CN109207498A

CN109207498A - A kind of preparation from bacillus high temperature resistant feed zytase

Info

Publication number: CN109207498A
Application number: CN201811325379.8A
Authority: CN
Inventors: 彭日荷; 姚泉洪; 田永生; 高建杰; 付晓燕; 许晶; 李振军; 韩红娟; 王波; 王丽娟; 朱彦满; 张福建; 黄悠楠
Original assignee: Shanghai Academy of Agricultural Sciences
Current assignee: Shanghai Academy of Agricultural Sciences
Priority date: 2018-11-08
Filing date: 2018-11-08
Publication date: 2019-01-15

Abstract

The invention discloses it is a kind of can in Pichia pastoris efficient secretory expression high temperature resistant acidic feed xylanase gene acquisition methods, detailed process is: by the gene from Bei Laisi bacillus xylanase gene elder generation's Optimizing Reconstruction at suitable Pichia anomala expression, then Evolution in vitro is oriented by gene, construct shellfish xylanase gene mutant library, it expresses and screens by saccharomyces cerevisiae library, obtain high temperature resistant acidic feed xylanase gene, this is gene constructed to yeast expression vector, realize the high efficient expression of high temperature resistant acidic feed xylanase gene.The xylan reaction optimum pH of expression reduces, and has heat-resisting quantity, and stable structure is suitble to be made into pellet.

Description

A kind of preparation from bacillus high temperature resistant feed zytase

Technical field

The invention belongs to microbiological genetic engineering fields, specifically utilize chemical synthesis process and mutation technique, Source Bei Laisi bacillus xylanase gene is transformed, makes it the high efficient expression in Pichia pastoris, the zytase of expression With heat-resisting quantity and optimal pH falls to 5.5, can be used for feed addition.

Background technique

Xylan is the important component of plant hemicellulose, be in nature in addition to cellulose polysaccharide the most abundant, It is important renewable resource.Cereal, pulse family class and oil crops are the primary raw materials in the food and animal feed of people.? In the cell wall of cereal, xylan accounts for very big specific gravity, xylan played during the growth metabolism of plant support and The effects of protection, but in grain trough when xylan too high levels, due to its high point degree, high retentiveness, it will increase livestock and poultry digestion The point degree of chyme in road, influences animal to the mesotrophic absorption of feed.

β-l, 4- endo-xylanase is most important a kind of enzyme during xylan hydrolysis, and specific effect is in wood The glycosidic bond of β-l, 4-D- xylose glycosidic bond on glycan main chain, xylan is thoroughly hydrolyzed to xylose, xylobiose and xylobiose with On wood oligose.Zytase has broad prospects in terms of the utilization rate that cheap byproduct was developed and improved to feed resource. More non-starch polysaccharide is usually contained in feed, mainly include araboxylan, beta glucan, alpha-galactoside, pectin, Cellulose etc..Wherein araboxylan and beta glucan account for the 30% of non-starch polysaccharide, and non-starch polysaccharide can be in conjunction with a large amount of Water increases the chyme volume in feeding animal alimentary canal, and viscosity increases, and forms gel, as a result causes the function of digestive ferment It cannot proceed normally, influence the absorption of stomach, chyme is caused to be detained in small intestine, so as to cause microbiological anomaly breeding, cause Growth of animal is obstructed, feed conversion rate reduces.Because nonruminant cannot decompose non-starch polysaccharide, non-starch polysaccharide just at For a kind of anti-nutritional factors.Studies have shown that if addition zytase, it is big can to significantly reduce araboxylan molecule in feed It is small, it is broken down into the xylo-oligosaccharide of the smaller degree of polymerization, so as to improve feed performance, eliminates or reduction causes because viscosity increases Anti-oxidant action.Zytase has broad application prospects in terms of the development and utilization of feed resource.

