is analyzed.
Embodiment 2: preparation, purifying and the identification of pseudorabies virus gC protein monoclonal antibody
The preparation and purification of 2.1PRVgC protein monoclonal antibody
Firstly, PRV HN1201 strain virus liquid (2 × 10 prepared by embodiment 18TCID50/ ml) respectively through formaldehyde, β-the third 10/group of mouse is immunized after lactone, binary ethylenimine BEI inactivation, grouping and Freund's adjuvant emulsification, and prepared with embodiment 1 Mice serum progress ELISA after the coated ELISA method of PRVgC1 exempts from 3-7 times is persistently detected, as a result: each group mice serum ELISA potency≤1:400, optional 1 progresss cell fusion, after fusion positive rate be 0, abandon.
Secondly, mouse 10 is immunized after emulsifying in equal volume in PRVgC1 prepared by embodiment 1 and Freund's adjuvant, exempted from 1 every 2 weeks Secondary, the mice serum after being exempted from the coated ELISA method of PRVgC1 prepared by embodiment 1 to 3-7 times is carried out ELISA and persistently examined Survey, as a result: each group mice serum ELISA potency≤1:800, optional 1 progresss cell fusion, after fusion positive rate be 0, put It abandons.
Again, the PRV HN1201 strain virus liquid (2 × 10 prepared by embodiment 18TCID50/ ml) through formalin-inactivated with not First immunisation mouse 20 after family name's adjuvant emulsifies in equal volume, the PRVgC1 for preparing embodiment 1 after 2 weeks and Freund's adjuvant are isometric It emulsifies the 2nd time to be immunized, 3 wheels is immunized repeatedly.It takes a blood sample to 20 mouse and to implement within 9 days after exempting from every time after immune 2nd wheel The coated ELISA method of PRVgC1 prepared by example 1 persistently carries out ELISA to serum and persistently detects.As a result: each group mice serum ELISA potency≤1:1000, optional 1 progresss cell fusion, after fusion positive rate be 0, abandon.
Finally, PRV HN1201 strain virus liquid (2 × 10 prepared by embodiment 18TCID50/ ml) through formalin-inactivated, First immunisation mouse 20 after being emulsified in equal volume after PRVgC1 (100 μ g/ml) mixing with Freund's adjuvant, carried out the 2-5 times every 2 weeks Immune, the 6th time with PRVgC1 direct immunization.Dead mouse afterwards successively after immune 4-5 time, 10 mouse of survival are taken a blood sample and are used in combination The coated ELISA method of PRVgC1 prepared with embodiment 1 is carried out ELISA to serum and persistently detected.4-5 is immunized in mice serum ELISA potency is on the rise after secondary and ELISA potency >=1:12800 only 3 mouse, successively by Harlow E etc. (Harlow E,Lane D.Antibodies:a laboratory manual.New York:Cold Spring Harbor Laboratory Press.1998,139-312) document operating method carry out cell fusion, it is carried out with ELISA limited Dilution method subclone screening, adds up only to obtain 10 plants of positive hybridoma cells, positive rate is only 1%.HN1201 plants of PRV are felt The PK-15 cell envelope of dye evaluates 10 plants of positive hybridomas in microwell plate, through immunopcroxidase monolayer assay IPMA Cell conditioned medium, 1 plant of discovery have nonspecific reaction, 1 plant be it is negative therefore give up, obtain 8 plants of positive hybridoma cells (1B9,1F2, 8H2,10F6).Be injected into respectively the stimulation of paraffin through producing in female rat, prepare the ascites of 8 plants of monoclonal antibodies, take mixing Sample afterwards is evaluated through ELISA, IPMA, the results are shown in Table 1.
The evaluation result of 15 plants of monoclonal antibody ascites of table
Serial number Hybridoma cell strain title ELISA IPMA Ascites production
1 1B9 ≥1:1024000 1:800 It is moderate
2 1F2 ≥1:2048000 1:12800 It is moderate
3 3D4 1:4096 1:800 It is moderate
4 4E5 1:400-1:1600 1:80 Very fast and amount is few
5 4C7 1:8192 1:800 It is moderate
6 5C1 1:4096 1:1000 It is moderate
7 8H2 1:2048 1:40 Relatively slow and amount is few
8 10F6 1:512 1:160 Very fast and amount is few
According to the evaluation result of table 1, ascites is generated when selecting 5 plants of preparation ascites and yield is moderate, and ELISA, Monoclonal antibody 1B9,1F2 that is relatively high in IPMA level, all having good reactivity with PRVgC albumen and virus carries out Follow-up study.By 5 plants of ascites, with Chen Dan etc., (Chen Dan, Sun Guangrui, willow increase kind octanoic acid-ammonium sulfate co-precipitation method in monoclonal Application Agriculture of Anhui science in antibody purification, 2007,35 (26): the 8105,8108) octanoic acid-ammonium sulfate co-precipitation method Purifying, is identified with PAGE gel electrophoresis later, as a result: 1 plant of monoclonal antibody 5C1 purity is lower after purification is only 50% thus give up, the purity of remaining 4 plants of monoclonal antibody is >=85%；Divided to specifications with BCA protein quantification kit point Not carry out quantitative analysis, as a result: the concentration of monoclonal antibody 1B9,1F2,3D4,4C7 are respectively 3.8,4.2,1.2,0.8mg/ ml。
The identification of 2.2 monoclonal antibodies 1B9,1F2 specificity
