CN109207589A - The kit of one-step method real-time fluorescent quantitative reverse transcription polymerase chain reaction detection people's cell Keratin 7 - Google Patents
The kit of one-step method real-time fluorescent quantitative reverse transcription polymerase chain reaction detection people's cell Keratin 7 Download PDFInfo
- Publication number
- CN109207589A CN109207589A CN201710535124.3A CN201710535124A CN109207589A CN 109207589 A CN109207589 A CN 109207589A CN 201710535124 A CN201710535124 A CN 201710535124A CN 109207589 A CN109207589 A CN 109207589A
- Authority
- CN
- China
- Prior art keywords
- detection
- polymerase chain
- kit
- chain reaction
- reverse transcription
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention is a kind of one-step method real-time fluorescent quantitative RT-RCR detection of human cytokeratin 7 kit, the kit is using mRNA as template, carry out reverse transcription and real-time fluorescence quantitative PCR in same reaction system, without opening pipe lid in reaction process, cross contamination is avoided, and the mrna expression amount of people's cell Keratin 7 (CK7) in sample can be detected with accurate quantification.The kit can be used in clinical and scientific research detecting the expression of CK7 in the samples such as peripheral blood in patients, lymph node, to auxiliary diagnosis, guiding treatment colorectal cancer and prompt prognosis.
Description
Technical field
It is one kind by making reverse transcription and real-time fluorescence quantitative PCR using mRNA as template the invention belongs to field of biotechnology
The detection technique carried out in same reaction system can detect people's cell Keratin 7 (CK7) in sample with accurate quantification
The kit of mrna expression amount.
Background technique
Last century mid-term, as survive living environment, the continuous of eating habit and living standard of people changes, constantly mentions
Height, disease incidence/death rate of all kinds of tumours is also in rise year by year trend at the same time.The morbidity and mortality of colorectal cancer are only
Inferior to lung cancer and breast cancer, it has also become third malignant tumour.Colorectal cancer has the biological characteristics of high malignancy and invasion,
Infiltration, transfer often occurs, this biological characteristics is to lead to that patient's prognosis is poor and the higher key factor of the death rate.Knot is straight
The generation of intestinal cancer, development be it is related to polygenes, multifactor influence each other, multi-step, intricate incremental process；So
And its diagnosis and treatment key takeaway is early detection, early diagnosis, early treatment as most of tumours.Clinical research shows
The surgical cure rate of early stage colorectal cancer can achieve 80%-90%, however colorectal cancer patients are usually because early stage lacks specificity
Clinical symptoms and sign, be not easy to cause the enough attention of patient, it is difficult to timely find parallel operative treatment in illness early stage.
Most colorectal cancer patients have been mid-terms in discovery, even advanced stage, even if row operative treatment, it is also difficult to reach patient's ideal
Effect, the postoperative recurrence rate of transform is higher, and life cycle is also shorter, and prognosis is bad.In recent years, with digestive endoscope binding of pathological
Diagnostic method based on inspection is clinically widely applied, but for China at present medical status for, wouldn't be suitble to advise greatly
Mould digests endoscope screening, and then causes early stage row operative treatment rate lower.Even if clinical discovery Advanced colorectal cancer patient
Operative treatment is carried out, also has the patient of 30%-40% is postoperative to occur recurring or shifting sending out, recurrence and transfer now result in knot directly
One of dead main reason of patients with bowel cancer.In recent years, treatment of colorectal cancer and operation plan have apparent improvement and progress,
Simultaneously various anaphase means such as: Radiotherapy chemotherapy constantly update with it is perfect, the new methods such as biological therapy, gene therapy are continuous
It emerges in large numbers.The tumour cell survived in blood circulation is the basis of DISTANT METASTASES IN and recurrence, although the various detections of various colorectal cancers
Method constantly increases, however this kind of cell quantities are atomic, are not easy to detected by routine clinical means.In recent years, pass through
RT-polymerase chain reaction (RT-PCR) technology detects trace circular tumour cell in peripheral blood
(Circulatingtumor cell, CTC) has become and may and be attempted.