Report that producing the microorganism of zytase includes bacterium (Int J Polym Sci, 2015 (14), 655-661), chain Mould (Bioresource Technol, 2008,99 (5), 1252-1258), aspergillus (Indian J Microb, 2012,52 (4), 682-688), mould (Bioresources, 2015,10 (1), 1627-1643) and trichoderma (New Biotechnol, 20 13,30 (5): 523-530) etc..The composition and catalytic property of the zytase of separate sources are different.Most of microbe Zytase is monomeric protein, and molecular mass 8-145kDa, isoelectric point pI value 3-10, optimum temperature is 40-75 DEG C.No Catalysis characteristics with the zytase in source have very big difference, they have different most suitable action pH and optimum temperature, gold The influence for belonging to the xylanase activity of ion pair separate sources is also different.Contain multiple energy in the activated centre of zytase With the sublocus of Binding Capacity, the structure in these sites, size, the spatial relationship of quantity and they and catalytic group are determined The enzyme is to the affinity of different substrates, specificity, the mode of action and kinetic parameter of enzyme reaction etc..

The molecular structure of β-l, 4- endo-xylanase mainly includes catalytic domain (catalyitc domain, CD), fiber Plain combined area (cellulose binding domain, CBD), xylan combined area (xylan-binding domain, XBD), catenation sequence and repetitive sequence etc..The hydrolysis properties of zytase are mainly related to the structure of CD, and the wood of separate sources is poly- The CD of carbohydrase is basically unchanged in size and number, but the amino acid for wherein forming CD has diversity；Secondly, XBD is degrading Play a significant role during insoluble xylan.Zytase is divided according to amino acid identity in catalyst structure domain Endo-xylanase substantially can be divided into F family and G family two major classes by class.The CBD of F family zytase and activated centre by Hinge area is connected, and Substratspezifitaet is poor, and hydrolysis rate is fast, and product is the wood oligose of low molecule quality；G family zytase without Cellulase activity, molecular mass is generally lower, and Substratspezifitaet is very high, the homology of enzyme it is strong (Nucleic Acid Res, 2009,38(1),233-238).Aspergillus albicans (Aspergillus kawachii) the zytase XynC-C that generates have it is extensive PH adaptation range, higher activity can be kept under acid condition, but urge the xylan substrate other than araboxylan It is lower (Biosci Biotech Biochem, 1992,56 (4), 547) to change efficiency.And trichoderma pseudokiningii (Trichoderma pseudokoningii) zytase can be residual with the xylose of degrading maize branches and leaves cell wall 20%, but branches and leaves cell is shown from big Wall is merely able to the xylose residues (Curr Trend in Biotech Pharm, 2016,10 (3), 222) of degradation 10%.

Summary of the invention

The present invention uses Gene Exchange and gene recombinant methods in vitro, screens a kind of high efficient expression in saccharomycete High temperature resistant acidic xylanase gene.

The present invention is by vector construction, yeast is electroporated, high activity bacterial strain screening and etc. prepare production high temperature resistant Acidic xylanase gene methanol yeast bacterial strain.

The present invention is in order to improve the expression in yeast of phytase.According to the zytase of Bei Laisi bacillus BvxynA(AJD80562) amino acid sequence uses Pichia pastoris codon bias design Oligonucleolide primers length for 60 bases, By 20 bp overlaps, Tm value is 60-66 by all primers addition reaction system for connection between primer, carries out PCR amplification, 35 circulations are carried out altogether, synthesize xylanase gene.

The present invention is needed according to Yeast expression, optimization design xylanase gene.The principle of optimization includes: elimination gene The recognition site of internal common restriction enzyme constructs convenient for expression cassette；It eliminates inverted repeat sequence, loop-stem structure and turns Termination signal is recorded, keeps the GC/AT of gene internal balanced, improves the stability of RNA；Avoid 2,3 with CG and TA dual oligonucleotide (CG easily causes methylation in plant)；Gene coded protein is set to meet N-terminal principle, to improve the stability of translation albumen；It is excellent Change mRNA secondary structure free energy, to improve gene expression efficiency.

With the xylanase gene of synthesisBvxynAFor template, with the universal primer PBSKZ18 on cloning vector: GCGATTAAGTTGGGTAACGCC；PBSKF18:GGAAA GCGGGCAGTGAGCGCAACG expands xylanase geneBvxynA, all genetic fragments are subjected to DNA molecular using taq archaeal dna polymerase at 10-50bp small fragment with DNaseI digestion It resets, shocks by electricity into colibacillus, construct mutant gene bank.