By swine fever virus CSFV, porcine reproductive and respiratory syndrome virus PRRSV, porcine circovirus 2 type PCV2, the tiny disease of pig Malicious PPV, pseudorabies virus PRV and culture PRV be individually fixed in microwell plate with PK15 cell, by monoclonal antibody 1B9, 1F2 ascites is as primary antibody, using fluorescent marker rabbit anti-mouse antibody secondary antibody as fluorescent marker secondary antibody, according to indirect immunofluorescence method IFA is detected, as a result: monoclonal antibody 1B9,1F2 is only reacted with PRV, without with other pig common diseases and culture cell Cross reaction occurs.
By PRVgB Δ 148-546 albumen, PRVgB albumen (preparing according to patent CN10563827A), PRVgD albumen (is pressed Patent CN104004774A method preparation) and embodiment 1 prepare PRVgC1, be coated in microwell plate respectively, by monoclonal Antibody 1B9,1F2 ascites are detected as primary antibody by ELISA, as a result: monoclonal antibody 1B9,1F2 is only anti-with PRVgC albumen It answers, without being reacted with the other albumen of PRV.
Show: monoclonal antibody 1B9,1F2 is the monoclonal antibody specific of PRVgC albumen.
The application of 2.3 monoclonal antibodies 1B9,1F2
PRVgC1, PRVgC2, PRVgC3, PRVgC4, PRVgC5 and patent CN104248757 prepared by embodiment 1 The PRVgBgD subunit vaccine semi-finished product of preparation, and the vaccine finished product that addition 206 adjuvants (46%V/V) is prepared afterwards, warp Western blot identification, as a result: the subunit vaccine that PRVgC1, PRVgC2, PRVgC3, PRVgC4, PRVgC5 are made into half at Product and the reaction of corresponding vaccine finished product are the positive, and PRVgBgD subunit vaccine semi-finished product and corresponding vaccine finished product are feminine gender. Accordingly, two plants of monoclonal antibodies can be used for protein vaccine containing PRVgC or the semi-finished product without PRVgC protein vaccine and at product examine It tests.
The measurement of 2.4 monoclonal antibody neutralization activities
By in " Chinese veterinary pharmacopoeia " 2015 editions described measurement of fixed virus diluted blood heat-clearing method mouse monoclonal antibody 1B9,1F2 And potency, it is first that the different extension rates (1:1V/V-1:2048V/V) of mouse monoclonal antibody 1B9,1F2 and fresh rabbit anteserum are mixed It closes, then with PK15 cell in 37 DEG C, 5%CO2Under the conditions of be incubated for 1 hour, be separately added into Fa plants of PRV classics strain and (purchased with MA plants From China Veterinary Drugs Supervisory Inst.), Bartha plants of vaccine strain (being purchased from China Veterinary Drugs Supervisory Inst.) and HN1201 plants of variant of virus are dilute Liquid is released (containing 100TCID50/ mL), set 37 DEG C, 5%CO2Under the conditions of cultivate 72-120 hours observation cytopathies, and calculate And potency, it the results are shown in Table 2.
Neutralization titer of 2 monoclonal antibody of table to different strains
Monoclonal antibody HN1201 plants Bartha plants Ma
1B9 1:158 1:631 1:316
1F2 0 0 0
As the result is shown: monoclonal antibody 1B9 has neutralization activity, the neutralization to 3 strains with the presence of complement Potency >=1:158；No matter monoclonal antibody 1F2 is whether there is or not complement, without neutralization activity.It accordingly, can be by two plants Monoclonal antibody contains for such as Epitope Identification research, qualitative and quantitative diagnostic test of the mechanism study such as PRVgC protein structure parsing The detection etc. of pseudorabies virus antigen in the vaccine composition of pseudorabies virus antigen and other antigens.
The hypotype and variable region sequences of 2.5 monoclonal antibodies 1B9,1F2 measure
With Pierce Rapid ELISA Mouse mAb Isotyping Kit and referring to specification to monoclonal antibody The hypotype of 1B9,1F2 are identified.As a result: the heavy chain subgroup of monoclonal antibody 1B9,1F2 is IgG2a, and light chain type is kappa。
According to the sequence signature of source of mouse monoclonal antibody, heavy chain variable region primer sequence is designed:
P1:GGGAATTCAAATSCTGGGT
P2:CCAAAGCTTGGGRCCARK
Design light chain variable region primer sequence:
P3:ACTAGTCGACATGAGTGTGCYCACTCA
P4:CCCAAGCTTGGATGGTGGGAAGAT
According to Zhang Aihua etc., (Zhang Aihua, closes orchid, and the anti-CD molecule monoclonal antibody light and heavy chain of the series mouse such as Wang Zhiyou is variable The Cloned culturing Products in China magazine of area's gene, 2001,15 (2): 65-68) establish variable region sequences survey Determine method, obtain the variable region sequences of monoclonal antibody 1B9,1F2 respectively by molecule clone technology, chooses corresponding clone's matter Grain, which is sent to Suzhou Jin Wei intelligence Biotechnology Co., Ltd, to be sequenced.As a result, the heavy chain variable region of monoclonal antibody 1B9, light chain Respectively as shown in SEQ ID No.1, SEQ ID No.3, amino acid sequence by its derivation is respectively the gene order of variable region SEQ ID No.2,SEQ ID No.4；The heavy chain variable region of monoclonal antibody 1F2, the gene order of light chain variable region are respectively such as It is respectively SEQ ID No.6, SEQ ID by its amino acid sequence derived shown in SEQ ID No.5, SEQ ID No.7 No.8。