Keratin (CK) is a kind of silk-fibroin, is present between epithelial cell, has and keeps epithelial cell and tissue mechanical
The effect of stability and integrality.The study found that there is keratin in normal tissue cell epithelium and cancer cell, and in health
But without finding the trace of keratin in human peripheral blood, but then there is keratin in the peripheral blood of tumor patient.Cell
The discrimination factor that Keratin 7 (CK7) can be used as the Nasopharyngeal neoplasms such as colon cancer, liver cancer can also be used as diagnosis Colon and rectum
The diagnosis index whether cancer shifts.Therefore whether there is or not the tables of CK7 mRNA in the detection samples such as peripheral blood in patients and lymph node
It reaches, strong evidence can be provided to the transfer diagnosing and treating of the colorectal cancer tumour in epithelium class source, it can also be to tumour
Transfer and recurrence and observation of curative effect provide help.One-step method fluorescent quantitative PCR technique makes reverse transcription and PCR amplification same
It is carried out in one reaction system, without opening pipe lid in reaction process, avoids cross contamination, save experimental period.With conveniently, just
The features such as prompt, reproducible.
Summary of the invention
Kit of the present invention includes: RT-polymerase chain reaction liquid (RT-PCR reaction solution), Moloney Murine Leukemia
Viral (M-MuLV) reverse transcriptase, RNase inhibitor (Rnasin), Taq DNA polymerase (Taq archaeal dna polymerase),
Standard items, yin and yang attribute reference substance.
Wherein RT-polymerase chain reaction liquid contains the water of coke diethyl phthalate processing, reverse transcriptase polymerase chain buffering
Liquid, oligomerization (dT) 15-18 (Oligo (dT)15-18)、dNTPs、MgCl2, detection use upstream and downstream primer, fluorescence probe.
Detection is surveyed with primer sorting with upstream primer and detection downstream primer:
Upstream primer sequence are as follows: 5 '-ACCAGTTCGCCATGGATGAC -3 ',
Downstream primer sequence are as follows: 5 '-GATCTGGGTCATCTTTTCACGG -3 ',
Fluorescence probe sequence are as follows: 5 '-FAM-TCGCTGCGCTCGTCGTCGA-TAMRA -3 '
Standard items sequence are as follows:
ACCAGTTCGCCATGGATGACGATATCGCTGCGCTCGTCGTCGACAACGGCTCCGGCATGTGCAAGGCCGGCTT
CGCGGGCGACGATGCTCCCCGGGCCGTCTTCCCCTCCATCGTGGGCCGCCCTAGGCACCAGGGTGTGATGGTGGGTA
TGGGTCAGAAGGACTCCTACGTGGGCGACGAGGCCCAGAGCAAGAGAGGCATCCTGACCCTGAAGTACCCCATTGAA
CACGGCATTGTCACCAACTGGGACGATATGGAGAAGATTTGGCACCACACTTTCTACAATGAGCTGCGTGTGGCCCC
TGAGGAGCACCCTGTGCTGCTCACCGAGGCCCCTCTGAACCCTAAGGCCAACCGTGAAAAGATGACCCAGATC。
In yin and yang attribute reference substance, negative controls are the RNA sample of no CK7 mRNA, and positive reference substance is to have people's cell angle
The RNA sample of albumen 7 (CK7) mRNA.
This kit is stored in -20 DEG C, reduces multigelation to the greatest extent.
The present invention establishes the side of one-step method real-time fluorescent quantitative reverse transcription polymerase chain reaction technique detection CK7 expression
Method avoids cross contamination, saves experimental period without opening pipe lid in reaction process.In this detection project, we are used
Specificity fluorescent probe hybridizes quantitative PCR detection technique, reduces false positive interference to the greatest extent under the premise of keeping hypersensitivity, makes
The specificity of tested cls gene greatly improves.And through detecting patient's sample, show that this method is practical.Designed by this method
Primer, probe and testing result can provide reliable foundation for the exploitation of fluorescent quantificationally PCR detecting kit.