All rearrangement DNA moleculars of digestion, the Yeast expression carrier that segment insertion Escherichia coli-Saccharomyces cerevisiae is shuttled PVT102U/ α (patent 201510230599.8), transformed saccharomyces cerevisiae by high-temperature process, and carry out enzyme in acid condition Activity determination is mutated strain, the final zytase for obtaining high temperature resistant acidic by the zytase of Large-scale Screening high activity Gene BvxynA54 completes mutant gene sequence measurement.

Go out primer by the both ends sequence design of mutated gene, the point of contact Χ hol is added at the end gene 5` and signal state cuts sequence Column, primer BvxynAZ, at the end the gene 3` addition point of contact Not I, primer BvxynAF, after amplified fragments are cloned,Χho I WithNot I double digestion, orientation insertion Pichia pastoris secretion expression carrier pPYPX88(GenBank:AY178633), it is built into The Yeast expression carrier (Fig. 1) of mutant xylanase gene BvxynA54 selects phytase height expression recombination yeastP. PastorisStrain, the zytase of expression specific enzyme activity with higher, heat-resisting quantity and optimal reaction pH are 5.5.

The present invention has the beneficial effect that:

It is had the advantage that by resetting the xylanase gene obtained outside the transformation of preference password and genosome

1. new xylanase gene BvxynA54 is suitble to the high efficient expression in Pichia pastoris.

2. gene expression product has very high high temperature resistance, zytase is residual after 30 minutes after 90 DEG C of high-temperature process Viability reaches 85%, and is suitble to acidic environment, can be used as feed enzyme additive.

Detailed description of the invention:

Fig. 1 is built into xylanase gene BvxynA54 yeast expression vector pYPXYN54.

Fig. 2 SDS-PAGE detects xylanase gene BvxynA54 Pichia anomala expression.

Xylanase activity under Fig. 3 different pH condition.

Zytase residual activity is analyzed after 90 DEG C of high-temperature process of Fig. 4.

Fig. 5 metal ion is on the active influence of zytase BvxynA54

Specific embodiment

Embodiment 1: the BvxynA chemical synthesis of xylanase gene

Zytase BvxynA gene is synthesized using PCR is extended continuously.Design primer length is 60 bp, and gene both ends introduce Xho I and SacI restriction enzyme site.By 20 bp overlaps, Tm value is 60-66 for connection between primer and primer.All primers are added Enter reaction system, intermediate primer amount is 10-20 ng, and the primer amount of two sides is 100-200ng.PCR reaction system is 100 μ L. PCR amplification condition is 94 DEG C, 30s；65 DEG C, 30s；72 DEG C, 2min.35 circulations are carried out altogether.PCR amplification is high-fidelity with enzyme Taq DNA polymerase.Pcr amplified fragment is cloned into conventional carrier pUC18 by TA cloning process.Determined dna sequence is true Determine synthetic gene sequence correctness.

Synthesize gene primer are as follows:

Xyn1:CTCGAGAAAAGAGAGGCTGAAGCTGCTGGTACTGACTACTGGCAGAACTGG ACTGATGGT(SEQ ID Shown in NO.1)

Xyn2:AGTTACCACCAGAACCATTGACAGCGTTGACAGTACCACCACCATCAGTCC AGTTCTGCC(SEQ ID Shown in NO.2)

Xyn3:CAATGGTTCTGGTGGTAACTACTCTGTCAACTGGTCCAATACTGGTAACTT CGTCGTTGG(SEQ ID Shown in NO.3)

Xyn4:GTTGATGGTTCTGAATGGAGAACCGGTGGTCCAGCCTTTACCAACGACGAA GTTACCAGT(SEQ ID Shown in NO.4)

Xyn5:CTCCATTCAGAACCATCAACTACAATGCTGGTGTCTGGGCTCCTAATGGCA ATGGCTACT(SEQ ID Shown in NO.5)

Xyn6:TACTCGATGAGTGGTGCTCTGGTCCAGCCATACAGAGTCAAGTAGCCATTG CCATTAGGA(SEQ ID Shown in NO.6)

Xyn7:AGAGCACCACTCATCGAGTACTATGTTGTTGACTCTTGGGGTACTTACAGA CCAACTGGT(SEQ ID Shown in NO.7)

Xyn8:CATAAGTACCACCATCGGACTTGACAGTACCTTTGTAAGTACCAGTTGGTC TGTAAGTAC(SEQ ID Shown in NO.8)

