CN109207501A

CN109207501A - Express the construction method of the sequence of universal Chimeric antigen receptor

Info

Publication number: CN109207501A
Application number: CN201811117096.4A
Authority: CN
Inventors: 张宏涛; 彭亮; 王先进
Original assignee: Shenzhen Feipeng Biotherapy Co Ltd
Current assignee: Shenzhen Feipeng Biotherapy Co Ltd
Priority date: 2018-09-25
Filing date: 2018-09-25
Publication date: 2019-01-15

Abstract

The present invention relates to molecular biology fields, in particular to a kind of construction method of sequence for expressing universal Chimeric antigen receptor.The described method includes: the CAR skeleton area that the nucleic acid sequence of each function fragment for the Chimeric antigen receptor (CAR) for not including antigen-binding domains is obtained by Overlap extension PCR anastomosing and splicing；The restriction enzyme site there are two IIs type restriction enzyme is preset in the function fragment for being inserted into antigen-binding domains in CAR skeleton area.The CAR sequence obtained when antigen binding domain is inserted into the sequence that this method constructs will not leave behind " trace " of any restriction enzyme site.

Description

Express the construction method of the sequence of universal Chimeric antigen receptor

Technical field

The present invention relates to molecular biology fields, in particular to a kind of sequence for expressing universal Chimeric antigen receptor The construction method of column.

Background technique

Adoptive cellular immunotherapy (ACI) is at present for one of more effective treatment method of malignant tumour.At present The clinical trial curative effect ideal for a variety of solid tumors and neoplastic hematologic disorder has been reported.Wherein, Chimeric antigen receptor (chimeric Antigen receptor, CAR) T cell technology is to develop a kind of very fast cell therapy technology in recent years.Pass through gene Renovation technique, effector T cell has both target killing and persistence, while for tumor by local immunosupress microenvironment and breaking The CAR-T of host immune tolerance status has also had been reported that.

Currently, the preparation of CAR-T is still based on lentiviruses transduction, while also having through non-virus carrier and gene editing The mode that technology such as CRISPR/CAS9 system prepares the gene site-directed insertion T cell genome of CAR.CAR is generally believed by CD8 Number peptide, extracellular antigen binding domain (connecting rod that single chain antibody fragments include both light chain, heavy chain and connection), CD8 α Hinge, CD8 transmembrane region, CD137 (or CD28) and CD3 ζ composition, cytotoxicity, proliferation activity by improved T cell And time-to-live etc. is increased dramatically, to enhance T cell to the specific killing ability of tumour.

Since tumour has heterogeneity, different tumour cells has tumor associated antigen and specific antigen, such as Gynophore needs the corresponding single-chain antibody being directed to its corresponding CAR-T of different tumor diseases, so that slow virus is expressed The building of carrier is time-consuming and laborious or gene chemical synthesis expense cost increases, it is therefore necessary to develop a kind of universal i.e. slotting type Slow virus carrier, and " trace " can be left unlike single-chain antibody is inserted into CAR using double digestion by tradition clone.

In view of this, the present invention is specifically proposed.

Summary of the invention

The present invention relates to a kind of construction methods of sequence for expressing universal Chimeric antigen receptor, comprising:

The nucleic acid sequence for each function fragment for not including the Chimeric antigen receptor (CAR) of antigen-binding domains is passed through The CAR skeleton area that Overlap extension PCR anastomosing and splicing obtains；

There are two being preset in the function fragment for being inserted into antigen-binding domains in CAR skeleton area The restriction enzyme site of IIs type restriction enzyme.

It only needs to have can be obtained the connection constructed for the antigen binding domain of different tumor markers with the above method The CAR sequence of whole function.

This technology selection devises the CAR frame sequence containing special restriction enzyme site sequence, the restriction enzyme site cutting sequence Around identification sequence, therefore single-chain antibody is inserted into CAR skeleton and will not leave behind any " trace ", and existing slow virus is logical It mostly uses traditional restrictive enzyme to be inserted into single-chain antibody or redesign the different CAR of synthesis for different target spots with type carrier to divide Son, it is both rear first is that can leave a trace at single-chain antibody both ends, second is that time-consuming and expensive.