Kit application method of the present invention:
Detection should all set up positive reference substance and negative controls every time.Standard items are diluted to 1 × 10 with 1 × TE buffer2-
1×107Copy/ml.
Reverse transcriptase polymerase chain augmentation detection: carrying out on fluorescence quantitative PCR instrument, 50 μ l of total volume, wherein reverse transcriptase polymerase
46.5 μ l of chain reaction liquid, test sample (mRNA, standard items, positive or negative control) 2 μ l, Moloney Murine Leukemia virus
(M-MuLV) 0.5 μ l of reverse transcriptase, 0.5 μ l of RNase inhibitor (Rnasin), (Taq DNA is poly- for Taq DNA polymerase
Synthase) 0.5 μ l.Reaction condition: 45 DEG C reverse transcription 30 minutes, 95 DEG C initial denaturation 5 minutes, 95 DEG C 30 seconds, 60 DEG C of 30 seconds, 72
DEG C of 30 seconds totally 40 circulations, 72 DEG C extend 10 minutes.According to standard curve obtained, CK7 in each sample to be measured is calculated
Amount (copy number/ml).
Detailed description of the invention
Fig. 1 is the detection of real-time fluorescence quantitative RT-PCR standard items.
Fig. 2 is real-time fluorescence quantitative RT-PCR standard curve.
Specific embodiment
The present invention is described further with reference to the drawings and specific embodiments.It should be understood that these embodiments are merely to illustrate
Purpose, rather than the limitation scope of the invention.
Embodiment 1
The expression of one-step method fluorescence quantitative RT-RCR method detection CK7.
One, material:
Trizol reagent and restriction enzyme are purchased from invitrogen company of the U.S., pGEM-T-Easy cloning vector, M-
MLV reverse transcriptase, Taq archaeal dna polymerase, Oligo (dT) 15-18 are purchased from U.S. Promega company, ABI7500 type quantitative PCR
Instrument is American AB I Products.
Two, primer and probe design and synthesis:
With CK7 full length cDNA sequence (GenBank accession number NM_031144.3) for template, Primer ExpressTM is used
(V3.0, American AB I company) software analyzes TaqMan primer and probe site, and according to considering CK7 genomic dna sequence simultaneously
Situation therefrom selects optimal combination.The primer of standard items of the present invention and inspection are same primers with primer.
Upstream primer sequence is
5 '-ACCAGTTCGCCATGGATGAC -3 ',
Downstream primer sequence is
5 '-GATCTGGGTCATCTTTTCACGG -3 ',
Fluorescence probe sequence is
5 '-FAM-TCGCTGCGCTCGTCGTCGA-TAMRA -3 ', by Dalian, treasured biotech company is synthesized.
Three, prepared by standard items
The fresh surgical sample of patient liquid nitrogen cryopreservation immediately, and mentioned after being ground in mortar in the presence of liquid nitrogen with Trizol reagent
Total serum IgE is taken, 2.5 μ l RNA are taken, in 50 μ l RT-polymerase chain reaction volumes, with upstream and downstream primer in 7500 type of ABI
Carry out PCR amplification in PCR instrument, condition be 45 DEG C reverse transcription 30 minutes, 95 DEG C initial denaturation 5 minutes, 95 DEG C 30 seconds, 60 DEG C 30
Second, 72 DEG C totally 30 circulations, 72 DEG C of extensions set 4 DEG C after ten minutes within 30 seconds.
PCR product is inserted into pGEM-T-Easy cloning vector with cloning system after electrophoresis detection, and positive colony is sent
Shanghai Sangon Biotech Company carries out sequence verification.Cloning vector plasmids, as standard items are extracted after being sequenced successfully.Measurement concentration is simultaneously changed
It is counted as (copy number/volume).
Embodiment 2
The application of fluorescence quantitative RT-RCR method detection CK7.