In conclusion can be carried out with two plants of monoclonal antibodies according to immunology principle and the characteristic of two plants of monoclonal antibodies Application in the pseudorabies virus detection of non-diagnostic purpose, including epidemiological analysis, in vitro tissue is detected, epitope Pseudoabies in the vaccine composition of identification research, qualitative and quantitative diagnostic test antigen containing pseudorabies virus and other antigens The detection of viral antigen.
Embodiment 3: the foundation and application of ImmunohistochemistryMethods Methods
The foundation of 3.1 ImmunohistochemistryMethods Methods
The method of immunohistochemistry the following steps are included:
1) it draws materials: acquiring the tissue samples such as the tonsillotome, brain, lung of pig, be immediately placed in formalin and fix, it is right when necessary It carries out suitably repairing block.
2) preparation of paraffin section: it is fixed be dehydrated again with automatic dehydrator after flowing water rinses, be transparent, waxdip, use Slice, exhibition piece, mounting piece bake piece on processed slide after embedding machine embedding.
3) inhibit endogenous enzyme: slide being dewaxed to distilled water, 3%H is added dropwise2O2It stands to inhibit endogenous enzyme.
4) antigen retrieval: with multiple such as the hot high pressure reparation of antigen hot repair, multiple hot repair, microwave thermal reparation or enzyme digestion are boiled Slide after handling roasting piece is to repair antigen.
5) it closes: being washed 3 times with phosphate buffer, confining liquid such as horse serum or bovine serum albumin(BSA) BSA closing is added dropwise；
6) dye: sucking and diluted primary antibody is added after confining liquid, incubation at room temperature incubation in 1 hour or 37 DEG C 45-60 minutes or 2-8 DEG C of overnight incubation；It is washed 3 times with phosphate buffer, enzyme target sheep anti-mouse antibody is added as ELIAS secondary antibody, incubation at room temperature Incubation in 1 hour or 37 DEG C 45-60 minutes.
7) it develops the color: being washed 3 times with phosphate buffer, the colour developing of AEC or DAB developing solution is added, depending on staining conditions phosphoric acid Salt buffer or distilled water terminate；Haematoxylin lining dye nucleus is added to redye, is dehydrated when necessary, is transparent, mounting, mirror Inspection.
The screening of 3.2 immunohistochemistry primary antibodies
4 plants of monoclonal antibodies 1B9,1F2,3D4,4C7 (ascites after purification) prepared by embodiment 2 are used as primary antibody, press The clinical pathological material of disease collected is attacked after poison respectively to HN1201 plants, Fa plants, Ma plants of PRV after 2 doubling dilution of 1:50-1:3200, according to 3.1 the method for embodiment carries out immunohistochemistry detection, the results are shown in Table 2.As shown in Table 2: monoclonal antibody 1F2 is used for PRV When HN1201 plants, Fa plants, Ma plants of immunohistochemical reaction potency >=1:800, potency is higher and clean background；And remaining 3 plants The potency of monoclonal antibody 1B9,3D4,4C7 are lower and background is very high or has non-specific responding, can not effectively be applied.
The selection result of 3 immunohistochemistry primary antibody of table
3.3 clinical application
The tissue samples such as 278 parts of tonsillotomes, brain, lungs that clinic is collected are limited through the prosperous animal epidemic prevention technology of Beijing Century member Company's PRV PCR kit detects 207 parts of positives, 71 parts of feminine genders；And 207 parts of positives are sequenced, as a result, it has been found that having 158 Part is PRV variant, remaining is the strain of PRV classics.Use monoclonal antibody 1F2 (1:1000) as primary antibody by described in embodiment 3.1 ImmunohistochemistryMethods Methods are detected, and the results are shown in Table 4.As shown in Table 3: the positive coincidence rate of immunohistochemistry and PCR method is 92%, Negative match-rate is 100%, and total coincidence rate is 94%；The infection of another PRV concentrates on nucleus and in cytoplasm, with brain group It is the most prominent to knit lesion (account for all brain tissue's samples 91%).In addition, it is 4 that this time 278 parts, which have 90 parts of positive clinical samples, Tonsillotome, brain, the lung tissue sample (every kind each 6 parts) of head (20 part /) morbid pig, for the brain of the morbid pig of acquisition in continuous 5 days Tissue sample, discovery is continuously tracked by immunohistochemistry: the lesion of 4 pigs is gradually transferred to by initial tonsillotome, lungs Brain.
4 immunohistochemistry of table is compared with PCR testing result