Detailed description of the invention

It, below will be to specific in order to illustrate more clearly of the specific embodiment of the invention or technical solution in the prior art Embodiment or attached drawing needed to be used in the description of the prior art be briefly described, it should be apparent that, it is described below Attached drawing is some embodiments of the present invention, for those of ordinary skill in the art, before not making the creative labor It puts, is also possible to obtain other drawings based on these drawings.

Fig. 1 is the plasmid map of pCDHF-0 plasmid employed in one embodiment of the invention；

Fig. 2 is the plasmid map of pCDHF-UPAarI plasmid employed in one embodiment of the invention；

Fig. 3 is the expression efficiency of CAR in one embodiment of the invention.

Specific embodiment

In some embodiments, the function fragment is containing one or more elements selected from the group being made up of:

Leader peptide, joint sequence, transmembrane domain, costimulation structural domain and signal transduction structural domain.

In some embodiments, the leader peptide is selected from CD8 leader Chimerical receptor signal peptide.

In some embodiments, the leader peptide is selected from the area hinge that joint sequence is selected from CD8.

In some embodiments, the transmembrane domain is selected from the transmembrane region of CD8.

In some embodiments, the costimulation structural domain be selected from CD27, CD28, CD137, OX40, CD30, CD40, In PD-1, LFA-1, CD2, CD7, Lck, DAP10, ICOS, LIGHT, NKG2C, B7-H3 and the ligand of CD3 ζ specific binding It is any, or any combination thereof.

In some embodiments, the signal transduction structural domain appointing in PKC θ, Fc ε RI γ, ZAP70, CD3 ζ One kind, or any combination thereof.

In some embodiments, the function fragment includes the hinge of CD8 leader Chimerical receptor signal peptide, CD8 Area, the transmembrane region of CD8, CD137 and CD3 ζ.

In some embodiments, for expanding first function fragment at the 5 ' ends in CAR skeleton area It is reserved in trip primer, and the downstream primer of 3 ' first function fragment held for expanding CAR skeleton area There is restriction enzyme site.

In some embodiments, the IIs type restriction enzyme be selected from AarI, BveI, Eam1104, Eco57I, Any one of EcoRII, SfiI.

In some embodiments, the function fragment further includes reporter gene.

In some embodiments, the reporter gene is fluorescent reporter gene.

In some embodiments, the fluorescent reporter gene be selected from GFP, EGFP, RFP, mCherry, Any one of mStrawberry, Luciferase, mApple, mRuby, EosFP.

According to an aspect of the present invention, the invention further relates to the expression constructed by construction method as described above is general The sequence of type Chimeric antigen receptor.

According to an aspect of the present invention, the universal chimeric antigen reached the invention further relates to sequence table as described above by Body.

According to an aspect of the present invention, the invention further relates to the carriers of sequence as described above.

In some embodiments, the carrier includes retrovirus or CRISPR/CAS plasmid.

In some embodiments, the retrovirus is slow virus.

In some embodiments, the CRISPR/CAS plasmid be selected from CRISPR/CAS-1, CRISPR/CAS-2, Any one of CRISPR/CAS-3, CRISPR/CAS-5, CRISPR/CAS-7, CRISPR/CAS-9, CRISPR/CAS-10.

According to an aspect of the present invention, the invention further relates to by being inserted into carrier as described above containing expression antigen The obtained recombinant vector of the nucleotide fragments of binding structural domain；

The two sides of the nucleotide fragments containing expression antigen-binding domains are provided with IIs type limit as described above The restriction enzyme site of property restriction endonuclease processed.

In some embodiments, the antigen-binding domains are sc-Fv or Fab antibody segment.

In some embodiments, wherein sc-Fv or Fab antibody segment be fitted into, humanization or human antibody segment.One In a little embodiments, the antigen-binding domains are the antigen-binding domains for identifying tumour.