8 Peripheral Blood from Patients with Malignant samples through definitive pathological diagnosis separate Peripheral Blood Nucleated Cells, after PBS is washed
Cell Trizol reagent is collected by centrifugation and extracts cell total rna, 2.5 μ l RNA are taken, in 50 μ l RT-polymerase chain reaction bodies
In product, carry out PCR amplification in 7500 type PCR instrument of ABI with upstream and downstream primer, condition be 45 DEG C reverse transcription 30 minutes, 95 DEG C are pre-
Denaturation 5 minutes, 95 DEG C totally 40 circulations, 72 DEG C of extensions set 4 DEG C after ten minutes within 30 seconds within 30 seconds, 72 DEG C within 30 seconds, 60 DEG C.Together
Standard curve is made in the quasi- product examine survey of Shi Jiabiao.Measurement result handles the CK7 table that detection sample is calculated according to standard curve through instrument
Up to amount.
Two, sample detection result
Standard items testing result referring to Fig. 1 standard curve referring to fig. 2.
8 peripheral blood in patients detection result of specimen such as following tables
| Patient code | Gender | Age | Sample | CK7 value (copy number/ml) |
| 1 | Female | 49 | Peripheral blood | 1.0×103 |
| 2 | Female | 57 | Peripheral blood | 2.5×10 |
| 3 | Male | 66 | Peripheral blood | 3.5×103 |
| 4 | Male | 61 | Peripheral blood | 1.2×10 |
| 5 | Female | 83 | Peripheral blood | 1.4×102 |
| 6 | Male | 54 | Peripheral blood | 2.8×10 |
| 7 | Female | 68 | Peripheral blood | 1.0×102 |
| 8 | Male | 71 | Peripheral blood | 2.9×10 |
Present invention combination most preferred embodiment is described, however after having read appeal content of the invention, this field skill
Art personnel can make various changes or modifications the present invention, and such equivalent forms equally fall within the application the appended claims institute
The range of restriction.
ACCAGTTCGCCATGGATGACGATATCGCTGCGCTCGTCGTCGACAACGGCTCCGGCATGTGCAAGGCCGGCTT
CGCGGGCGACGATGCTCCCCGGGCCGTCTTCCCCTCCATCGTGGGCCGCCCTAGGCACCAGGGTGTGATGGTGGGTA
TGGGTCAGAAGGACTCCTACGTGGGCGACGAGGCCCAGAGCAAGAGAGGCATCCTGACCCTGAAGTACCCCATTGAA
CACGGCATTGTCACCAACTGGGACGATATGGAGAAGATTTGGCACCACACTTTCTACAATGAGCTGCGTGTGGCCCC
TGAGGAGCACCCTGTGCTGCTCACCGAGGCCCCTCTGAACCCTAAGGCCAACCGTGAAAAGATGACCCAGATC
Claims (2)
1. a kind of kit of one-step method real-time fluorescent quantitative reverse transcription polymerase chain reaction detection people's cell Keratin 7, containing inverse
Transcriptase polymerase chain reaction liquid, Moloney Murine Leukemia viral (M-MuLV) reverse transcriptase, RNase inhibitor, heat resistance
Archaeal dna polymerase, standard items and yin and yang attribute reference substance；It is characterized in that: RT-polymerase chain reaction liquid contains coke diethyl phthalate
Water, RT-polymerase chain reaction buffer, the oligomerization (dT) of processing15-18、dNTPs、MgCl2, detection with upstream primer, detection
With downstream primer, fluorescence probe, in which:
Detection is with upstream primer sequence
5 '-ACCAGTTCGCCATGGATGAC -3 ',
Detection is with downstream primer sequence
5 '-GATCTGGGTCATCTTTTCACGG -3 ',
Fluorescence probe sequence is
5 '-FAM-TCGCTGCGCTCGTCGTCGA-TAMRA -3 ',
Standard items sequence is
ACCAGTTCGCCATGGATGACGATATCGCTGCGCTCGTCGTCGACAACGGCTCCGGCATGTGCAAGGCCGGCTT
CGCGGGCGACGATGCTCCCCGGGCCGTCTTCCCCTCCATCGTGGGCCGCCCTAGGCACCAGGGTGTGATGGTGGGTA
TGGGTCAGAAGGACTCCTACGTGGGCGACGAGGCCCAGAGCAAGAGAGGCATCCTGACCCTGAAGTACCCCATTGAA
CACGGCATTGTCACCAACTGGGACGATATGGAGAAGATTTGGCACCACACTTTCTACAATGAGCTGCGTGTGGCCCC
TGAGGAGCACCCTGTGCTGCTCACCGAGGCCCCTCTGAACCCTAAGGCCAACCGTGAAAAGATGACCCAGATC。