Xyn9:GTCCGATGGTGGTACTTATGACATCTACACCACTACCAGATACAATGCTCC ATCCATCGA(SEQ ID Shown in NO.9)

Xyn10:TCTGACAGACCAGTACTGAGTGAAAGTGGTGTTGTCACCATCGATGGATG GAGCATTGTA(SEQ ID Shown in NO.10)

Xyn11:CTCAGTACTGGTCTGTCAGACAGTCCAAGAGACCAACTGGTTCCAACGCT GCTATCACCT(SEQ ID Shown in NO.11)

Xyn12:TTCATACCATGAGACTTCCAAGCATTGACATGATTGGAGAAGGTGATAGC AGCGTTGGAA(SEQ ID Shown in NO.12)

Xyn13:TGGAAGTCTCATGGTATGAATCTTGGCTCCAACTGGGCTTACCAAGTCTT GGCTACTGAA(SEQ ID Shown in NO.13)

Xyn14:GAGCTCTTACCAAACAGTGACGTTGGAAGAACCAGAGGACTTGTAGCCTTCAGTAGCCAAGACTTG Shown in GT(SEQ ID NO.14)

Embodiment 2: the external shuffled library building of the BvxynA of xylanase gene

2.1 PCR amplification phytase genes and recycling

Universal primer is designed at pUC18 cloning vector both ends, the BvxynA for expanding the xylanase gene of synthesis is template, primer Sequence are as follows: shown in PBSKZ18:GCGATTAAGTTGGGTAACGCC(SEQ ID NO.15)；PBSKF18: Shown in GGAAAGCGGGCAGTGAGCGCAACG(SEQ ID NO.16), reaction condition are as follows: 94 DEG C of 10min initial denaturations, 94 DEG C It is denaturalized 30s, 30s and 72 DEG C of extension 90s of 50 DEG C of annealing, totally 30 circulations, 1% Agrose electrophoresis, saturating suction bag method recycles 588bp Genetic fragment.

2.2 DNase I degradation of dna and recycling small fragment

Genetic fragment is recycled with DNase I buffer (50mmol/L Tris-Cl pH7.4+1mmol/L MgCl₂ )100μl Dissolution；0.1U DNase I is added, 25 DEG C are handled 15 minutes.70 DEG C are handled 10 minutes.10% acryl amide electrophoresis, saturating suction bag method Recycle the small fragment of 10-50bp.With 10 μ l 10 × primer free PCR buffer (Primerless PCR Buffer) (50mmol/ L KCl+10mmol/LTris-Cl pH9.0+1% Triton) dissolution precipitating.

2.3 primer free PCR (Primerless PCR)

The DNase I degradation fragment of gene is mixed by equal proportion, carries out Primerless PCR amplification.Reaction system: 5 μ l Small fragment DNA+4 μ l 2.5mmol/L dNTPs+4.5 μ l 25mmol/LMgCl₂+ Taq2U +ddH₂O to 50μl；Reaction Program are as follows: 94 DEG C of 30s, 40 DEG C of 30s, 72 DEG C of 30s, totally 45 recycle), 2%Agrose electrophoresis detection PCR amplification result.

2.4 have primer PCR (Primer PCR)

Carry out Primer pcr amplification reaction.Reaction system: 5 μ lPrimerless PCR product+phyiZ1,0.2 ng+ phyiF1 0.2ng+10×PCR Buffer 5μl +2.5mmol/L dNTPs 4μl+Taq2U+ ddH₂O to 50μl.Instead Answer program are as follows: 94 DEG C of 30s, 70 DEG C of 30s, 72 DEG C of 2.0min, totally 35 circulations, 1%Agrose electrophoresis detection recycle 588 genes Segment.

The rearrangement xylanase gene segment of 588 bp is recycled, TA clone is connected to pUC18 cloning vector, which has Ampicillin resistance gene.Electric shocking method converts coli strain DH5 α and obtains mutant library, and storage capacity reaches 10⁸。

Zytase mutant gene bank on escherichia coli cloning plasmid library is double digested, recycling mutation phytase base The Yeast expression carrier PVT102U/ α (patent that the endonuclease bamhi of cause shuttles in Escherichia coli-Saccharomyces cerevisiae 201510230599.8) on the basis of construct mutant xylanase gene yeast secreted expression plasmid library.