In conclusion the ImmunohistochemistryMethods Methods established using monoclonal antibody 1F2 as primary antibody are when its 1:1000 is diluted and detected It is high with the coincidence rate of PCR, PCR method can be replaced to carry out epidemiological survey；Pathological tissues can be accurately positioned, clear see Observe Growth trends or diffusion process of the cause of disease in histocyte so that Pathogen test is more visual and clear, be PRV (including The strain of PRV classics and variant are caused) prevention and treatment of epidemic disease provide support, be later period PRV especially variant the reason of, The research of pathogenesis and process and Epitope Identification research lay the foundation.
Embodiment 4: the ELISA kit preparation and application of the protein monoclonal antibody containing PRVgC
4.1PRVgC protein monoclonal antibody paired experiment
5 plants of monoclonal antibodies prepared by embodiment 2 after purification, are divided respectively with 0.3 μ g/ml of same concentrations, 100 holes μ l/ Be not coated in microwell plate, be added embodiment 1 prepare PRVgC1 antigen V/V 1:100 dilution after, respectively with 5 plants of enzyme targets Monoclonal antibody V/V1:2500 dilution carries out match reaction, colour developing, and microplate reader reads its absorbance value OD450nm, the results are shown in Table 5.
The test result of the different monoclonal antibody cocktails of table 5
Whether the epitope being directed to antibody addition two plants of monoclonal antibodies of verification experimental verification is identical to be measured.It will implement PRVgC1 prepared by example 1 is closed after being coated in microwell plate with confining liquid, and the monoclonal of first plant of saturated concentration is then added Antibody reacts, and washing pats dry, the monoclonal antibody for adding another plant of saturated concentration reacts.Two plants of monoclonals are anti- After precursor reactant, the sheep anti-mouse igg for adding HRP label is reacted, and is washed, and colour developing measures its absorbance A value.By public affairs Formula AI=[(A1.2-A1)/A2] × 100% calculates separately the value added index AI that single grand antibody is superimposed two-by-two.Wherein, A1, A2 points Not Wei monoclonal antibody 1 and 2 A value, A1.2 be monoclonal antibody 1 be superimposed monoclonal antibody 2 A value；Two kinds of monoclonal antibodies can be tentatively concluded when AI is greater than 50% Corresponding different antigen binding site.It the results are shown in Table 6.
Table 6: the value added index AI that monoclonal antibody is superimposed two-by-two
As shown in Table 5: only as monoclonal antibody 1F2 as coating antigen, monoclonal antibody 1B9 as enzyme labelled antibody, or When monoclonal antibody 1B9 as coating antigen, monoclonal antibody 1F2 as enzyme labelled antibody when, testing result is just effective, and other The absorbance that collocation mode is surveyed is lower, is unable to complete subsequent accurately and effectively quantitative detection.
The similarities and differences that two plants of monoclonal antibodies are directed to epitope are demonstrated simultaneously, as a result: mouse monoclonal antibody 1B9 and 1F2 Antibody additivity index is above 50%, shows that two plants of monoclonal antibodies identify different epitopes, can be used for establishing double antibody Sandwich method.
The preparation of 4.2ELISA kit
Coated microwell plate 1: 0.075-0.15 μ g/ml mouse monoclonal antibody 1F2 is coated in microwell plate, sets 2-8 DEG C Coating is overnight or 37 DEG C are coated with 1 hour, washes 2-3 times with sample cleaning solution and pats dry or drain, small in 37 DEG C of closings 2 with confining liquid When, 2-3 times are washed with sample cleaning solution and are patted dry or drained.
Enzyme labelled antibody 1: with the monoclonal antibody 1B9 of Over-voltage protection label purifying, enzyme used is horseradish peroxidase HRP or alkaline phosphatase AP, antibody content is 1.4mg/ml, mark rate 0.78 after identified enzyme mark；V/V1 is pressed when use: Any multiple dilution of 1500-1:9000.
Coated microwell plate 2: 0.5 μ g/ml monoclonal antibody 1B9 is coated in microwell plate, set 2-8 DEG C coating overnight or 37 DEG C are coated with 1 hour, wash 2-3 times with sample cleaning solution and pat dry or drain, and are closed 2 hours with confining liquid in 37 DEG C, use sample Cleaning solution washes 2-3 times and pats dry or drain.
Enzyme labelled antibody 2: with the monoclonal antibody 1F2 of Over-voltage protection label purifying, enzyme used is horseradish peroxidase HRP or alkaline phosphatase AP, antibody content is 1.4mg/ml, mark rate 0.78 after identified enzyme mark；V/V1 is pressed when use: 4000 dilutions.
Sample diluting liquid: phosphate buffer.
Cleaning solution: the phosphate buffer of the Tween-20 containing 0.05%V/V.
Standard items: PRVgC albumen (abbreviation PRVgC1) prepared by embodiment 1.
Developing solution: including A liquid and B liquid, wherein A liquid is to use distilled water constant volume after 10ml dehydrated alcohol is added in TMB 20mg It is aseptic subpackaged after mixing to 100ml；B liquid is citric acid 2.1g, anhydrous Na2HPO42.82g, 0.75% hydrogen peroxide urea 0.64ml distilled water dissolves and is settled to 100ml, aseptic subpackaged after mixing.