2. the reagent of Real time quantitative RT-PCR detection people's cell Keratin 7 as described in claim 1
Box, it is characterized in that: one, reverse transcription and real-time fluorescence quantitative PCR carry out in same reaction system, without opening in reaction process
Pipe lid, avoids cross contamination；Two, reference substance divides negative controls and positive reference substance, and wherein negative controls are thin for nobody
The RNA sample of born of the same parents' Keratin 7 mRNA, positive reference substance are the RNA sample of someone's cytokeratin 7 (CK7) mRNA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710535124.3A CN109207589A (en) | 2017-07-05 | 2017-07-05 | The kit of one-step method real-time fluorescent quantitative reverse transcription polymerase chain reaction detection people's cell Keratin 7 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710535124.3A CN109207589A (en) | 2017-07-05 | 2017-07-05 | The kit of one-step method real-time fluorescent quantitative reverse transcription polymerase chain reaction detection people's cell Keratin 7 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109207589A true CN109207589A (en) | 2019-01-15 |
Family
ID=64992568
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710535124.3A Pending CN109207589A (en) | 2017-07-05 | 2017-07-05 | The kit of one-step method real-time fluorescent quantitative reverse transcription polymerase chain reaction detection people's cell Keratin 7 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109207589A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1410547A (en) * | 2002-11-12 | 2003-04-16 | 浙江大学医学院附属第二医院 | Real time fluorescence quantitative RT-PCR detection human cell keratin20 reagent box |
| CN1693479A (en) * | 2005-02-01 | 2005-11-09 | 合肥中科大生物技术有限公司 | Kit with fluorescent quantitative RT-PCR detection technique used for cell keratin 19(Ck19)mRNA |
| CN101365806A (en) * | 2005-12-01 | 2009-02-11 | 医学预后研究所 | Methods, kits and devices for identifying biomarkers of treatment response and use thereof to predict treatment efficacy |
| CN101760523A (en) * | 2008-10-23 | 2010-06-30 | 上海复星医药（集团）股份有限公司 | RT-PCR technology for analyzing ARHGDIB gene expression quantity by using ACTB gene |
| CN102719547A (en) * | 2012-07-02 | 2012-10-10 | 厦门大学 | Real-time fluorescence quantitative PCR (Polymerase Chain Reaction) kit for detecting expression level of HER2 genes |
| CN103173553A (en) * | 2013-03-21 | 2013-06-26 | 中国食品药品检定研究院 | Fluorogenic quantitative polymerase chain reaction (PCR) detection assay kit for complementary deoxyribonucleic acid (cDNA) sequence of mouse beta-actin |
-
2017
- 2017-07-05 CN CN201710535124.3A patent/CN109207589A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1410547A (en) * | 2002-11-12 | 2003-04-16 | 浙江大学医学院附属第二医院 | Real time fluorescence quantitative RT-PCR detection human cell keratin20 reagent box |
| CN1693479A (en) * | 2005-02-01 | 2005-11-09 | 合肥中科大生物技术有限公司 | Kit with fluorescent quantitative RT-PCR detection technique used for cell keratin 19(Ck19)mRNA |
| CN101365806A (en) * | 2005-12-01 | 2009-02-11 | 医学预后研究所 | Methods, kits and devices for identifying biomarkers of treatment response and use thereof to predict treatment efficacy |
| CN101760523A (en) * | 2008-10-23 | 2010-06-30 | 上海复星医药（集团）股份有限公司 | RT-PCR technology for analyzing ARHGDIB gene expression quantity by using ACTB gene |
| CN102719547A (en) * | 2012-07-02 | 2012-10-10 | 厦门大学 | Real-time fluorescence quantitative PCR (Polymerase Chain Reaction) kit for detecting expression level of HER2 genes |