Embodiment 3: the screening of high temperature resistant acidic xylanase gene

Mutated library is transformed into saccharomyces cerevisiae, obtains Saccharomyces cerevisiae transformant of mutant xylanase gene.

Positive yeast single colonie is carried out Liquid Culture o'clock in 40 orifice plates respectively, and (different parts on every block of plate set 3 A control), plate is placed in the determination of activity heated 30 min at 90 DEG C and carry out enzyme after culture.Specific step is as follows: taking 150 μ l SD culture solution, 40 well culture plates are added in each hole equivalent, to Yeast Growth to OD₆₀₀Plate is placed at 90 DEG C by=0.4-0.6 Heat 30 min.10 μ l bacterium solutions are taken out from the hole of culture plate and are transferred to new 40 well culture plate, and pH6 Tris-HCL buffering is added Diluted 1% xylan liquid, the 10 μ l of liquid after setting 50 DEG C of water-baths heat preservation 30min, adds 200 μ l of DNS to develop the color in boiling water bath 3min, After tap water cooling, add distilled water constant volume 25ml, surveys O.D value.DNS solution: C7H4N2O7 (3,5- dinitros are accurately weighed Base salicylic acid) 20 g, it is added in 1.5 L ddH2O, then dissolution weighs 32 g NaOH, is added and dissolves, then gradually add Enter 10 g of sodium sulfite, 10 g of phenol, 600 g of sodium potassium tartrate tetrahydrate, be slowly heated, temperature is to 45 DEG C, it is ensured that above-mentioned drug can be complete Fully dissolved is settled to 2L, solution is put into brown bottle, room temperature preservation after two weeks, can use after cooling.

The fire resistant xylanase yeast strain DNA obtained is extracted, DNA is transformed into Escherichia coli, extracts plasmid, is carried out Mutant gene sequence measurement, the xylanase gene nucleotide sequence of acquisition is as shown in SEQ ID NO.17, and amino acid sequence is such as Shown in SEQ ID NO.20.

Embodiment 4: Yeast expression zytase vector construction

By the both ends primers of mutated gene, the point of contact Xho I and signal state cutting sequence, primer is added at gene 5 ' end Are as follows: BvxynmZ:(5 '-AACTCGAGAAAAGAGAGGCTGAAGCT GCTGGTACTGACTACTG-3 ') (SEQ ID NO.18 It is shown), it is held in gene 3 ' and the point of contact NotI: primer are as follows: BvxynmF:(5 '-AACGCGGCCGCTTACCAAACAGTGACGTT is added GGAAGAACCAGAG -3 ') (shown in SEQ ID NO.19).After amplified fragments clone, Xho I and Not I double digestion, orientation It is inserted into pPYPX88(GenBank:AY178633), which is transformed secreting signal peptide, in MF4I atg start codon Three amino acid after increasing pichia yeast AOX1 Gene A TG after ATG, respectively A, I and P, furthermore in MF4I signal peptide Centre increases 10 amino acid of EEAEAEAEPK.It is built into zytase Yeast expression carrier pYPXYN54(Fig. 1).

Embodiment 5: zytase height expresses recombination yeast screening

By the yeast strain of activationPichia Pastoris30 DEG C of 18 hr of culture in 500 ml YPD, until OD₆₀₀=1.7, Thalline were collected by centrifugation by 5000 r/min, and supernatant is gone in the sterile washing thallus being successively pre-chilled with 500,250 ml, centrifugation, with 20 1 mol/L sorbierite suspension thalline of ml pre-cooling.The sorbierite that thallus uses 0.5 ml to be pre-chilled again after centrifugation suspends, for shocking by electricity Competence.

A large amount of extracting Yeast expression carrier pYPXYN54, BglIISmall fragment is recycled in digestion, and 2 μ g linearized fragments is taken to be added 50 μ L competent cells, 5 min of ice bath are shocked by electricity with Bio-Red GenePulser electric shock instrument, parameter 2.5Kv, 25 μ F.Electric shock After be added immediately 1.0 ml pre-cooling 1 mol/L sorbierite, take 200 μ L to be coated on solid selection medium plate (18.6% sorbierite, 2% glucose, 1.34%YNB, 0.005% glutamic acid, 0.005% methionine, 0.005% lysine, 0.005% leucine, 0.005% isoleucine, 2% agarose), 30 DEG C of cultures are until transformant occurs.With toothpick by transformant pair Answer dibbling to MM(1.34%YNB, 0.00004% biotin, 0.5% methanol, 1.5% agarose) and MD(1.34%YNB, 0.00004% Biotin, 2% glucose, 1.5% agarose) on plate, 30 DEG C of culture 2d grow normal on MD and grow on MM not just Normal transformant is positive colony.