In some embodiments, the antigen-binding domains of the identification tumour identify in the group of following antigen composition It is any: α-fetoprotein (AFP), α-actinine -4, A3, to A33 antibody have specificity antigen, ART-4, B7, Ba 733, BAGE, BrE3 antigen, CA125, CAMEL, CAP-1, carbonic anhydrase IX, CASP-8/m, CCL19, CCL21, CD1, CD1a、 CD2、CD3、CD4、CD5、CD8、CD11A、CD14、CD15、CD16、CD18、 CD19、CD20、CD21、CD22、 CD23、CD25、CD29、CD30、CD32b、CD33、 CD37、CD38、CD40、CD40L、CD44、CD45、CD46、CD52、 CD54、CD55、 CD59、CD64、CD66a-e、CD67、CD70、CD70L、CD74、CD79a、CD79b、 CD80、CD83、 CD95、CD126、CD132、CD133、CD138、CD147、CD154、 CDC27、CDK-4/m、CDKN2A、CTLA4、CXCR4、 CXCR7, CXCL12, HIF-1 α, colon-specific antigen p (CSAp), CEA (CEACAM-5), CEACAM-6, c-Met, DAM, EGFR, EGFRvIII, EGP-1 (TROP-2), EGP-2, ELF2-M, Ep-CAM, fiber mother cell growth factor (FGF), Flt- 1, Flt-3, folacin receptor, G250 antigen, GAGE, gp100, GRO- β, HLA-DR, HM1.24, human chorionic gonadotrophin (HCG) and its subunit, HER2/neu, HMGB-1, hypoxia inducible sex factor (HIF-1), HSP70-2M, HST-2, Ia, IGF-1R、IFN-γ、IFN-α、IFN-β、IFN-λ、IL-4R、IL-6R、IL-13R、 IL-15R、IL-17R、IL-18R、IL- 2, IL-6, IL-8, IL-12, IL-15, IL-17, IL-18, IL-23, IL-25, type-1 insulin like growth factor (IGF-1), KC4 Antigen, KS-1 antigen, KS1-4, Le-Y, LDR/FUT, macrophage migration inhibitory factor (MIF), MAGE, MAGE-3, MART1, MART-2、NY-ESO-1、TRAG-3、mCRP、MCP-1、MIP-1A、MIP-1B、MIF、 MUC1、MUC2、MUC3、MUC4、 MUC5ac, MUC13, MUC16, MUM-1/2, MUM-3, NCA66, NCA95, NCA90, cancer of pancreas mucoprotein, PD1 receptor, placenta Growth factor, p53, PLAGL2, prostatic acid phosphatase, PSA, PRAME, PSMA, PlGF, ILGF, ILGF-1R, IL-6, IL-25, RS5, RANTES, T101, SAGE, S100, survivin, survivin -2B, TAC, TAG-72, tenascin, TRAIL by Body, TNF-α, Tn antigen, Thomson-Fu Leidenglixi antigen, tumor necrosis antigens, VEGFR, ED-B fibronectin, WT-1, 17-1A antigen, complement factor C_3, C3a, C3b, C5a, C5, angiogenesis marker, bc1-2, bc1-6, Kras, oncogene Marker and oncogene products.

In some embodiments, the nucleotide sequence such as SEQ of the nucleotide fragments of the expression antigen-binding domains Shown in ID NO:1.

According to an aspect of the present invention, the invention further relates to a kind of host cells, by recombinant vector institute as described above Conversion.

In some embodiments, the host cell is T cell, NK cell, NKT cell, cytokine-induced killer Cell (cytokine induced killer, CIK), dendritic cells-cytokine induced kill cell (DC-CIK).

In some embodiments, T cell includes CD8+T cell and/or CD8+ memory T cell.

In some embodiments, the NK cell is selected from the NK cell for the group being made up of: primary NK cells, NK- 92, NK-92.26.5, NK 92.MI, NK-92Ci, NK-92Fc, NK3.3, NKL, NKG, NK-YT, NK-YTS, KHYG-1 and HATAK cell.

In certain embodiments, CAR-T or CAR-NK therapy is applicable to treating cancer.It is expected that any kind of tumour It can be all targeted with any kind of tumour antigen.The cancer for the exemplary types that can be targeted includes acute lymphoblastic Leukaemia, Acute Meyloid derived leukocythemia, cholangiocarcinoma, breast cancer, cervix cancer, chronic lymphocytic leukemia, chronic bone Marrow-derived leukocythemia, colorectal cancer, carcinoma of endometrium, cancer of the esophagus, gastric cancer, head-neck carcinoma, hodgkin's lymphomas, lung cancer, Medullary carcinoma of thyroid gland, non Hodgkin lymphom, Huppert's disease, kidney, oophoroma, cancer of pancreas, glioma, melanocyte Tumor, liver cancer, prostate cancer and urinary tract bladder cancer.However, the skilled artisan will recognise that virtually any type of cancer swells Tumor related antigen is all known.