Terminate liquid: 2M H2SO4。
By coated microwell plate 1, enzyme labelled antibody 1, sample diluting liquid, cleaning solution, standard items, developing solution, terminate liquid assembling At kit 1；By coated microwell plate 2, enzyme labelled antibody 2, sample diluting liquid, cleaning solution, standard items, developing solution, terminate liquid group Dress up kit 2.
The detection method of 4.3ELISA kit
Detection method includes
1. standard items are diluted to after 720ng/ml with sample diluting liquid carry out 2 times of doubling dilutions i.e. 360,180,90, 45,0ng/ml, PRVgC2, PRVgC3, PRVgC4, PRVgC5 sample diluting liquid for separately preparing measuring samples such as embodiment 1 1:100-1:200 is diluted, standard items serial dilutions, measuring samples dilution are pressed into 100 holes μ l/ simultaneously and are added in microwell plate, 37 DEG C of sealing plate juxtaposition incubation 45-90 minutes is incubated at room temperature 60 minutes；
2. abandoning reaction solution, washed 2-4 times with cleaning solution, pats dry or drain；
3. 37 DEG C of sealing plate juxtaposition incubation 30-45 minutes or room temperature are incubated after the enzyme labelled antibody after dilution is added by 100 holes μ l/ It educates 45 minutes；
4. abandoning reaction solution, washed 2-4 times with cleaning solution, pats dry or drain；
5. plus each hole 50 μ l/ of developing solution A liquid, B liquid, set 37 DEG C incubate 10 minutes or incubation at room temperature 15 minutes；
6. plus 50 hole μ l/ of terminate liquid, in 10 minutes with microplate reader read absorbance value OD450nm；
7. drawing standard curve according to the absorbance value of standard items serial dilutions, PRVgC albumen in measuring samples is calculated Corresponding content.
The optimization of 4.4ELISA kit
By a monoclonal antibody according to 0.6,0.5,0.4,0.3,0.2,0.15,0.1,0.075,0.05,0.0375, 0.025,0.01875 μ g/mL, 12 gradients are longitudinally coated with microwell plate；By after another enzyme-labeled antibody according to 1:4000,1:5000, After 7 gradient dilutions of 1:6000,1:7000,1:8000,1:9000,1:10000, prepared by the embodiment 1 of 2 μ g/mL PRVgC1 carries out sandwich ELISA detection.Antibody concentration corresponding to P/N, that is, sample value/feminine gender value highest hole is selected, respectively as Coated antibody and enzyme labelled antibody best effort concentration.It is established respectively by this testing program anti-for coating with mouse monoclonal antibody 1F2 The detection method of body and enzyme labelled antibody 1B9 pairing, and matched by coated antibody and enzyme labelled antibody 1F2 of mouse monoclonal antibody 1B9 Detection method, detect the gC protein sample of gradient dilution respectively, using protein concentration as abscissa, absorbance OD value is vertical sits Mark draws curve, calculates the range of linearity and related coefficient of double-antibody sandwich elisa.Select the range of linearity big and related coefficient High matching method, as optimal pairing, to realize the accurate detection to antigen.
As a result: kit 1, by coated antibody of mouse monoclonal antibody 1F2 and peridium concentration is 0.05-0.15 μ g/mL, mouse As the matching method of enzyme labelled antibody (1:1500-1:9000), the big (0- of the range of linearity of detection after monoclonal antibody 1B9 enzyme mark 720ng/mL) and related coefficient is high (>=99%)；And kit 2, it is coated antibody (0.5 μ g/ml) for coated antibody using 1B9, As the matching method of enzyme labelled antibody (1:4000) after 1F2 enzyme mark, range of linearity 0-180ng/ml, related coefficient is 96% left It is right.From detection the range of linearity it is wide and save raw material angle, therefore selective reagent box 1 carry out follow-up test.
The application of 4.5ELISA kit
PRVgC1 albumen 400,250,120ng/ml progress mark-on go back to of the preparation of embodiment 1 are added in sample diluting liquid respectively Acceptance test is carried out repeating to detect each 5 times by 4.3 the method for embodiment.
As a result: drawing standard curve according to the absorbance value of standard items serial dilutions is y=0.0042x-0.0082, R2 =0.9967；According to PRVgC1 dilution 400,250, the corresponding OD of 120ng/ml450nmValue, calculate respective recovery of standard addition and The coefficient of variation is shown in Table 7.
7 antigen mark-on reclaims test result of table
As shown in Table 7: this kit and method accuracy are high, reproducible, can be used for the detection of actual sample.Therefore to general PRVgC2, PRVgC3, PRVgC4, PRVgC5 prepared by embodiment 1 dilutes 1:100-1:200 with sample diluting liquid, by embodiment 4.3 the methods are to quantitative detection is carried out, as a result: corresponding PRVgC albumen portion in PRVgC2, PRVgC3, PRVgC4, PRVgC5 The content divided is respectively 5.486,7.802,2.341,3.908 μ g/ml, and seedling can be accurately matched according to this result for animal immune.