Recombination yeast is inoculated in 20ml BMGY, and (1% yeast extract, 2% peptone, 1.34%YNB 0.000004% are raw Object element, 1% glycerol), 30 DEG C of cultures, thalline were collected by centrifugation, and 20ml induced medium BMMY(is added with 0.5% methanol and replaces BMGY In glycerol), continue 36 hr of Fiber differentiation at 30 DEG C.

Corresponding culture is carried out using methanol as the MM culture medium of sole carbon source and by the MD culture medium of carbon source of glucose, into one Recombinant conversion of step screening site-directed integration.

All positive colonies are individually inoculated in triangular flask, 30 DEG C of cultures are trained to OD600=4-5 using methanol induction 36 hr are supported, each inducible strain takes 5 μ l supernatants to carry out SDS-PAGE detection, takes 10 μ l supernatants to dilute 100 times, separately with wood Glycan is that substrate carries out enzyme assay.Xylanase activity measuring method takes DNS method (BASF Company).It takes dilute Enzyme solution 0.1ml is released, 1% xylan liquid 0.9ml is added, after setting 50 DEG C of water-bath heat preservation 30min, DNS 2ml is added to develop the color in boiling water bath 3min adds distilled water constant volume 25ml after tap water cooling, surveys O.D value.

DNS solution: C is accurately weighed₇H₄N₂O₇1.5 L ddH are added in (3,5- dinitrosalicylic acid) 20 g₂In O, Dissolution, then weighs 32 g NaOH, is added and dissolves, be then gradually added into 10 g of sodium sulfite, 10 g of phenol, potassium tartrate 600 g of sodium, slow heating, temperature is to 45 DEG C, it is ensured that above-mentioned drug can be completely dissolved, and after cooling, be settled to 2L, solution is put Enter in brown bottle, room temperature preservation after two weeks, can use.

Unit of xylanase activity (U) is defined as: hydrolyzed xylan per minute generates 1 μm of comparable enzyme amount of ol xylose institute.

Embodiment 6: properties of xylanase measurement

Substrate is configured to pH=2.5 respectively; 3; 3.5; 4; 4.5; 5; 5.5; 6; 6.5; 7; 7.5; 8; 9; 10; 11 with pH=6 when enzyme-activity unit be 100%, with high density fermentation supernatant measure condition of different pH under zytase it is opposite Vigor.The result shows that the zytase has enzyme activity between pH4.5-11, and when pH value is 5.5, xylanase activity highest (Fig. 3).

The optimum temperature of zytase BsxynA is 50 DEG C.Enzyme stability at high temperature, when temperature is greater than at 60 DEG C When reason, enzyme activity is higher than room temperature activity.5 minutes when 80 DEG C of processing, enzymatic activity highest.Supernatant is handled 30 minutes with 90 DEG C, Cooled on ice is placed, enzyme reaction substrate is added, 50 DEG C of 30 min of reaction are measured using the fermentation liquid without high-temperature process as reference Remaining enzymatic activity in supernatant.For enzyme solution by 90 DEG C of 30 min of high-temperature process processing, the activity of zytase is untreated 650% (Fig. 4) of enzymatic activity.

Sequence table

<110>Academy of Agricultural Sciences, Shanghai City

<120>a kind of preparation from bacillus high temperature resistant feed zytase

<130> 2018

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 60

<212> DNA

<213>artificial sequence (artificial DNA)

<400> 1

ctcgagaaaa gagaggctga agctgctggt actgactact ggcagaactg gactgatggt 60

<210> 2

<211> 60

<212> DNA

<213>artificial sequence (artificial DNA)

<400> 2

agttaccacc agaaccattg acagcgttga cagtaccacc accatcagtc cagttctgcc 60

<210> 3

<211> 60

<212> DNA

<213>artificial sequence (artificial DNA)