According to an aspect of the present invention, the invention further relates to a kind of Chimeric antigen receptors, are inserted by sequence as described above It expresses and obtains after nucleotide fragments as mentioned above containing expression antigen-binding domains.

Embodiment of the present invention is described in detail below in conjunction with embodiment, but those skilled in the art will Understand, the following example is merely to illustrate the present invention, and is not construed as limiting the scope of the invention.It is not specified in embodiment specific Condition person carries out according to conventional conditions or manufacturer's recommended conditions.Reagents or instruments used without specified manufacturer is It can be with conventional products that are commercially available.

In following exemplary embodiments, the present invention provides a kind of quick, seamless building is anti-for different tumours The method of former universal slow virus carrier, this method comprises the following steps: utilizing over-lapping round pcr by CAR CD8 leader needed for molecule, the sequence fragment containing special restriction enzyme site, CD8 α hinge, CD8 transmembrane region, CD137 and CD3 ζ connects to form a complete CAR skeleton, and above-mentioned restriction enzyme site is AarI, around the enzyme spcificity cleavage site Therefore nucleic acid sequence will not include any extra unnecessary base using the CAR gone out constructed by the enzyme.

The amplification of original part needed for embodiment 1CAR skeleton

Using CD8 leader of the method for synthesizing gene synthesis comprising two sites AarI and with the front end CD8 α hinge It is overlapped the segment of 17bp, it is following (thickened portion is AarI restriction enzyme site) to be named as CD8lA its sequence:

Design overlapping primers expand CAR skeleton original part respectively, and primer is following, and (underscore is overlay region, and overstriking italic is enzyme Enzyme site):

Expand CD8lA:

Primer:

R5’-GCGCTGGCGTCGTGGTTCGAGCAGGTGGATCGATC-3’(SEQ ID NO:3)

Template:

GCCACCATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCT CCACGCCGCCAGGC CGGTACGCAGGTGCCGCGATGCGTAGCGATCGATGCATCGG CATGCATGCATCGATCGATCGATCCACCTGCTCGA (SEQ ID NO:4)

Expand CD8 α hinge:

Primer:

F5’-GATCCACCTGCTCGAACCACGACGCCAGCGCCGCGACCAC-3’(SEQ ID NO:5)

R5’-CGCCCAGATGTAGATATCACAGGCGAAGTCCAGCCCCCTC-3’(SEQ ID NO:6)

Template:

ACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGC AGCCCCTGTCCCTGC GCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGC ACACGAGGGGGCTGGACTTCGCCTGTGAT(SEQ ID NO:7)

Expand CD8 transmembrane region:

Primer:

F5’-GACTTCGCCTGTGATATCTACATCTGGGCGCCCTTG-3’(SEQ ID NO:8)

R5’-CTTTCTGCCCCGTTTGCAGTAAAGGGTGATAACCAG-3’(SEQ ID NO:9)

Template:

ATCTACATCTGGGCGCCCTTGGCCGGGACTTGTGGGGTCCTTCTCCTGTCACT GGTTATCACCCTTTACTGC(SEQ ID NO:10)

Expand CD137:

Primer:

F5’-ATCACCCTTTACTGCAAACGGGGCAGAAAGAAACTC-3’(SEQ ID NO:11)

R5’-GCTGAACTTCACTCTCAGTTCACATCCTCCTTCTTC-3’(SEQ ID NO:12)

Template:

AAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGACC AGTACAAACTACTC AAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAA GAAGGAGGATGTGAACTG(SEQ ID NO:13)

Expand CD3 ζ:

Primer:

F5’-GGAGGATGTGAACTGAGAGTGAAGTTCAGCAGGAGC-3’(SEQ ID NO:14)

Template:

AGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACAAGCAGGGCCAG AACCAGCTCTATAACG AGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGG ACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAA AGCCGAGAAGGAAGAAC CCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACA GT GAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTT ACCAGGGTCTCAGTACAGCCACC AAGGACACCTACGACGCCCTTCACATGCAGGC CCTGCCCCCTCGC(SEQ ID NO:16)

Similarly, it is used as label convenient for observation to test the convenient GFP that can be added behind CAR skeleton, it is corresponding Design of primers is as follows:

It is the same to expand CD8lA, CD8 α hinge, CD8 transmembrane region, CD137 primer, subsequent CD3 ζ and GFP are connected using 2A peptide It connects.