Embodiment described above is only presently preferred embodiments of the present invention, for explaining only the invention, is not constituted to this Any restrictions of invention.By referring to exemplary embodiments, invention has been described, it should be appreciated that word used in it Language is descriptive and explanatory vocabulary, rather than limited vocabulary.It can be right within the scope of the claims by providing The present invention modifies, and revises in without departing substantially from scope and spirit of the present invention to the present invention.Although wherein describing The present invention be related to specific method, material and embodiment, it is not intended that the present invention is limited to particular case disclosed in it, On the contrary, the present invention can be extended to other all methods and applications with the same function.
<110>Luoyang Pu Laikewantai Bioisystech Co., Ltd
<120>pseudorabies virus gC protein antibodies, the kit containing the antibody and application
<130> 2017
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 357
<212> DNA
<213>mouse monoclonal antibody 1B9 weight chain variable region nucleotide sequence
<400> 1
gagatccagc tgcagcagtc tggacctgag ctggtgaagc ctggggcttc agtgaaggta 60
tcctgcaagg cttctggtta ctcattcact gactacaaca tgtactgggt gaagcagagc 120
catggaaaga gccttgagtg ggttggatat attgatcctt acaatggtgg taatagctac 180
aaccagaagt tcaagggcaa ggccacattg actgttgaca agtcctccag cacagccttc 240
atgcatctca acagcctgac atctgaggac tctgcagtct attactgtgc aagatggttt 300
attactacgg tagcctttga ctactggggc caaggcacca ctctcacagt ctcctca 357
<210> 2
<211> 119
<212> PRT
<213>mouse monoclonal antibody 1B9 heavy chain variable amino acid sequence
<400> 2
Glu Ile Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Asp Tyr
20 25 30
Asn Met Tyr Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Trp Val
35 40 45
Gly Tyr Ile Asp Pro Tyr Asn Gly Gly Asn Ser Tyr Asn Gln Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Phe
65 70 75 80
Met His Leu Asn Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Trp Phe Ile Thr Thr Val Ala Phe Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Leu Thr Val Ser Ser
115
<210> 3
<211> 336
<212> DNA
<213>mouse monoclonal antibody 1B9 light chain variable region nucleotide sequence
<400> 3
gatgttgtga tgacccaaac tccactctcc ctgcctgtca gtcttggaga tcaagcctcc 60
atctcttgca gatctagtca gagccttgta cacagttatg gaaacaccta tttacattgg 120
tacctgcaga agccaggcca gtctccaaag ctcctgatct acaaagtttc caaccgattt 180
tctggggtcc cagacaggtt cagtggcagt ggatcaggga cagatttcac actcaagatc 240
agcagagtgg aggctgagga tctgggagtt tatttctgct ctcaaagtac acatgttcca 300
ttcacgttcg gctcggggac aaagttggag ataaaa 336
<210> 4
<211> 112
<212> PRT
<213>mouse monoclonal antibody 1B9 chain variable region amino acid sequence
<400> 4
Asp Val Val Met Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly
1 5 10 15
Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His Ser
20 25 30
Tyr Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Phe Cys Ser Gln Ser
85 90 95
Thr His Val Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys
100 105 110
<210> 5
<211> 354
<212> DNA
<213>mouse monoclonal antibody 1F2 weight chain variable region nucleotide sequence
<400> 5
gaggttaagc tgcagcagtc tggggcagag cttgtgaagc caggggcctc agtcaagttg 60
tcctgcaaag cttctggctt caacattaaa gactactata tgcacagagt gaagcagagg 120
cctgaacagg gcctggagtg gattggaagg attgatcctg gggacggtga aaccaaatat 180
gtcccgaagt tccagggcaa ggccactata acagcagaca catcctccaa cacagcctac 240
ctgcagctca gcagcctgac atctgaggac actgccgtct attactgttc tagatggaat 300
tactatgatg ctatggacta ctggggtcaa ggaacctcag tcaccgtctc ctca 354
<210> 6
<211> 118
<212> PRT
<213>mouse monoclonal antibody 1F2 heavy chain variable amino acid sequence
<400> 6
Glu Val Lys Leu Gln Gln Ser Gly Ala Glu Leu Val Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Phe Asn Ile Lys Asp Tyr
20 25 30
Tyr Met His Arg Val Lys Gln Arg Pro Glu Gln Gly Leu Glu Trp Ile
35 40 45
Gly Arg Ile Asp Pro Gly Asp Gly Glu Thr Lys Tyr Val Pro Lys Phe
50 55 60
Gln Gly Lys Ala Thr Ile Thr Ala Asp Thr Ser Ser Asn Thr Ala Tyr
65 70 75 80
Leu Gln Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ser Arg Trp Asn Tyr Tyr Asp Ala Met Asp Tyr Trp Gly Gln Gly Thr
100 105 110
Ser Val Thr Val Ser Ser
115
<210> 7
<211> 321
<212> DNA
<213>mouse monoclonal antibody 1F2 light chain variable region nucleotide sequence
<400> 7
agtattgtta tgacccagac tcccaaattc ctgcttgttt cagcaggaga cagggttacc 60
ataacctgca aggccagtca gagtgtgagt aatgatgtat cttggtacca acagaagcca 120
gggcagtctc ctaaactgct gatatactat gcatccaatc gctacactgg agtccctgat 180
cgcttcactg gcagtggata tgggacggat ttcactttca ccatcagcac tgtgcaggct 240
gaagacctgg cagtttattt ctgtcagcag gattatagct ctccctggac gttcggtgga 300
ggcaccaagc tggaaatcaa a 321
<210> 8
<211> 107
<212> PRT
<213>mouse monoclonal antibody 1F2 chain variable region amino acid sequence
<400> 8
Ser Ile Val Met Thr Gln Thr Pro Lys Phe Leu Leu Val Ser Ala Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Ser Val Ser Asn Asp
20 25 30
Val Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile
35 40 45
Tyr Tyr Ala Ser Asn Arg Tyr Thr Gly Val Pro Asp Arg Phe Thr Gly
50 55 60
Ser Gly Tyr Gly Thr Asp Phe Thr Phe Thr Ile Ser Thr Val Gln Ala
65 70 75 80
Glu Asp Leu Ala Val Tyr Phe Cys Gln Gln Asp Tyr Ser Ser Pro Trp
85 90 95
Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys
100 105