<400> 3

caatggttct ggtggtaact actctgtcaa ctggtccaat actggtaact tcgtcgttgg 60

<210> 4

<211> 60

<212> DNA

<213>artificial sequence (artificial DNA)

<400> 4

gttgatggtt ctgaatggag aaccggtggt ccagccttta ccaacgacga agttaccagt 60

<210> 5

<211> 60

<212> DNA

<213>artificial sequence (artificial DNA)

<400> 5

ctccattcag aaccatcaac tacaatgctg gtgtctgggc tcctaatggc aatggctact 60

<210> 6

<211> 60

<212> DNA

<213>artificial sequence (artificial DNA)

<400> 6

tactcgatga gtggtgctct ggtccagcca tacagagtca agtagccatt gccattagga 60

<210> 7

<211> 60

<212> DNA

<213>artificial sequence (artificial DNA)

<400> 7

agagcaccac tcatcgagta ctatgttgtt gactcttggg gtacttacag accaactggt 60

<210> 8

<211> 60

<212> DNA

<213>artificial sequence (artificial DNA)

<400> 8

cataagtacc accatcggac ttgacagtac ctttgtaagt accagttggt ctgtaagtac 60

<210> 9

<211> 60

<212> DNA

<213>artificial sequence (artificial DNA)

<400> 9

gtccgatggt ggtacttatg acatctacac cactaccaga tacaatgctc catccatcga 60

<210> 10

<211> 60

<212> DNA

<213>artificial sequence (artificial DNA)

<400> 10

tctgacagac cagtactgag tgaaagtggt gttgtcacca tcgatggatg gagcattgta 60

<210> 11

<211> 60

<212> DNA

<213>artificial sequence (artificial DNA)

<400> 11

ctcagtactg gtctgtcaga cagtccaaga gaccaactgg ttccaacgct gctatcacct 60

<210> 12

<211> 60

<212> DNA

<213>artificial sequence (artificial DNA)

<400> 12

ttcataccat gagacttcca agcattgaca tgattggaga aggtgatagc agcgttggaa 60

<210> 13

<211> 60

<212> DNA

<213>artificial sequence (artificial DNA)

<400> 13

tggaagtctc atggtatgaa tcttggctcc aactgggctt accaagtctt ggctactgaa 60

<210> 14

<211> 68

<212> DNA

<213>artificial sequence (artificial DNA)

<400> 14

gagctcttac caaacagtga cgttggaaga accagaggac ttgtagcctt cagtagccaa 60

gacttggt 68

<210> 15

<211> 21

<212> DNA

<213>artificial sequence (artificial DNA)

<400> 15

gcgattaagt tgggtaacgc c 21

<210> 16

<211> 24

<212> DNA

<213>artificial sequence (artificial DNA)

<400> 16

ggaaagcggg cagtgagcgc aacg 24

<210> 17

<211> 588

<212> DNA

<213>artificial sequence (artificial DNA)

<400> 17

ctcgagaaaa gagaggctga agctgctggt actgactact ggcagaactg gactgatggt 60

ggtggtactg tcaacgctgt caatggttct ggtggtaact actctgtcaa ctggtccaat 120

actggtgact tcgtcgttgg taaaggctgg accaccggtt ctccattcag aaccatcaac 180

tacaatgctg gtgtctgggc tcctaatggc aatggctact tgactctgta tggctggacc 240

agagcaccac tcatcgagta ctatgttgtt gactcttggg gtacttacag accaactggt 300

acttacaaag gtactgtcaa gtccgatggt ggtacttatg acatctacac cactaccaga 360

tacaatgctc catccatcga tggtgacaac accactttca ctcagtactg gtctgtcaga 420

cagtccaaga gaccaactgg ttccaacgct gctatcacct tctccaatca tgtcaatgct 480

tggaagtctc atggtatgaa tcttggctcc aactgggctt accaagtctt ggctactgaa 540

ggctacaagt cctctggttc ttcgcacgtc actgtttggt aagagctc 588

<210> 18

<211> 43

<212> DNA

<213>artificial sequence (artificial DNA)

<400> 18

aactcgagaa aagagaggct gaagctgctg gtactgacta ctg 43

<210> 19

<211> 42

<212> DNA

<213>artificial sequence (artificial DNA)