| CN103173553A (en) * | 2013-03-21 | 2013-06-26 | 中国食品药品检定研究院 | Fluorogenic quantitative polymerase chain reaction (PCR) detection assay kit for complementary deoxyribonucleic acid (cDNA) sequence of mouse beta-actin |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105603101B (en) | Detect application of the system of 8 miRNA expression quantity in diagnosis or auxiliary diagnosis of hepatoma product is prepared | |
| CN104372087B (en) | The diagnosing cancer of liver mark being made up of serum microRNA and diagnostic kit | |
| CN101851682B (en) | MiRNA combination used for detecting esophageal squamous cell carcinoma and application thereof | |
| CN108624688B (en) | Application of hsa _ circ _0012755 as prostate cancer molecular target in preparation of medicines and kits | |
| CN109439757A (en) | Application of the blood plasma excretion body miR-455-3p as early liver cancer diagnosis marker | |
| CN103074431B (en) | Special primer, kit and method for testing minRNA-128 in colorectal cancer serum | |
| CN109337961A (en) | The kit of one-step method real-time fluorescent quantitative reverse transcription polymerase chain reaction detection people's matrix metalloproteinase 11 | |
| CN106399527A (en) | Primer group for detecting renal cancer and detecting method thereof | |
| CN110257514A (en) | A kind of new cancer of the esophagus blood miRNA marker and its application | |
| CN109207589A (en) | The kit of one-step method real-time fluorescent quantitative reverse transcription polymerase chain reaction detection people's cell Keratin 7 | |
| CN105154533A (en) | MiRNA composition and kit therefore for diagnosis of early hepatocellular carcinoma | |
| CN106636440A (en) | Application of plasma microRNAs to preparation of diagnosis reagent for screening and diagnosing lung adenocarcinoma patients from male population | |
| CN109536589A (en) | The kit of one-step method real-time fluorescent quantitative reverse transcription polymerase chain reaction detection people miR-1290 | |
| CN106520924A (en) | Primer set and detection method for detecting ovarian cancer | |
| CN109536584A (en) | The kit of one-step method real-time fluorescent quantitative reverse transcription polymerase chain reaction detection human epithelial cells adhesion molecule | |
| CN106148554A (en) | A kind of mark for carcinoma of prostate detection and the application in test kit thereof | |
| CN109402227A (en) | The kit of one-step method real-time fluorescent quantitative reverse transcription polymerase chain reaction detection people's matrix metallopeptidase 1 | |
| CN109929921A (en) | MicroRNA 21 (MIR21) nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method) | |
| CN109957609A (en) | Utilize the kit of PCR- fluorescence probe method detection 155 nucleic acid quantification of MicroRNA | |
| CN106636450B (en) | It is a kind of for diagnosing the non-invasive marker object and kit of Lung Squamous Carcinoma Patients in non-smoking or slight smoking population | |
| CN104774916B (en) | Biomarker combination used for detection of chemotherapy curative effect and/or prognosis of metastatic colorectal cancer and application thereof | |
| CN105671178B (en) | Serum microRNA diagnosing cancer of liver marker and kit | |
| CN104911248A (en) | Micro RNA combination used for II and III stage colorectal cancer diagnosis and prognosis as well as application thereof | |
| CN108796073A (en) | A kind of kit of joint-detection gene maspin and miR-17 Diagnosis of Breast cancer | |
| CN109055556A (en) | A kind of lncRNA detection kit and its application for diagnosing transfer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190115 |