Claims (10)

  1. It is mouse monoclonal antibody 1. specifically binding the variable region sequences of the mouse monoclonal antibody of pseudorabies virus gC albumen The variable region sequences of 1B9 or the variable region sequences of mouse monoclonal antibody 1F2.
  2. 2. variable region sequences according to claim 1, which is characterized in that in the variable region sequences of mouse monoclonal antibody 1B9 In, heavy chain variable amino acid sequence is amino acid sequence shown in SEQ ID No.2 or the sequence by one or more ammonia The addition of base acid is deleted, the conservative variant of replacement or modification conservative mutation acquisition；And/or chain variable region amino acid sequence Amino acid sequence shown in SEQ ID No.4 or the sequence is classified as to add, delete, replace or repair by one or more amino acid Adorn the conservative variant that conservative mutation obtains.
  3. 3. variable region sequences according to claim 1, which is characterized in that in the variable region sequences of mouse monoclonal antibody 1F2 In, heavy chain variable amino acid sequence is amino acid sequence shown in SEQ ID No.6 or the sequence by one or more ammonia The addition of base acid is deleted, the conservative variant of replacement or modification conservative mutation acquisition；And/or chain variable region amino acid sequence Amino acid sequence shown in SEQ ID No.8 or the sequence is classified as to add, delete, replace or repair by one or more amino acid Adorn the conservative variant that conservative mutation obtains.
  4. 4. pseudorabies virus gC protein antibodies, by its respective weight chain variable in the variable region sequences of Claims 2 or 3 Region sequence or its conservative variant, and/or it is corresponding its respectively in the variable region sequences light-chain variable sequence or its protect Keeping property variant composition；The segment of the antibody or the antibody still keeps the ability of specific binding pseudorabies virus；And/or The antibody is monoclonal antibody or genetic engineering antibody；It is preferred that the genetic engineering antibody includes single-chain antibody, chimeric Dan Ke Grand antibody, reshaping monoclonal antibody, the segment of pig resource monoclonal antibody or the antibody；It is preferred that the antibody is anti-for murine monoclonal Body 1B9 or mouse monoclonal antibody 1F2.
  5. 5. application of the antibody according to claim 4 in the pseudorabies virus detection for carrying out non-diagnostic purpose； It is preferred that the pseudorabies virus detection of the non-diagnostic purpose includes epidemiological analysis, is detected in vitro tissue, epitope Identification research, vaccine semi-finished product and product inspection and qualitative and quantitative diagnostic test antigen containing pseudorabies virus and other The detection of pseudorabies virus antigen in the vaccine composition of antigen；It is preferred that the method using immunohistochemistry carries out non-diagnostic mesh Pseudorabies virus detection；The method of the further preferred immunohistochemistry uses mouse monoclonal antibody 1F2 for primary antibody；Into The preferred primary antibody of one step using when make 1:50-1:1000 dilution.
  6. 6. a kind of ELISA kit comprising the segment of antibody or the antibody described in claim 4, pseudorabies virus gC egg White standard items, and the detection reagent for being detected to antigen-antibody reaction.
  7. 7. kit according to claim 6, which is characterized in that the antibody includes that mouse monoclonal antibody 1B9 and mouse are single Clonal antibody 1F2, and one of described mouse monoclonal antibody 1B9 and mouse monoclonal antibody 1F2 is coated on microwell plate, separately A kind of labeled substance markers；
    And/or the marker includes enzyme, fluorophor or chemiluminescent groups；
    The detection reagent is the substrate that color reaction occurs with the marker；Preferably, the detection reagent includes that enzyme is aobvious Color reagent, fluorescent reagent or chemical illuminating reagent.
  8. 8. kit according to claim 7 comprising enzyme label mouse monoclonal antibody 1B9, for being coated with microwell plate Mouse monoclonal antibody 1F2 and pseudorabies virus gC protein standard substance；
    Preferably, the package amount of the mouse monoclonal antibody 1F2 is 0.075-0.15 μ g/ml；The murine monoclonal of the enzyme label Carry out 1:(1500-9000 when antibody 1B9 use) volume dilution.
  9. 9. utilizing the detection pseudorabies virus gC albumen of ELISA detection kit described in any one of claim 7-8 The method of content comprising:
    Standard items serial dilutions, measuring samples dilution are added in microwell plate simultaneously, are incubated for by step S1；
    Step S2 abandons reaction solution；
    Step S3, by the enzyme labelled antibody micropore plate incubation after dilution；
    Step S4 abandons reaction solution；
    Step S5 adds developing solution, is incubated for；
    Step S6 adds terminate liquid, and surveys absorbance value OD with microplate reader450nm；
    Step S7 draws standard curve according to the absorbance value of standard items serial dilutions, calculates PRVgC albumen in measuring samples Corresponding content；
    Preferred standard product serial dilutions are by being diluted to 0-720ng/ml with sample diluting liquid for standard items；
    Further preferred standard items series diluted is 0-360ng/ml.
  10. 10. a kind of ELISA detection kit as described in any one of claim 7-8 is in quantitative detection pseudorabies virus gC Albumen holoprotein or its segment or its conservative variant or its active fragment single expression, or with other albumen expressing in series or Application in the content of pseudorabies virus gC albumen when amalgamation and expression.
CN201710515776.0A 2017-06-29 2017-06-29 Pseudorabies virus gC protein antibody, kit containing antibody and application Active CN109212205B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710515776.0A CN109212205B (en) 2017-06-29 2017-06-29 Pseudorabies virus gC protein antibody, kit containing antibody and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710515776.0A CN109212205B (en) 2017-06-29 2017-06-29 Pseudorabies virus gC protein antibody, kit containing antibody and application