<400> 19

aacgcggccg cttaccaaac agtgacgttg gaagaaccag ag 42

<210> 20

<211> 191

<212> PRT

<213>artificial sequence (Artificial protein)

<400> 20

Lys Arg Glu Ala Glu Ala Ala Gly Thr Asp Tyr Trp Gln Asn Trp Thr

1 5 10 15

Asp Gly Gly Gly Thr Val Asn Ala Val Asn Gly Ser Gly Gly Asn Tyr

20 25 30

Ser Val Asn Trp Ser Asn Thr Gly Asp Phe Val Val Gly Lys Gly Trp

35 40 45

Thr Thr Gly Ser Pro Phe Arg Thr Ile Asn Tyr Asn Ala Gly Val Trp

50 55 60

Ala Pro Asn Gly Asn Gly Tyr Leu Thr Leu Tyr Gly Trp Thr Arg Ala

65 70 75 80

Pro Leu Ile Glu Tyr Tyr Val Val Asp Ser Trp Gly Thr Tyr Arg Pro

85 90 95

Thr Gly Thr Tyr Lys Gly Thr Val Lys Ser Asp Gly Gly Thr Tyr Asp

100 105 110

Ile Tyr Thr Thr Thr Arg Tyr Asn Ala Pro Ser Ile Asp Gly Asp Asn

115 120 125

Thr Thr Phe Thr Gln Tyr Trp Ser Val Arg Gln Ser Lys Arg Pro Thr

130 135 140

Gly Ser Asn Ala Ala Ile Thr Phe Ser Asn His Val Asn Ala Trp Lys

145 150 155 160

Ser His Gly Met Asn Leu Gly Ser Asn Trp Ala Tyr Gln Val Leu Ala

165 170 175

Thr Glu Gly Tyr Lys Ser Ser Gly Ser Ser Ala Val Thr Val Trp

180 185 190

Claims

1. a kind of encode following high temperature resistant acidic feed xylanase gene sequence, shown in SEQ ID NO.17:

ctcgagaaaa gagaggctga agctgctggt actgactact ggcagaactg gactgatggt 60

ggtggtactg tcaacgctgt caatggttct ggtggtaact actctgtcaa ctggtccaat 120

actggtgact tcgtcgttgg taaaggctgg accaccggtt ctccattcag aaccatcaac 180

tacaatgctg gtgtctgggc tcctaatggc aatggctact tgactctgta tggctggacc 240

agagcaccac tcatcgagta ctatgttgtt gactcttggg gtacttacag accaactggt 300

acttacaaag gtactgtcaa gtccgatggt ggtacttatg acatctacac cactaccaga 360

tacaatgctc catccatcga tggtgacaac accactttca ctcagtactg gtctgtcaga 420

cagtccaaga gaccaactgg ttccaacgct gctatcacct tctccaatca tgtcaatgct 480

tggaagtctc atggtatgaa tcttggctcc aactgggctt accaagtctt ggctactgaa 540

ggctacaagt cctctggttc ttcgcacgtc actgtttggt aagagctc 588。

2. high temperature resistant acidic feed xylanase gene according to claim 1, it is characterized in that deriving from Bei Laisi gemma Bacillus gene encodes the amino acid of albumen as shown in SEQ ID NO.20, by in-vitro directed screening, sports asparagus fern at 51 Propylhomoserin；187 mutation alanine.

3. high temperature resistant acidic feed xylanase gene according to claim 1, it is characterised in that high temperature resistant acidic feed Include: with the method that xylan obtains

, Bei Laisi bacillus xylanase gene derived from using chemical synthesis and structure optimization；

B, using above-mentioned synthesis Bei Laisi bacillus xylanase gene as template, DNA is carried out using the in-vitro directed reorganization of gene Molecular rearrangement is oriented screening to rearranged gene using saccharomyces cerevisiae, obtains high temperature resistant acidic xylanase gene.

4. Ju xylanase gene described in claim 1, it is characterised in that be assembled into Yeast expression carrier and be built into ferment Female expression vector pYPXYN54 after being integrated on Pichia chromosome, can screen the base of highly effective expression of xylanase gene Because of engineered strain.

5. Ju xylanase gene engineering strain as claimed in claim 4, the zytase of expression have high temperature resistance with And optimum pH 5.5.