Expand CD3 ζ:

Primer:

F5’-GGAGGATGTGAACTGAGAGTGAAGTTCAGCAGGAGC-3’(SEQ ID NO:17)

R5’-GTTAGTGGCATCGATGCGAGGGGGCAGGGCCTGCATG-3’(SEQ ID NO:18)

Template:

With SEQ ID NO:16.

Expand GFP:

Primer:

F 5’-GCCCTGCCCCCTCGCATCGATGCCACTAACTTCTC-3’(SEQ ID NO:19)

Template:

ATCGATGCCACTAACTTCTCCCTGTTGAAACAAGCAGGGGATGTCGAAGAGA ATCCCGGGCCAATGG TGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT CCTGGTCGAGCTGGACGGCGACGTAAACGGCCACA AGTTCAGCGTGTCCGGCGA GGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACC GGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGC AGTGCTTCAGCCGCTACCCC GACCACATGAAGCAGCACGACTTCTTCAAGTCCGC CATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTC AAGGACGACGGCAAC TACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATC GAGCT GAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTG GAGTACAACTACAACAGCCACAACGT CTATATCATGGCCGACAAGCAGAAGAACG GCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAG CGTGCAGCT CGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCC GACAACCACT ACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAG CGCGATCACATGGTCCTGCTGGAGTTCGTGA CCGCCGCCGGGATCACTCTCGGCAT GGACGAGCTGTACAAGTAA(SEQ ID NO:21)

The splicing of two: CAR skeleton of embodiment

The single CAR composition original part that above-mentioned amplification is obtained is using over-lapping PCR according to CD8lA, CD8 α Hinge, CD8 transmembrane region, amplification CD137, amplification CD3 ζ sequence pass through 5 wheel PCR and are spliced to form the CAR not comprising single-chain antibody Skeleton area, single-chain antibody are inserted through AarI and can realize seamless splicing, and the conventional double digestion avoided connects " the trace left Mark ", principle are that position is fixed around recognition site using the enzyme cutting position, this be it is different from the institute such as common EcoRI, Therefore it will not leave behind restriction enzyme site after single-chain antibody being connected to the slow virus carrier of the skeleton containing CAR.Utilize entire CAR The BamHI/FseI or seamless connection kit of skeleton upstream and downstream are connected and are ultimately formed into slow virus carrier pCDHF-0 (Fig. 1) Universal Lentiviral pCDHF-UPAarI (Fig. 2).

Embodiment three: the Lentiviral of the CD19 antigen containing identification is constructed

1) before synthesis is comprising four bases+identification CD19 single-chain antibody+CD8 α hinge behind AarI+CD8 Leader The genetic fragment of four base+AarI, gene order it is following (thickened portion is AarI restriction enzyme site,GAGTFor CD8 Leader Four bases next,GACAFor CD8 α hinge first four base):

2) using AarI respectively to synthesis back said gene segment and universal Lentiviral pCDHF- UPAarI, since genetic fragment and universal carrier pCDHF-UPAarI can leave four alkali after CD8 Leader after digestion Base and CD8 α hinge first four base and the cohesive end formed, therefore do not have extra unnecessary sequence, in this way process Ligase connects the slow virus carrier pCDHF-UPAarI-CD19 for ultimately forming specific recognition CD19 antigen.

3) prepared by slow virus: day before transfection bed board 293T, and density is 5 × 10⁶A/ware, next day rate to be converged be 80~ Carrying out plasmid transfection when 90%, expression vector and packaging plasmid mass ratio are 2:1:1, transfection reagent LIPO2000, LIPO3000 or PEI is 3:1 with plasmid total amount ratio, is incubated for 5min with 1.5ml Opti-MEM culture medium respectively, then by rouge Plastid, which is added in plasmid liquid, forms transfection working solution, and static incubation 25min is slowly added in plate further along culture dish edge, Jog is even, places 37 DEG C, 5%CO₂Incubator culture, next day change liquid, and it is slow virus stoste that 48h, which collects supernatant, and stoste is micro- Pore membrane filtering, ultrafiltration is up to slow virus concentrate.