Publications (2)

Publication Number Publication Date
CN109212205A true CN109212205A (en) 2019-01-15
CN109212205B CN109212205B (en) 2021-08-20

Family

ID=64976715

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710515776.0A Active CN109212205B (en) 2017-06-29 2017-06-29 Pseudorabies virus gC protein antibody, kit containing antibody and application

Country Status (1)

Country Link
CN (1) CN109212205B (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5122447A (en) * 1989-01-23 1992-06-16 Iowa State University Research Foundation, Inc. Method of detecting pseudorabies virus specific serum antibody by use of a universal diagnostic antigen
EP0752888B1 (en) * 1994-03-30 2007-08-15 Virogenetics Corporation NUCLEOTIDE AND AMINO ACID SEQUENCES OF CANINE HERPESVIRUS gB, gC and gD AND USES THEREFOR
CN104459121A (en) * 2014-11-28 2015-03-25 洛阳普莱柯万泰生物技术有限公司 PRV (pseudorabies virus) antibody detection system and preparation method thereof
CN106188280A (en) * 2016-07-22 2016-12-07 洛阳普莱柯万泰生物技术有限公司 Monoclonal antibody and vaccine combination thereof and application
CN106596946A (en) * 2015-10-14 2017-04-26 江苏维赛科技生物发展有限公司 Porcine pseudorabies virus near-infrared fluorescence detection kit and uses thereof

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5122447A (en) * 1989-01-23 1992-06-16 Iowa State University Research Foundation, Inc. Method of detecting pseudorabies virus specific serum antibody by use of a universal diagnostic antigen
EP0752888B1 (en) * 1994-03-30 2007-08-15 Virogenetics Corporation NUCLEOTIDE AND AMINO ACID SEQUENCES OF CANINE HERPESVIRUS gB, gC and gD AND USES THEREFOR
CN104459121A (en) * 2014-11-28 2015-03-25 洛阳普莱柯万泰生物技术有限公司 PRV (pseudorabies virus) antibody detection system and preparation method thereof
CN106596946A (en) * 2015-10-14 2017-04-26 江苏维赛科技生物发展有限公司 Porcine pseudorabies virus near-infrared fluorescence detection kit and uses thereof
CN106188280A (en) * 2016-07-22 2016-12-07 洛阳普莱柯万泰生物技术有限公司 Monoclonal antibody and vaccine combination thereof and application

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
陈振海等: "用重组腺病毒免疫方法制备伪狂犬病病毒gC蛋白单克隆抗体", 《中国兽医科学》 *

Also Published As

Publication number Publication date
CN109212205B (en) 2021-08-20

Similar Documents

Publication Publication Date Title
JP5597128B2 (en) H5 subtype-specific binding protein useful for diagnosis and monitoring of H5 avian influenza
CN104031144B (en) Specific bond HEV 3, antibody of 4 types and application thereof
CN105837686B (en) Monoclonal antibody and application thereof
CN109232736B (en) Monoclonal antibody specifically binding to porcine transmissible gastroenteritis virus, pharmaceutical composition, kit and application thereof
CN111925436B (en) Monoclonal antibody of African swine fever virus P30 protein and application thereof
CN109232734B (en) Monoclonal antibody specifically binding canine adenovirus, pharmaceutical composition, kit and application thereof
CN114426974B (en) Antibodies or antibody fragments specifically binding to the CD2v protein of African swine fever virus
CN110272488B (en) Cat calicivirus monoclonal antibody and application thereof
CN107449912B (en) Anti- H7N9 subtype avian influenza virus monoclonal antibody antigen epitope and its screening technique and application
CN109206509B (en) Monoclonal antibody combined with pseudorabies virus gD protein and application thereof
CN112876559B (en) Monoclonal antibody specifically binding to porcine rotavirus and application thereof
WO2023036153A1 (en) New coronavirus antibody and use thereof
CN109959788B (en) Coating antigen and enzyme-labeled antibody for detecting porcine pseudorabies virus gE antibody and blocking method kit
CN102747044A (en) Porcine pseudorabies virus resisting hybridoma cell line, preparation method thereof, monoclonal antibody and application thereof
CN108752471B (en) Preparation method and application of anti-PCV 2 monoclonal antibody
CN105717293B (en) A kind of kit for being used to detect porcine circovirus 2 type
CN106119210B (en) A kind of Poliovirus I monoclonal antibody and its application
CN115947835B (en) Antibody targeting influenza B virus nucleoprotein and application thereof
CN112094352A (en) anti-IgM monoclonal antibody
CN104479022A (en) Anti-S-adenosyl-L-homocysteine monoclonal antibody 301, hybridomas thereof, composition, colloidal gold test paper, kit and uses
CN109206510B (en) Monoclonal antibody combined with pseudorabies virus gB protein and application thereof
CN110632298B (en) Canine adenovirus 1 type monoclonal antibody, variable region sequence, hybridoma cell strain and application thereof
CN113817054B (en) Murine monoclonal antibody 5B11 specifically binding porcine rotavirus VP6 protein and application thereof
CN114316037B (en) Antibody m19 of O-type foot-and-mouth disease virus structural protein, preparation method and application
CN109212205A (en) Pseudorabies virus gC protein antibodies, the kit containing the antibody and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB02 Change of applicant information
CB02 Change of applicant information

Address after: Room 1010, Commune No. 6, Huaxia Road, No. 6, High-tech Zone, Luoyang China (Henan) Free Trade Experimental Zone, Henan Province

Applicant after: Luoyang Pu Tai Biotechnology Co.,Ltd.

Address before: 471003 Huaxia Road, hi tech Zone, Luoyang, Henan

Applicant before: LUOYANG PULIKE WANTAI BIOLOGICAL TECHNOLOGY Co.,Ltd.

GR01 Patent grant
GR01 Patent grant