4) slow virus titer determination: preparing one 24 orifice plates, and every hole is added 1.5 × 10⁵293T cell, supplemented medium is extremely 500ul, addition, which helps, turns agent to final concentration of 10ug/ml, and adding concentration gradient is 0.01,0.1,1,2,5ul viral concentration Liquid, while a negative control is set, light mix places 37 DEG C, 5%CO₂Incubator culture 48h, flow cytometer detection efficiency of infection take Efficiency of infection be 10%-30% calculate virus titer, be added 0.1ul concentrate, efficiency of infection 13.3%, titre be 2 × 10⁸TU/ml。

Example IV: CAR-T cell preparation

1) separation and activation of T cell: obtained peripheral blood mononuclear cells is counted, is added according to the ratio of 1:1 The beads for entering to be coupled CD3/CD28 antibody, gently shakes 20min, and using the suction-operated of magnetic frame, the T for obtaining the CD3 positive is thin Born of the same parents, T cell at this time are active, and are added complete medium (Lonza x-vivo15+IL-2), are trained to T cell Support amplification.It is CD3/CD28 key player on a team that the present embodiment, which sorts T, and the separation of T cell can also utilize EasySep^TMHuman T Cell Enrichment Kit carries out negative choosing from PBMC and obtains T cell.

2) after the T cell in PBMC being sorted and activated using the beads of coupling CD3/CD28 antibody, with Lonza x- Cell density is adjusted to 4 × 10 by 15 culture medium of vivo⁶Cell/mL, be added final concentration of 10ug/ml help turn agent and according to The slow virus for being packaged with CAR is added in the ratio of MOI=5:1, and it is 1 × 10 that complete medium to concentration is added after 4h⁶Cell/m, Next day changes liquid, and the state parallel type detection CAR expression of cell is observed after 48h, and CAR expression efficiency is as shown in Figure 3.

Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention., rather than its limitations；To the greatest extent Present invention has been described in detail with reference to the aforementioned embodiments for pipe, but those skilled in the art should understand that: its It is still possible to modify the technical solutions described in the foregoing embodiments, or to some or all of the technical features It is equivalently replaced；And these are modified or replaceed, various embodiments of the present invention skill that it does not separate the essence of the corresponding technical solution The range of art scheme.

SEQUENCE LISTING

<110>Shenzhen Fei Peng Biotherapies, Inc.

<120>construction method of the sequence of universal Chimeric antigen receptor is expressed

<160> 21

<170> PatentIn version 3.3

<210> 1

<211> 159

<212> DNA

<213>artificial sequence

<400> 1

gccaccatgg ccttaccagt gaccgccttg ctcctgccgc tggccttgct gctccacgcc 60

gccaggccgg tacgcaggtg ccgcgatgcg tagcgatcga tgcatcggca tgcatgcatc 120

gatcgatcga tccacctgct cgaaccacga cgccagcgc 159

<210> 2

<211> 33

<212> DNA

<213>artificial sequence

<400> 2

cgcggatccg ccaccatggc cttaccagtg acc 33

<210> 3

<211> 35

<212> DNA

<213>artificial sequence

<400> 3

gcgctggcgt cgtggttcga gcaggtggat cgatc 35

<210> 4

<211> 143

<212> DNA

<213>artificial sequence

<400> 4

gccaccatgg ccttaccagt gaccgccttg ctcctgccgc tggccttgct gctccacgcc 60

gccaggccgg tacgcaggtg ccgcgatgcg tagcgatcga tgcatcggca tgcatgcatc 120

gatcgatcga tccacctgct cga 143

<210> 5

<211> 40

<212> DNA

<213>artificial sequence

<400> 5

gatccacctg ctcgaaccac gacgccagcg ccgcgaccac 40

<210> 6

<211> 40

<212> DNA

<213>artificial sequence

<400> 6

cgcccagatg tagatatcac aggcgaagtc cagccccctc 40

<210> 7

<211> 135

<212> DNA

<213>artificial sequence

<400> 7

accacgacgc cagcgccgcg accaccaaca ccggcgccca ccatcgcgtc gcagcccctg 60

tccctgcgcc cagaggcgtg ccggccagcg gcggggggcg cagtgcacac gagggggctg 120

gacttcgcct gtgat 135

<210> 8

<211> 36

<212> DNA

<213>artificial sequence

<400> 8

gacttcgcct gtgatatcta catctgggcg cccttg 36

<210> 9

<211> 36

<212> DNA

<213>artificial sequence

<400> 9

ctttctgccc cgtttgcagt aaagggtgat aaccag 36

<210> 10

<211> 72

<212> DNA

<213>artificial sequence

<400> 10

atctacatct gggcgccctt ggccgggact tgtggggtcc ttctcctgtc actggttatc 60

accctttact gc 72

<210> 11

<211> 36

<212> DNA

<213>artificial sequence

<400> 11

atcacccttt actgcaaacg gggcagaaag aaactc 36

<210> 12

<211> 36

<212> DNA

<213>artificial sequence

<400> 12

gctgaacttc actctcagtt cacatcctcc ttcttc 36

<210> 13

<211> 126

<212> DNA

<213>artificial sequence

<400> 13

aaacggggca gaaagaaact cctgtatata ttcaaacaac catttatgag accagtacaa 60

actactcaag aggaagatgg ctgtagctgc cgatttccag aagaagaaga aggaggatgt 120

gaactg 126

<210> 14

<211> 36

<212> DNA

<213>artificial sequence

<400> 14

ggaggatgtg aactgagagt gaagttcagc aggagc 36

<210> 15

<211> 36

<212> DNA

<213>artificial sequence

<400> 15

ccgggccggc cttagcgagg gggcagggcc tgcatg 36

<210> 16

<211> 336

<212> DNA

<213>artificial sequence

<400> 16

agagtgaagt tcagcaggag cgcagacgcc cccgcgtaca agcagggcca gaaccagctc 60

tataacgagc tcaatctagg acgaagagag gagtacgatg ttttggacaa gagacgtggc 120

cgggaccctg agatgggggg aaagccgaga aggaagaacc ctcaggaagg cctgtacaat 180

gaactgcaga aagataagat ggcggaggcc tacagtgaga ttgggatgaa aggcgagcgc 240

cggaggggca aggggcacga tggcctttac cagggtctca gtacagccac caaggacacc 300

tacgacgccc ttcacatgca ggccctgccc cctcgc 336

<210> 17

<211> 36

<212> DNA

<213>artificial sequence

<400> 17

ggaggatgtg aactgagagt gaagttcagc aggagc 36

<210> 18

<211> 37

<212> DNA

<213>artificial sequence

<400> 18

gttagtggca tcgatgcgag ggggcagggc ctgcatg 37

<210> 19

<211> 35

<212> DNA

<213>artificial sequence

<400> 19

gccctgcccc ctcgcatcga tgccactaac ttctc 35

<210> 20

<211> 33

<212> DNA

<213>artificial sequence

<400> 20

ccgggccggc cttacttgta cagctcgtcc atg 33

<210> 21

<211> 783

<212> DNA

<213>artificial sequence

<400> 21

atcgatgcca ctaacttctc cctgttgaaa caagcagggg atgtcgaaga gaatcccggg 60

ccaatggtga gcaagggcga ggagctgttc accggggtgg tgcccatcct ggtcgagctg 120

gacggcgacg taaacggcca caagttcagc gtgtccggcg agggcgaggg cgatgccacc 180

tacggcaagc tgaccctgaa gttcatctgc accaccggca agctgcccgt gccctggccc 240

accctcgtga ccaccctgac ctacggcgtg cagtgcttca gccgctaccc cgaccacatg 300

aagcagcacg acttcttcaa gtccgccatg cccgaaggct acgtccagga gcgcaccatc 360

ttcttcaagg acgacggcaa ctacaagacc cgcgccgagg tgaagttcga gggcgacacc 420

ctggtgaacc gcatcgagct gaagggcatc gacttcaagg aggacggcaa catcctgggg 480

cacaagctgg agtacaacta caacagccac aacgtctata tcatggccga caagcagaag 540

aacggcatca aggtgaactt caagatccgc cacaacatcg aggacggcag cgtgcagctc 600

gccgaccact accagcagaa cacccccatc ggcgacggcc ccgtgctgct gcccgacaac 660

cactacctga gcacccagtc cgccctgagc aaagacccca acgagaagcg cgatcacatg 720

gtcctgctgg agttcgtgac cgccgccggg atcactctcg gcatggacga gctgtacaag 780

taa 783

Claims

1. a kind of construction method for the sequence for expressing universal Chimeric antigen receptor characterized by comprising

The nucleic acid sequence for each function fragment for not including the Chimeric antigen receptor (CAR) of antigen-binding domains is passed through into overlapping The CAR skeleton area that extension PCR anastomosing and splicing obtains；

IIs there are two being preset in the function fragment for being inserted into antigen-binding domains in CAR skeleton area The restriction enzyme site of type restriction enzyme.

2. construction method according to claim 1, which is characterized in that the function fragment containing it is one or more selected from by with The element of the group of lower composition:

Leader peptide, joint sequence, transmembrane domain, costimulation structural domain and signal transduction structural domain；

Preferably, the leader peptide is selected from CD8 leader Chimerical receptor signal peptide；

Preferably, the leader peptide is selected from the area hinge that joint sequence is selected from CD8；

Preferably, the transmembrane domain is selected from the transmembrane region of CD8；

Preferably, the costimulation structural domain be selected from CD27, CD28, CD137, OX40, CD30, CD40, PD-1, LFA-1, CD2, CD7, Lck, DAP10, ICOS, LIGHT, NKG2C, B7-H3, with any one of ligand of CD3 ζ specific binding or its Meaning combination；

Preferably, the signal transduction structural domain is selected from any one of PKC θ, Fc ε RI γ, ZAP70, CD3 ζ or its any group It closes；

Preferably, the function fragment include CD8 leader Chimerical receptor signal peptide, the area hinge of CD8, CD8 transmembrane region, CD137 and CD3 ζ；

Preferably, it for expanding the upstream primer of first function fragment at the 5 ' ends in CAR skeleton area, and is used for It expands in the downstream primer of first function fragment at the 3 ' ends in CAR skeleton area and is reserved with restriction enzyme site.

3. construction method according to claim 1 or 2, which is characterized in that the IIs type restriction enzyme is selected from Any one of AarI, BveI, Eam1104, Eco57I, EcoRII, SfiI.

4. construction method according to claim 1 or 2, the function fragment further includes reporter gene；

Preferably, the reporter gene is fluorescent reporter gene；

Preferably, the fluorescent reporter gene be selected from GFP, EGFP, RFP, mCherry, mStrawberry, Luciferase, Any one of mApple, mRuby, EosFP.

5. the sequence for the universal Chimeric antigen receptor of expression that any one of Claims 1 to 4 construction method constructs.

6. the universal Chimeric antigen receptor that sequence table described in claim 5 is reached.

7. the carrier containing sequence described in claim 5；

Preferably, the carrier includes retroviral vector or CRISPR/CAS plasmid；

Preferably, the retroviral vector is slow virus carrier；

Preferably, the CRISPR/CAS plasmid be selected from CRISPR/CAS-1, CRISPR/CAS-2, CRISPR/CAS-3, Any one of CRISPR/CAS-5, CRISPR/CAS-7, CRISPR/CAS-9, CRISPR/CAS-10.

8. nucleotide fragments of the insertion containing expression antigen-binding domains are obtained heavy into carrier as claimed in claim 7 Group carrier；

The two sides of the nucleotide fragments containing expression antigen-binding domains, which are provided with, to be referred in claim 1 or 10 The restriction enzyme site of IIs type restriction enzyme；

Preferably, the antigen-binding domains are sc-Fv or Fab antibody segment；

Preferably, wherein sc-Fv or Fab antibody segment be fitted into, humanization or human antibody segment；

Preferably, the nucleotide sequence of the nucleotide fragments of the expression antigen-binding domains is as shown in SEQ ID NO:1.

9. host cell is converted by recombinant vector according to any one of claims 8；

Preferably, the host cell is T cell, NK cell, NKT cell, CIK cell, DC-CIK cell.

10. Chimeric antigen receptor, the sequence as described in claim 5, which is inserted into mentioned in 8, contains expression antigen binding structure Expression obtains after the nucleotide fragments in domain.